[Fri Oct 9 13:11:10 PDT 2026] Qui4 (Qui/Quilhua) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 35048248 total bases: 5292285448 Q20 bases: 5230975709(98.8415%) Q30 bases: 5060616798(95.6225%) Q40 bases: 5060616798(95.6225%) Read2 before filtering: total reads: 35048248 total bases: 5292285448 Q20 bases: 5219882616(98.6319%) Q30 bases: 5037176361(95.1796%) Q40 bases: 5037176361(95.1796%) Read1 after filtering: total reads: 34443887 total bases: 4749972299 Q20 bases: 4710155819(99.1618%) Q30 bases: 4580106113(96.4238%) Q40 bases: 4580106113(96.4238%) Read2 after filtering: total reads: 34443887 total bases: 4751396487 Q20 bases: 4706455796(99.0542%) Q30 bases: 4562199303(96.0181%) Q40 bases: 4562199303(96.0181%) Filtering result: reads passed filter: 68887774 reads failed due to low quality: 556584 reads failed due to too many N: 1360 reads failed due to too short: 650778 reads with adapter trimmed: 9947087 bases trimmed due to adapters: 196331194 Duplication rate: 4.51384% Insert size peak (evaluated by paired-end reads): 183 JSON report: output/13-wgbs/fastp/Qui4.fastp.json HTML report: output/13-wgbs/fastp/Qui4.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui4 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui4 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Qui4_R1.fq.gz -O output/13-wgbs/trimmed/Qui4_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Qui4.fastp.json --html output/13-wgbs/fastp/Qui4.fastp.html fastp v1.0.1, time used: 67 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Qui4_R1.fq.gz output/13-wgbs/trimmed/Qui4_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Qui4-1123626 Temporary files will be written into the directory: /tmp/13-wgbs-Qui4-1123626/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui4_R1.fq.gz and output/13-wgbs/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui4_R1.fq.gz and output/13-wgbs/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui4_R1.fq.gz and output/13-wgbs/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui4_R1.fq.gz and output/13-wgbs/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui4_R1.fq.gz and output/13-wgbs/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui4_R1.fq.gz and output/13-wgbs/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui4_R1.fq.gz and output/13-wgbs/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui4_R1.fq.gz and output/13-wgbs/trimmed/Qui4_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4305486) Finished subdividing output/13-wgbs/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui4_R1.fq.gz<) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4305486) Finished subdividing output/13-wgbs/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui4_R1.fq.gz<) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui4_R1.fq.gz for PID: 1124794 and offset 8 (sequences written out: 4305485) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.7 to /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.1 to /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.3 to /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui4_R2.fq.gz for PID: 1124794 and offset 8 (sequences written out: 4305485) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.8 to /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.5 to /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.4 to /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.6 to /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.2 to /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.2_C_to_T.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.7 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.7 to /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.1 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.1 to /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.3 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.3 to /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.8 (4305485 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.8 to /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.5 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.5 to /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.4 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.4 to /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.6 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.6 to /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.2 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.2 to /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.2_G_to_A.fastq Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.7 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.7_C_to_T.fastq and Qui4_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.1 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.1_C_to_T.fastq and Qui4_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.3 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.3_C_to_T.fastq and Qui4_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.8 (4305485 sequences in total) Input files are Qui4_R1.fq.gz.temp.8_C_to_T.fastq and Qui4_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.5 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.5_C_to_T.fastq and Qui4_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.4 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.4_C_to_T.fastq and Qui4_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.6 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.6_C_to_T.fastq and Qui4_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.2 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.2_C_to_T.fastq and Qui4_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:4738:1056_1:N:0:GGTACACG+ANCAGCGC/1 99 Chromosome_9B_CT_converted 77538608 1 141M = 77538604 -145 TTAATGGTAAATGAAAGATATTAGTAAATTTAATGTTATATTGAATAAGAGATTAATTTGTTTAGTAAATAAGATATTGTAGTGTAAATTTTTTTGAATGTGGTGTTTTAATATTTTGAATTTATATATATATATTGTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*II*IIII9I9II*9III99III*II***II*999*I9*9*9***99***9*99** AS:i:-30 XS:i:-30 XN:i:0 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:40G31A20A14A7G24 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:4738:1056_2:N:0:GGTACACG+ANCAGCGC/2 147 Chromosome_9B_CT_converted 77538604 1 141M = 77538608 145 TGATTTAATGGTAAATGAAAGATATTAGTAAATTTAATGTTATATTGAATAAGAGATTAATTTGTTTAGTAAATAAGATATTGTAGTGTAAATTTTTATGAATGTGGTGTTTAAATATTTGGAATTTATATATATATATTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:44G31A64 YS:i:-30 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:29129:1042_1:N:0:GGTACACG+ANCAGCGC/1 99 Chromosome_6A_CT_converted 32714402 6 9M7I125M = 32714510 249 AATTGTATTAAAAAAAAAAAAAAAAATGTAATAGATATTAATTTGTAAAAATTTATATTGTTTAAATATATATATAGTATTAAATTTTTTGTAGTAGTTAAATATTGATTTGTTAGAAGTTTTAAAGGTTATATAATAGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9*IIIIIIII9IIIIIIIIIIIII*IIII9III9I9IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII AS:i:-32 XS:i:-12 XN:i:0 XM:i:1 XO:i:1 XG:i:7 NM:i:8 MD:Z:119A14 YS:i:-18 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29129:1042_2:N:0:GGTACACG+ANCAGCGC/2 147 Chromosome_6A_CT_converted 32714510 6 141M = 32714402 -249 GAAGTTTTAAAGGTTATATAATAGTTAAGTGATTGTTTTTAGTAGTAGTTAAATATTGATTTTTTTAAATTTATAAATGATATATGTATGTAAGTGATGTAGTTTTTAGTAGTAGTTAAATATTGATTTGTTTAAGTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-18 XS:i:-18 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:11A50G13T64 YS:i:-32 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:3346:1056_1:N:0:GGTACACG+ANCAGCGC/1 99 Chromosome_7B_CT_converted 68992519 24 141M = 68992595 211 AAATTTAATATGTATATTTTTTGTAATAATAGAATTATTTATTTTAAAATTATTTTAGATTTTAGAATTAATTGTGAAATGTAGGAAATGATTATTTGAGGAATTTAAAGGTATTTTTAAGTTATTTTTTTAGTAATTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:126A5A8 YS:i:-41 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:3346:1056_2:N:0:GGTACACG+ANCAGCGC/2 147 Chromosome_7B_CT_converted 68992595 24 100M6I35M = 68992519 -211 AAATGTAGGAAATGATTATTTGAGGAATTTAAAGGTATTTTTAAGTTATTTTTTTAGTAATTTTAAAATAATATTTGAAATAAAAGAATATAATGTTTGAATATATATAAGTATTTTAGTAAAATGAAGTATTGTAATTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-41 XN:i:0 XM:i:3 XO:i:1 XG:i:6 NM:i:9 MD:Z:50A5A49G28 YS:i:-12 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:49872:1042_1:N:0:GGTACACG+AGCAGCGC/1 77 * 0 0 * * 0 0 TTGGTAATGGTGAAAGTTTTTTGAGAGGGATTAAAATAAATAATATATAATTAATTAATTAATGGAGTTTATGGTTGTGGTAGTGAAGGTTTTTTATAGTGTTAATGTTTATTGTGATATGGGATTTTTTTTTTTTTTT IIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIII9IIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:49872:1042_2:N:0:GGTACACG+AGCAGCGC/2 141 * 0 0 * * 0 0 AAAAATCCCATATCACAATAAACATTAACACTATAAAAAACCTTCACTACCACAACCATAAACTCCATTAATTAATTAATTATATATTATTTATTTTAATCCCTCTCAAAAAACTTTCACCATTACCAATAAAAAACAT IIIII9IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII9IIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:34129:1042_1:N:0:GGTACACG+AGCAGCGC/1 77 * 0 0 * * 0 0 TTAGAGATAGAAATTAAATTATTATAGATTTAGAGATTTAAAATGAATTATTGTAGATGTAGAGATAGAAAATAAAATTATTATTTATTTTGAATAGAAAATGAATAATTGATATTGTTTTGTAAAATAGGATTGGTTAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:34129:1042_2:N:0:GGTACACG+AGCAGCGC/2 141 * 0 0 * * 0 0 ATAAAATTTAATAACTCTTAACCAATCCTATTTTACAAAACAATATCAATTATTCATTTTCTATTCAAAATAAATAATAATTTTATTTTCTATCTCTACATCTACAATAATTCATTTTAAATCTCTAAATCTATAATAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:26621:1042_1:N:0:GGTACACG+ANCAGCGC/1 77 * 0 0 * * 0 0 TTAAAATAAAGGTTAGGAATTAGTTTATAAATTGAATTTTAAAAATAATTAATTTTGATTGTAATAATAGTGGGTAAAGAATTATGGTGAAAAAAGGTGGGATTTGTTTTTATTTTTGTTTTTTTATGTTGTGTAATTTAA IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:26621:1042_2:N:0:GGTACACG+ANCAGCGC/2 141 * 0 0 * * 0 0 ATATACATACATATTAAATCCTTATCAAATATAATATTTCTATTAAAATCTAAATTAACTTTTAATTTTTTCACATACTATTCAATATTTTAAAAATATTTTTATTTTCATTAAAATAAACTTTTAATATATTAAACAACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:49289:1042_1:N:0:GGTACACG+AGCAGCGC/1 99 Chromosome_4A_CT_converted 66709802 2 37M15D104M = 66709946 286 TTAATATATTTGGTGAATTGTTAATATGAAGTTAAAGTGTAAATATGTTAAAAGAGTATTTTATAGATTTTAAATAGTTTTATTGTTATTGATATTTGTATTAATATAGGGAGGTGATTATTTTATATTGATTTAGTGTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-56 XS:i:-61 XN:i:0 XM:i:1 XO:i:1 XG:i:15 NM:i:16 MD:Z:37^TGATTAGGGTTAAAA30A73 YS:i:-37 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:49289:1042_2:N:0:GGTACACG+AGCAGCGC/2 147 Chromosome_4A_CT_converted 66709946 2 36M2D63M1I41M = 66709802 -286 GATTTAGTGTTTTTTTATGGGATTTGAAATTGTGATTGAGATGTATGAGAATTTGATTTATAGATGGGTAATTTTATTTTTATTTTAAATGGTAAGTTGAAAAAGAGTATGTTGTATTTTTGATGTAAAATATTTTGAAAA IIII9I9I9III9IIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-37 XS:i:-26 XN:i:0 XM:i:3 XO:i:2 XG:i:3 NM:i:6 MD:Z:36^TG14G8T3G76 YS:i:-56 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:45811:1042_1:N:0:GGTACACG+AGCAGCGC/1 99 Chromosome_8B_CT_converted 21661580 6 43M1D62M1I35M = 21661601 162 ATTGTTTATAAAAATATTAATAGATATTTTTATGAAGGAGTGGTTTTAGGAATTGATTATGTGGTTAATGGAGATTGATTAATTAAATTAGAGAAAAATGGTGTTAAATTTTTGATTTTTTTTATTAAGTATTTAAATTTT I9IIIIIIIIIII9I*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-16 XS:i:-22 XN:i:0 XM:i:0 XO:i:2 XG:i:2 NM:i:2 MD:Z:43^T97 YS:i:-16 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:45811:1042_2:N:0:GGTACACG+AGCAGCGC/2 147 Chromosome_8B_CT_converted 21661601 6 22M1D62M1I56M = 21661580 -162 AGATATTTTTATGAAGGAGTGGTTTTAGGAATTGATTATGTGGTTAATGGAGATTGATTAATTAAATTAGAGAAAAATGGTGTTAAATTTTTGATTTTTTTTATTAAGTATTTAAATTTTGGAAAGTTTTGTGATTTAAAG IIII9II*IIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-16 XS:i:-22 XN:i:0 XM:i:0 XO:i:2 XG:i:2 NM:i:2 MD:Z:22^T118 YS:i:-16 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:34129:1042_1:N:0:GGTACACG+AGCAGCGC/1 77 * 0 0 * * 0 0 TTAGAGATAGAAATTAAATTATTATAGATTTAGAGATTTAAAATGAATTATTGTAGATGTAGAGATAGAAAATAAAATTATTATTTATTTTGAATAGAAAATGAATAATTGATATTGTTTTGTAAAATAGGATTGGTTAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:34129:1042_2:N:0:GGTACACG+AGCAGCGC/2 141 * 0 0 * * 0 0 ATAAAATTTAATAACTCTTAACCAATCCTATTTTACAAAACAATATCAATTATTCATTTTCTATTCAAAATAAATAATAATTTTATTTTCTATCTCTACATCTACAATAATTCATTTTAAATCTCTAAATCTATAATAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:3346:1056_1:N:0:GGTACACG+ANCAGCGC/1 83 Chromosome_4A_GA_converted 19264412 42 141M = 19264336 -217 TAAAATTACTAAAAAAATAACTTAAAAATACCTTTAAATTCCTCAAATAATCATTTCCTACATTTCACAATTAATTCTAAAATCTAAAATAATTTTAAAATAAATAATTCTATTATTACAAAAAATATACATATTAAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:8T132 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:3346:1056_2:N:0:GGTACACG+ANCAGCGC/2 163 Chromosome_4A_GA_converted 19264336 42 141M = 19264412 217 TTAATTACAATACTTCATTTTACTAAAATACTTATATATATTCAAACATTATATTCTTTTATTTCAAATATTATTTTAAAATTACTAAAAAAATAACTTAAAAATACCTTTAAATTCCTCAAATAATCATTTCCTACATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:84T56 YS:i:-6 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:29129:1042_1:N:0:GGTACACG+ANCAGCGC/1 83 Chromosome_8B_GA_converted 88374412 11 115M2D26M = 88374297 -258 AACTATTATATAACCTTTAAAACTTCTAACAAATCAATATTTAACTACTACAAAAAATTTAATACTATATATATATTTAAACAATATAAATTTTTACAAATTAATATCTATTACATTTTTTTTTTTTTTTTTAATACAATT IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIII9I9III9IIII*IIIIIIIIIIIII9IIIIIIII*9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-17 XS:i:-12 XN:i:0 XM:i:1 XO:i:1 XG:i:2 NM:i:3 MD:Z:14T100^TT26 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29129:1042_2:N:0:GGTACACG+ANCAGCGC/2 163 Chromosome_8B_GA_converted 88374297 11 141M = 88374412 258 ATAAACTTAAACAAATCAATATTTAACTACTACTAAAAACTACATCACTTACATACATATATCATTTATAAATTTAAAAAAATCAATATTTAACTACTACTAAAAACAATCACTTAACTATTATATAACCTTTAAAACTTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-54 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:78C50T11 YS:i:-17 YT:Z:CP >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:49872:1042_1:N:0:GGTACACG+AGCAGCGC/1 83 Chromosome_4A_GA_converted 51468683 42 1M5I133M = 51468688 144 AAAAAAAAAAAAAAATCCCATATCACAATAAACATTAACACTATAAAAAACCTTCACTACCACAACCATAAACTCCATTAATTAATTAATTATATATTATTTATTTTAATCCCTCTCAAAAAACTTTCACCATTACCAA IIIIIIIIIII9IIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIII AS:i:-20 XN:i:0 XM:i:0 XO:i:1 XG:i:5 NM:i:5 MD:Z:134 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:49872:1042_2:N:0:GGTACACG+AGCAGCGC/2 163 Chromosome_4A_GA_converted 51468688 42 139M = 51468683 -144 AAAAATCCCATATCACAATAAACATTAACACTATAAAAAACCTTCACTACCACAACCATAAACTCCATTAATTAATTAATTATATATTATTTATTTTAATCCCTCTCAAAAAACTTTCACCATTACCAATAAAAAACAT IIIII9IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII9IIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:139 YS:i:-20 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:4738:1056_1:N:0:GGTACACG+ANCAGCGC/1 77 * 0 0 * * 0 0 TTAATGGTAAATGAAAGATATTAGTAAATTTAATGTTATATTGAATAAGAGATTAATTTGTTTAGTAAATAAGATATTGTAGTGTAAATTTTTTTGAATGTGGTGTTTTAATATTTTGAATTTATATATATATATTGTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*II*IIII9I9II*9III99III*II***II*999*I9*9*9***99***9*99** YT:Z:UP LH00129:489:23JFWNLT4:8:1101:4738:1056_2:N:0:GGTACACG+ANCAGCGC/2 141 * 0 0 * * 0 0 CAATATATATATATAAATTCCAAATATTTAAACACCACATTCATAAAAATTTACACTACAATATCTTATTTACTAAACAAATTAATCTCTTATTCAATATAACATTAAATTTACTAATATCTTTCATTTACCATTAAATCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:49289:1042_1:N:0:GGTACACG+AGCAGCGC/1 83 Chromosome_6A_GA_converted 28815945 35 141M = 28815816 -270 AAACACTAAATCAATATAAAATAATCACCTCCCTATATTAATACAAATATCAATAACAATAAAACTATTTAAAATCTATAAAATACTCTTTTAACATATTTACACTTTAACTTCATATTAACAATTCACCAAATATATTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-70 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:49289:1042_2:N:0:GGTACACG+AGCAGCGC/2 163 Chromosome_6A_GA_converted 28815816 35 141M = 28815945 270 TTTTCAAAATATTTTACATCAAAAATACAACATACTCTTTTTCAACTTACCATTTAAAATAAAAATAAAATTACCCATCTATAAATCAAATTCTCATACATCTCAATCACAATTTCAAATCCCATAAAAAAACACTAAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIII9III9I9I9IIII AS:i:0 XS:i:-26 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:45811:1042_1:N:0:GGTACACG+AGCAGCGC/1 83 Chromosome_8B_GA_converted 21603814 1 33M1I60M1D47M = 21603793 -162 AAAATTTAAATACTTAATAAAAAAAATCAAAAATTTAACACCATTTTTCTCTAATTTAATTAATCAATCTCCATTAACCACATAATCAATTCCTAAAACCACTCCTTCATAAAAATATCTATTAATATTTTTATAAACAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*I9IIIIIIIIIII9I AS:i:-16 XS:i:-16 XN:i:0 XM:i:0 XO:i:2 XG:i:2 NM:i:2 MD:Z:93^A47 YS:i:-16 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:45811:1042_2:N:0:GGTACACG+AGCAGCGC/2 163 Chromosome_8B_GA_converted 21603793 1 54M1I60M1D26M = 21603814 162 CTTTAAATCACAAAACTTTCCAAAATTTAAATACTTAATAAAAAAAATCAAAAATTTAACACCATTTTTCTCTAATTTAATTAATCAATCTCCATTAACCACATAATCAATTCCTAAAACCACTCCTTCATAAAAATATCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIII*II9IIII AS:i:-16 XS:i:-16 XN:i:0 XM:i:0 XO:i:2 XG:i:2 NM:i:2 MD:Z:114^A26 YS:i:-16 YT:Z:CP >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:26621:1042_1:N:0:GGTACACG+ANCAGCGC/1 77 * 0 0 * * 0 0 TTAAAATAAAGGTTAGGAATTAGTTTATAAATTGAATTTTAAAAATAATTAATTTTGATTGTAATAATAGTGGGTAAAGAATTATGGTGAAAAAAGGTGGGATTTGTTTTTATTTTTGTTTTTTTATGTTGTGTAATTTAA IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:26621:1042_2:N:0:GGTACACG+ANCAGCGC/2 141 * 0 0 * * 0 0 ATATACATACATATTAAATCCTTATCAAATATAATATTTCTATTAAAATCTAAATTAACTTTTAATTTTTTCACATACTATTCAATATTTTAAAAATATTTTTATTTTCATTAAAATAAACTTTTAATATATTAAACAACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.2 and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.8 and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.5 and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.3 and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.4 and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.6 and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.7 and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.1 and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.1 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1417527 (32.92%) aligned concordantly 0 times 1009478 (23.45%) aligned concordantly exactly 1 time 1878481 (43.63%) aligned concordantly >1 times 67.08% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1416612 (32.90%) aligned concordantly 0 times 1011561 (23.49%) aligned concordantly exactly 1 time 1877313 (43.60%) aligned concordantly >1 times 67.10% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2463991 Mapping efficiency: 57.2% Sequence pairs with no alignments under any condition: 441130 Sequence pairs did not map uniquely: 1400365 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1233846 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1230145 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 108963698 Total methylated C's in CpG context: 2630838 Total methylated C's in CHG context: 123692 Total methylated C's in CHH context: 547185 Total methylated C's in Unknown context: 13463 Total unmethylated C's in CpG context: 10974187 Total unmethylated C's in CHG context: 18606373 Total unmethylated C's in CHH context: 76081423 Total unmethylated C's in Unknown context: 100780 C methylated in CpG context: 19.3% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.8% 4305485 reads; of these: 4305485 (100.00%) were paired; of these: 1416070 (32.89%) aligned concordantly 0 times 1010909 (23.48%) aligned concordantly exactly 1 time 1878506 (43.63%) aligned concordantly >1 times 67.11% overall alignment rate 4305485 reads; of these: 4305485 (100.00%) were paired; of these: 1416822 (32.91%) aligned concordantly 0 times 1008905 (23.43%) aligned concordantly exactly 1 time 1879758 (43.66%) aligned concordantly >1 times 67.09% overall alignment rate Processed 4305485 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305485 Number of paired-end alignments with a unique best hit: 2466257 Mapping efficiency: 57.3% Sequence pairs with no alignments under any condition: 440523 Sequence pairs did not map uniquely: 1398705 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1234454 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1231803 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 109047839 Total methylated C's in CpG context: 2627493 Total methylated C's in CHG context: 123414 Total methylated C's in CHH context: 547728 Total methylated C's in Unknown context: 13694 Total unmethylated C's in CpG context: 10979019 Total unmethylated C's in CHG context: 18611682 Total unmethylated C's in CHH context: 76158503 Total unmethylated C's in Unknown context: 100870 C methylated in CpG context: 19.3% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 12.0% Now waiting for all child processes to complete 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1415725 (32.88%) aligned concordantly 0 times 1010837 (23.48%) aligned concordantly exactly 1 time 1878924 (43.64%) aligned concordantly >1 times 67.12% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1417565 (32.92%) aligned concordantly 0 times 1009222 (23.44%) aligned concordantly exactly 1 time 1878699 (43.64%) aligned concordantly >1 times 67.08% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2465212 Mapping efficiency: 57.3% Sequence pairs with no alignments under any condition: 440737 Sequence pairs did not map uniquely: 1399537 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1232258 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1232954 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 109016398 Total methylated C's in CpG context: 2624446 Total methylated C's in CHG context: 124292 Total methylated C's in CHH context: 547433 Total methylated C's in Unknown context: 13524 Total unmethylated C's in CpG context: 10961930 Total unmethylated C's in CHG context: 18618598 Total unmethylated C's in CHH context: 76139699 Total unmethylated C's in Unknown context: 100174 C methylated in CpG context: 19.3% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.9% 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1416088 (32.89%) aligned concordantly 0 times 1009414 (23.44%) aligned concordantly exactly 1 time 1879984 (43.66%) aligned concordantly >1 times 67.11% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1416544 (32.90%) aligned concordantly 0 times 1009734 (23.45%) aligned concordantly exactly 1 time 1879208 (43.65%) aligned concordantly >1 times 67.10% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2466110 Mapping efficiency: 57.3% Sequence pairs with no alignments under any condition: 440458 Sequence pairs did not map uniquely: 1398918 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1233769 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1232341 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 109072555 Total methylated C's in CpG context: 2621690 Total methylated C's in CHG context: 123610 Total methylated C's in CHH context: 546700 Total methylated C's in Unknown context: 13604 Total unmethylated C's in CpG context: 10995158 Total unmethylated C's in CHG context: 18618974 Total unmethylated C's in CHH context: 76166423 Total unmethylated C's in Unknown context: 99799 C methylated in CpG context: 19.3% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 12.0% 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1418331 (32.94%) aligned concordantly 0 times 1007663 (23.40%) aligned concordantly exactly 1 time 1879492 (43.65%) aligned concordantly >1 times 67.06% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1414324 (32.85%) aligned concordantly 0 times 1010976 (23.48%) aligned concordantly exactly 1 time 1880186 (43.67%) aligned concordantly >1 times 67.15% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2464266 Mapping efficiency: 57.2% Sequence pairs with no alignments under any condition: 440681 Sequence pairs did not map uniquely: 1400539 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1230367 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1233899 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 108984501 Total methylated C's in CpG context: 2631438 Total methylated C's in CHG context: 123162 Total methylated C's in CHH context: 547873 Total methylated C's in Unknown context: 13590 Total unmethylated C's in CpG context: 10960736 Total unmethylated C's in CHG context: 18606916 Total unmethylated C's in CHH context: 76114376 Total unmethylated C's in Unknown context: 100898 C methylated in CpG context: 19.4% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.9% Processed 4000000 sequence pairs so far 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1417085 (32.91%) aligned concordantly 0 times 1009800 (23.45%) aligned concordantly exactly 1 time 1878601 (43.63%) aligned concordantly >1 times 67.09% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1416130 (32.89%) aligned concordantly 0 times 1010901 (23.48%) aligned concordantly exactly 1 time 1878455 (43.63%) aligned concordantly >1 times 67.11% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2465886 Mapping efficiency: 57.3% Sequence pairs with no alignments under any condition: 440370 Sequence pairs did not map uniquely: 1399230 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1233619 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1232267 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 109036050 Total methylated C's in CpG context: 2631892 Total methylated C's in CHG context: 123762 Total methylated C's in CHH context: 547419 Total methylated C's in Unknown context: 13706 Total unmethylated C's in CpG context: 10975583 Total unmethylated C's in CHG context: 18608761 Total unmethylated C's in CHH context: 76148633 Total unmethylated C's in Unknown context: 100795 C methylated in CpG context: 19.3% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 12.0% 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1416405 (32.90%) aligned concordantly 0 times 1009188 (23.44%) aligned concordantly exactly 1 time 1879893 (43.66%) aligned concordantly >1 times 67.10% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1415346 (32.87%) aligned concordantly 0 times 1011239 (23.49%) aligned concordantly exactly 1 time 1878901 (43.64%) aligned concordantly >1 times 67.13% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2465017 Mapping efficiency: 57.3% Sequence pairs with no alignments under any condition: 440221 Sequence pairs did not map uniquely: 1400248 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1234089 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1230928 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 109021980 Total methylated C's in CpG context: 2623816 Total methylated C's in CHG context: 123759 Total methylated C's in CHH context: 548238 Total methylated C's in Unknown context: 13725 Total unmethylated C's in CpG context: 10970133 Total unmethylated C's in CHG context: 18599267 Total unmethylated C's in CHH context: 76156767 Total unmethylated C's in Unknown context: 100294 C methylated in CpG context: 19.3% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 12.0% 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1417984 (32.93%) aligned concordantly 0 times 1009498 (23.45%) aligned concordantly exactly 1 time 1878004 (43.62%) aligned concordantly >1 times 67.07% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1418608 (32.95%) aligned concordantly 0 times 1009203 (23.44%) aligned concordantly exactly 1 time 1877675 (43.61%) aligned concordantly >1 times 67.05% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2465258 Mapping efficiency: 57.3% Sequence pairs with no alignments under any condition: 441221 Sequence pairs did not map uniquely: 1399007 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1232767 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1232491 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 108987313 Total methylated C's in CpG context: 2624035 Total methylated C's in CHG context: 123256 Total methylated C's in CHH context: 545789 Total methylated C's in Unknown context: 13455 Total unmethylated C's in CpG context: 10973910 Total unmethylated C's in CHG context: 18592670 Total unmethylated C's in CHH context: 76127653 Total unmethylated C's in Unknown context: 101177 C methylated in CpG context: 19.3% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.7% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 17221940. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.1 /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.1 /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.2 /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.2 /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.3 /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.3 /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.4 /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.4 /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.5 /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.5 /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.6 /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.6 /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.7 /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.7 /tmp/13-wgbs-Qui4-1123626/Qui4_R1.fq.gz.temp.8 /tmp/13-wgbs-Qui4-1123626/Qui4_R2.fq.gz.temp.8 Now merging BAM files Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.2_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.3_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.4_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.5_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.6_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.7_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Qui4_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1_bismark_bt2_PE_report.txt Now merging temporary reports Qui4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Qui4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 34443887 Number of paired-end alignments with a unique best hit: 19721997 Mapping efficiency: 57.3% Sequence pairs with no alignments under any condition: 3525341 Sequence pairs did not map uniquely: 11196549 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 9865169 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 9856828 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 872130334 Total methylated C's in CpG context: 21015648 Total methylated C's in CHG context: 988947 Total methylated C's in CHH context: 4378365 Total methylated C's in Unknown context: 108761 Total unmethylated C's in CpG context: 87790656 Total unmethylated C's in CHG context: 148863241 Total unmethylated C's in CHH context: 609093477 Total unmethylated C's in Unknown context: 804787 C methylated in CpG context: 19.3% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.9% Deleting temporary report files... Qui4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 48m 31s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Qui4_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Qui4_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Qui4_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Qui4_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Qui4_pe.bam: 19721997 Total number duplicated alignments removed: 1044319 (5.30%) Duplicated alignments were found at: 992987 different position(s) Total count of deduplicated leftover sequences: 18677678 (94.70% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Qui4_R1.fq.gz -2 output/13-wgbs/trimmed/Qui4_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui4-1123626 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Qui4_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Qui4_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Qui4_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui4_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui4_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui4_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Qui4_R1.fq.gz -2 output/13-wgbs/trimmed/Qui4_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui4-1123626 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Qui4_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Qui4_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18000000 Now waiting for all child processes to complete Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Finished processing child process. Exiting.. Processed lines: 18500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Processed lines: 18500000 Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.8 Processed 18677678 lines in total Total number of methylation call strings processed: 37355356 Final Cytosine Methylation Report ================================= Total number of C's analysed: 611533652 Total methylated C's in CpG context: 14712402 Total methylated C's in CHG context: 668767 Total methylated C's in CHH context: 2977019 Total C to T conversions in CpG context: 61691307 Total C to T conversions in CHG context: 104354179 Total C to T conversions in CHH context: 427129978 C methylated in CpG context: 19.3% C methylated in non-CpG context: 0.7% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui4_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui4_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui4_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui4_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui4_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Qui4_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui4_pe.deduplicated.txt.gz Writing bedGraph to file: Qui4_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Qui4_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Qui4_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Qui4_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Qui4_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Qui4.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Qui4.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1405917 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1697973 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3060668 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2935180 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2887079 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2596665 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2826156 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1466582 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2761881 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2651750 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Qui4.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Qui4.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Qui4_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Qui4_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1575947364 34.15 378413849 32.06 4.165 C 737899258 15.99 211781786 17.94 3.484 G 823796985 17.85 211810957 17.95 3.889 T 1476569202 32.00 378309330 32.05 3.903 AA 571163688 12.47 128492079 10.89 4.445 AC 250282490 5.46 68264877 5.78 3.666 AG 253583532 5.54 62424886 5.29 4.062 AT 490085392 10.70 119230832 10.10 4.110 CA 301856150 6.59 80836853 6.85 3.734 CC 128473709 2.80 42358709 3.59 3.033 CG 91527507 2.00 26104181 2.21 3.506 CT 210354491 4.59 62481783 5.29 3.367 GA 278741118 6.08 67679435 5.73 4.119 GC 120952452 2.64 33452245 2.83 3.616 GG 151009069 3.30 42378301 3.59 3.563 GT 267050013 5.83 68300800 5.79 3.910 TA 412577822 9.01 101400983 8.59 4.069 TC 232831167 5.08 67705770 5.74 3.439 TG 321751419 7.02 80903356 6.85 3.977 TT 498819364 10.89 128294772 10.87 3.888 [Fri Oct 9 14:59:51 PDT 2026] Qui4 done