[Fri Oct 9 13:10:56 PDT 2026] Qui3 (Qui/Quilhua) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 42137866 total bases: 6362817766 Q20 bases: 6288233634(98.8278%) Q30 bases: 6092518841(95.7519%) Q40 bases: 6092518841(95.7519%) Read2 before filtering: total reads: 42137866 total bases: 6362817766 Q20 bases: 6279270768(98.6869%) Q30 bases: 6076434833(95.4991%) Q40 bases: 6076434833(95.4991%) Read1 after filtering: total reads: 41446330 total bases: 5722568364 Q20 bases: 5673740768(99.1468%) Q30 bases: 5524953195(96.5467%) Q40 bases: 5524953195(96.5467%) Read2 after filtering: total reads: 41446330 total bases: 5724768500 Q20 bases: 5673087308(99.0972%) Q30 bases: 5513545550(96.3104%) Q40 bases: 5513545550(96.3104%) Filtering result: reads passed filter: 82892660 reads failed due to low quality: 706846 reads failed due to too many N: 1614 reads failed due to too short: 674612 reads with adapter trimmed: 10275931 bases trimmed due to adapters: 207829890 Duplication rate: 6.01871% Insert size peak (evaluated by paired-end reads): 183 JSON report: output/13-wgbs/fastp/Qui3.fastp.json HTML report: output/13-wgbs/fastp/Qui3.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui3 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui3 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Qui3_R1.fq.gz -O output/13-wgbs/trimmed/Qui3_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Qui3.fastp.json --html output/13-wgbs/fastp/Qui3.fastp.html fastp v1.0.1, time used: 79 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Qui3_R1.fq.gz output/13-wgbs/trimmed/Qui3_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Qui3-1123286 Temporary files will be written into the directory: /tmp/13-wgbs-Qui3-1123286/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui3_R1.fq.gz and output/13-wgbs/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui3_R1.fq.gz and output/13-wgbs/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui3_R1.fq.gz and output/13-wgbs/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui3_R1.fq.gz and output/13-wgbs/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui3_R1.fq.gz and output/13-wgbs/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui3_R1.fq.gz and output/13-wgbs/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui3_R1.fq.gz and output/13-wgbs/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui3_R1.fq.gz and output/13-wgbs/trimmed/Qui3_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Qui3_R1.fq.gz for PID: 1124768 and offset 8 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 5180792) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 5180792) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 5180792) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.1 to /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui3_R2.fq.gz for PID: 1124768 and offset 8 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.8 to /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.6 to /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.3 to /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.5 to /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.7 to /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.4 to /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 5180792) Using the subset file >/tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.2 to /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.2_C_to_T.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.1 (5180792 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.1 to /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.8 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.8 to /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.6 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.6 to /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.3 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.3 to /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.5 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.5 to /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.7 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.7 to /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.2 (5180792 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.2 to /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.4 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.4 to /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.4_G_to_A.fastq Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.1 (5180792 sequences in total) Input files are Qui3_R1.fq.gz.temp.1_C_to_T.fastq and Qui3_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.8 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.8_C_to_T.fastq and Qui3_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.3 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.3_C_to_T.fastq and Qui3_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.6 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.6_C_to_T.fastq and Qui3_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.7 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.7_C_to_T.fastq and Qui3_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.5 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.5_C_to_T.fastq and Qui3_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.4 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.4_C_to_T.fastq and Qui3_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.2 (5180792 sequences in total) Input files are Qui3_R1.fq.gz.temp.2_C_to_T.fastq and Qui3_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:40148:1042_1:N:0:TAACCATA+CAATCATG/1 99 Chromosome_9B_CT_converted 9807211 27 141M = 9807217 147 TAATTTTATTATAGTAGAATTTTAAATATTAAATTGTTATTTATAAATATAAGATGTATTGTAGAATTAAAGAAATTGAAGAAAGTATTGAAAATATATATATGTAAGTTAAAGTTTTTTTAAAGATGTATTTTTATGTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-73 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:40148:1042_2:N:0:TAACCATA+CAATCATG/2 147 Chromosome_9B_CT_converted 9807217 27 141M = 9807211 -147 TATTATAGTAGAATTTTAAATATTAAATTGTTATTTATAAATATAAGATGTATTGTAGAATTAAAGAAATTGAAGAAAGTATTGAAAATATATATATGTAAGTTAAAGTTTTTTTAAAGATGTATTTTTATGTATATAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-77 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:139A0A0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:43594:1042_1:N:0:TAACCATA+CAATCATG/1 77 * 0 0 * * 0 0 TTTTTTTGTATTTTTGAAATTTTGTATTAAAAGTGTAGATTTTTTTTTTATTAATTTTTTTGAAAATATATATAGAGTATTTTTATGAATATTTTTTAAAGGTATATGGTAAAAAAATTAATTTTATTTATAATTTTATGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIII9IIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:43594:1042_2:N:0:TAACCATA+CAATCATG/2 141 * 0 0 * * 0 0 TTCTCTAACCAACAAAAACCAATAATCCTAAAATAATTCTAATAACATTTCCAACCAACTTTATACCATTTCTTAACAAAACTAAATACTATTCAATAACTATTTCAAACCCTAAAATTTAAACTTTTTTTATTTCTACAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:39565:1042_1:N:0:TAACCATA+CAATCATG/1 77 * 0 0 * * 0 0 TTAAGTTTTGGATTTTTATTTTTTATATTAATTATATTGATTTTAATAAGTTTTTTGTTTTTAAGGATGAAATATAGTAGTAAGAATATATTAAGTAAGGTAGGTGAATGAAAATGTATTTTGATAGTGGAGTAGGAATAT IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:39565:1042_2:N:0:TAACCATA+CAATCATG/2 141 * 0 0 * * 0 0 TAAAAAAATAATTCTCAAAATCATAAAATTACAAAATAATAAATACAATAATATATAATTTATAATACTAAAATAAAAAATCCTAATATTAAAAAAAAATTACATAAAAATATATTAATTATTATTTCCAATATATTCCTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:40681:1042_1:N:0:TAACCATA+CAATCATG/1 99 Chromosome_7B_CT_converted 45389884 42 141M = 45389990 247 GTGGATTTTATTATTTTATGAAAAGTTGGTATTAAATAATTGATTAGGTATTGAAAGTTTAAATTGTTTAGAATTTAAGAATGTTTTATTATTAAATATAATTAGTTATATAAAGAATATGATAATTTTTAATTTGTAAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:82A58 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:40681:1042_2:N:0:TAACCATA+CAATCATG/2 147 Chromosome_7B_CT_converted 45389990 42 141M = 45389884 -247 TATATAAAGAATATGATAATTTTTAATTTGTAAAGTAGAGATATTTTATATATATTGTAATTGTAGTTAGAAATTAAAGTTGTTAATGAAATTTAATATATGTTATATAAAATGTTGATATGTGAATTGATGGTGGATATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:35326:1042_1:N:0:TAACCATA+CAATCATG/1 99 Chromosome_6B_CT_converted 3596133 1 141M = 3596433 442 TTTTGTTGTTATTGTATTATATAAATATAAATATAATTTAGGATTTGTTTGGATTTGATAAGGAGATAGTAATTTTGAAAAGTAATATAGAGATATGTTTATGGATTATTTTTATTTATATGAATTAGTGTTTTGTAATGG IIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:103A37 YS:i:-44 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:35326:1042_2:N:0:TAACCATA+CAATCATG/2 147 Chromosome_6B_CT_converted 3596433 1 122M1D19M = 3596133 -442 GGTTTTAGAATTAAGTTGTTAATAGTTTTGGTGTTTTGTAGAGTTTATTGGAGAAGTGTATGTAGGATTTAAGGGAATTTATGTTGTATAAGATAAAATGATTTTTTTGTAAATTATTTTGATTTTTTTTTTTTTTTATAT **I9I***I9I*I9II9IIIII*9IIII*III9*9999*II9I*99*IIIII9II99I*99**9I99II9III99IIII999III999*III99IIIII*IIIIIII99IIIII9II9III*IIII9IIIIIIIIIIIIII AS:i:-44 XS:i:-44 XN:i:0 XM:i:6 XO:i:1 XG:i:1 NM:i:7 MD:Z:1A5T44T12T8T24T22^T19 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:24501:1042_1:N:0:TAACCATA+CNATCATG/1 77 * 0 0 * * 0 0 AGAGTATATGTTTGAATTTTAGTTATTAATTATAATTTGGGGGGGGGGGTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*99I99**9**9*9******9* YT:Z:UP LH00129:489:23JFWNLT4:8:1101:24501:1042_2:N:0:TAACCATA+CNATCATG/2 141 * 0 0 * * 0 0 AAAACATCATATAAAAAAAAAATATCAACCATAATATAAATCTCAATAATCACCATATCATTAAAAA IIIIIIIIIIII99IIIII9I9IIII9I*I9IIII9I9IIIIII*IIIII9999*9I9II9I9II99 YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:38093:1042_1:N:0:TAACCATA+CAATCATG/1 99 Chromosome_10A_CT_converted 8861113 42 141M = 8861135 163 ATATTGTATTTTTTAAGTTTGAAAATGTGTGATGTTTATTATAATTAAAAGATTATTTGATTATGGTTTTTATTTAAATTTGAGGATATGTTATTGTGGTTGTAAAATATGTAATTTTGATTAGTGAAAGTTAATTGTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:38093:1042_2:N:0:TAACCATA+CAATCATG/2 147 Chromosome_10A_CT_converted 8861135 42 141M = 8861113 -163 AAATGTGTGATGTTTATTATAATTAAAAGATTATTTGATTATGGTTTTTATTTAAATTTGAGGATATGTTATTGTGGTTGTAAAATATGTAATTTTGATTAGTGAAAGTTAATTGTTTATTTGTTTATTTGTTATATGTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:25877:1042_1:N:0:TAACCATA+CNATCATG/1 77 * 0 0 * * 0 0 TTATTTTGTATATATAAATAGTTGTATTATAAATGTATTTAAATATTTTTGTAAAAATTGTATTTTTGTATAATGATTGTTAATATTTGTAAAATGTTTTTGTATTAATTGTATATTATTAAAAAGTTGAAGTATTGTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIIII*IIIIIIIIIIIIII9IIIII*IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:25877:1042_2:N:0:TAACCATA+CNATCATG/2 141 * 0 0 * * 0 0 AAACCTTCCAATCCCAAACTTAAAACAAAAAATAATAATCCTAAAAATTCTCTACCATATCCAAACATTCACTTTATCTTATCTTTATAAAAAAATTAACACTAAAAAATCCTTAAACCTTTATATTACATATCAAAAATT IIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:40148:1042_1:N:0:TAACCATA+CAATCATG/1 83 Chromosome_4A_GA_converted 78829742 0 109M16I9M1D7M = 78829736 -132 ATACATAAAAATACATCTTTAAAAAAACTTTAACTTACATATATATATTTTCAATACTTTCTTCAATTTCTTTAATTCTACAATACATCTTATATTTATAAATAACAATTTAATATTTAAAATTCTACTATAATAAAATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-67 XS:i:-67 XN:i:0 XM:i:1 XO:i:2 XG:i:17 NM:i:18 MD:Z:34A83^A7 YS:i:-71 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:40148:1042_2:N:0:TAACCATA+CAATCATG/2 163 Chromosome_4A_GA_converted 78829736 0 115M16I10M = 78829742 132 AATTATATACATAAAAATACATCTTTAAAAAAACTTTAACTTACATATATATATTTTCAATACTTTCTTCAATTTCTTTAATTCTACAATACATCTTATATTTATAAATAACAATTTAATATTTAAAATTCTACTATAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-71 XS:i:-71 XN:i:0 XM:i:3 XO:i:1 XG:i:16 NM:i:19 MD:Z:0T0T38A84 YS:i:-67 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:40681:1042_1:N:0:TAACCATA+CAATCATG/1 83 Chromosome_7B_GA_converted 151392528 42 141M = 151392422 -247 CTTTACAAATTAAAAATTATCATATTCTTTATATAACTAATTATATTTAATAATAAAACATTCTTAAATTCTAAACAATTTAAACTTTCAATACCTAATCAATTATTTAATACCAACTTTTCATAAAATAATAAAATCCAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:58T82 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:40681:1042_2:N:0:TAACCATA+CAATCATG/2 163 Chromosome_7B_GA_converted 151392422 42 141M = 151392528 247 AATATCCACCATCAATTCACATATCAACATTTTATATAACATATATTAAATTTCATTAACAACTTTAATTTCTAACTACAATTACAATATATATAAAATATCTCTACTTTACAAATTAAAAATTATCATATTCTTTATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:24501:1042_1:N:0:TAACCATA+CNATCATG/1 77 * 0 0 * * 0 0 AGAGTATATGTTTGAATTTTAGTTATTAATTATAATTTGGGGGGGGGGGTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*99I99**9**9*9******9* YT:Z:UP LH00129:489:23JFWNLT4:8:1101:24501:1042_2:N:0:TAACCATA+CNATCATG/2 141 * 0 0 * * 0 0 AAAACATCATATAAAAAAAAAATATCAACCATAATATAAATCTCAATAATCACCATATCATTAAAAA IIIIIIIIIIII99IIIII9I9IIII9I*I9IIII9I9IIIIII*IIIII9999*9I9II9I9II99 YT:Z:UP >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:39565:1042_1:N:0:TAACCATA+CAATCATG/1 83 Chromosome_6B_GA_converted 87270063 42 141M = 87269931 -273 ATATTCCTACTCCACTATCAAAATACATTTTCATTCACCTACCTTACTTAATATATTCTTACTACTATATTTCATCCTTAAAAACAAAAAACTTATTAAAATCAATATAATTAATATAAAAAATAAAAATCCAAAACTTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:39565:1042_2:N:0:TAACCATA+CAATCATG/2 163 Chromosome_6B_GA_converted 87269931 42 141M = 87270063 273 TAAAAAAATAATTCTCAAAATCATAAAATTACAAAATAATAAATACAATAATATATAATTTATAATACTAAAATAAAAAATCCTAATATTAAAAAAAAATTACATAAAAATATATTAATTATTATTTCCAATATATTCCTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:35326:1042_1:N:0:TAACCATA+CAATCATG/1 77 * 0 0 * * 0 0 TTTTGTTGTTATTGTATTATATAAATATAAATATAATTTAGGATTTGTTTGGATTTGATAAGGAGATAGTAATTTTGAAAAGTAATATAGAGATATGTTTATGGATTATTTTTATTTATATGAATTAGTGTTTTGTAATGG IIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:35326:1042_2:N:0:TAACCATA+CAATCATG/2 141 * 0 0 * * 0 0 ATATAAAAAAAAAAAAAAATCAAAATAATTTACAAAAAAATCATTTTATCTTATACAACATAAATTCCCTTAAATCCTACATACACTTCTCCAATAAACTCTACAAAACACCAAAACTATTAACAACTTAATTCTAAAACC IIIIIIIIIIIIII9IIII*III9II9IIIII99IIIIIII*IIIII99III*999III999IIII99III9II99I9**99*I99II9IIIII*99*I9II*9999*9III*IIII9*IIIII9II9I*I9I***I9I** YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:43594:1042_1:N:0:TAACCATA+CAATCATG/1 83 Chromosome_4A_GA_converted 84398494 42 141M = 84398281 -354 TCATAAAATTATAAATAAAATTAATTTTTTTACCATATACCTTTAAAAAATATTCATAAAAATACTCTATATATATTTTCAAAAAAATTAATAAAAAAAAAATCTACACTTTTAATACAAAATTTCAAAAATACAAAAAAA IIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIII9IIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:39T54T46 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:43594:1042_2:N:0:TAACCATA+CAATCATG/2 163 Chromosome_4A_GA_converted 84398281 42 141M = 84398494 354 TTCTCTAACCAACAAAAACCAATAATCCTAAAATAATTCTAATAACATTTCCAACCAACTTTATACCATTTCTTAACAAAACTAAATACTATTCAATAACTATTTCAAACCCTAAAATTTAAACTTTTTTTATTTCTACAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:38093:1042_1:N:0:TAACCATA+CAATCATG/1 77 * 0 0 * * 0 0 ATATTGTATTTTTTAAGTTTGAAAATGTGTGATGTTTATTATAATTAAAAGATTATTTGATTATGGTTTTTATTTAAATTTGAGGATATGTTATTGTGGTTGTAAAATATGTAATTTTGATTAGTGAAAGTTAATTGTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:38093:1042_2:N:0:TAACCATA+CAATCATG/2 141 * 0 0 * * 0 0 AAACATATAACAAATAAACAAATAAACAATTAACTTTCACTAATCAAAATTACATATTTTACAACCACAATAACATATCCTCAAATTTAAATAAAAACCATAATCAAATAATCTTTTAATTATAATAAACATCACACATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:25877:1042_1:N:0:TAACCATA+CNATCATG/1 83 Chromosome_4A_GA_converted 25007456 42 141M = 25007306 -291 TAAACAATACTTCAACTTTTTAATAATATACAATTAATACAAAAACATTTTACAAATATTAACAATCATTATACAAAAATACAATTTTTACAAAAATATTTAAATACATTTATAATACAACTATTTATATATACAAAATAA IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII*IIIII9IIIIIIIIIIIIII*IIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:25877:1042_2:N:0:TAACCATA+CNATCATG/2 163 Chromosome_4A_GA_converted 25007306 42 141M = 25007456 291 AAACCTTCCAATCCCAAACTTAAAACAAAAAATAATAATCCTAAAAATTCTCTACCATATCCAAACATTCACTTTATCTTATCTTTATAAAAAAATTAACACTAAAAAATCCTTAAACCTTTATATTACATATCAAAAATT IIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.6 and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.7 and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.1 and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.5 and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.8 and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.3 and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.4 and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.2 and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.2 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2207:42057:29207_1:N:0:TAACCATA+CAATCATA Chromosome_4A 2 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2357:18652:14368_1:N:0:TAACCATA+CAATCATG Chromosome_4A 2 Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far 5180792 reads; of these: 5180792 (100.00%) were paired; of these: 1727516 (33.34%) aligned concordantly 0 times 1224440 (23.63%) aligned concordantly exactly 1 time 2228836 (43.02%) aligned concordantly >1 times 66.66% overall alignment rate 5180792 reads; of these: 5180792 (100.00%) were paired; of these: 1732432 (33.44%) aligned concordantly 0 times 1221335 (23.57%) aligned concordantly exactly 1 time 2227025 (42.99%) aligned concordantly >1 times 66.56% overall alignment rate Processed 5180792 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180792 Number of paired-end alignments with a unique best hit: 2974014 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 546438 Sequence pairs did not map uniquely: 1660340 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1490560 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1483453 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 130849072 Total methylated C's in CpG context: 3290398 Total methylated C's in CHG context: 155609 Total methylated C's in CHH context: 703221 Total methylated C's in Unknown context: 18984 Total unmethylated C's in CpG context: 12673162 Total unmethylated C's in CHG context: 22063429 Total unmethylated C's in CHH context: 91963253 Total unmethylated C's in Unknown context: 125509 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% 5180792 reads; of these: 5180792 (100.00%) were paired; of these: 1728758 (33.37%) aligned concordantly 0 times 1224017 (23.63%) aligned concordantly exactly 1 time 2228017 (43.01%) aligned concordantly >1 times 66.63% overall alignment rate 5180792 reads; of these: 5180792 (100.00%) were paired; of these: 1729549 (33.38%) aligned concordantly 0 times 1224198 (23.63%) aligned concordantly exactly 1 time 2227045 (42.99%) aligned concordantly >1 times 66.62% overall alignment rate Processed 5180792 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180792 Number of paired-end alignments with a unique best hit: 2976705 Mapping efficiency: 57.5% Sequence pairs with no alignments under any condition: 544575 Sequence pairs did not map uniquely: 1659512 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1489840 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1486865 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 130989955 Total methylated C's in CpG context: 3297438 Total methylated C's in CHG context: 155914 Total methylated C's in CHH context: 706661 Total methylated C's in Unknown context: 19045 Total unmethylated C's in CpG context: 12691130 Total unmethylated C's in CHG context: 22082660 Total unmethylated C's in CHH context: 92056152 Total unmethylated C's in Unknown context: 126326 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1728312 (33.36%) aligned concordantly 0 times 1224042 (23.63%) aligned concordantly exactly 1 time 2228437 (43.01%) aligned concordantly >1 times 66.64% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1729951 (33.39%) aligned concordantly 0 times 1224514 (23.64%) aligned concordantly exactly 1 time 2226326 (42.97%) aligned concordantly >1 times 66.61% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1731083 (33.41%) aligned concordantly 0 times 1223978 (23.63%) aligned concordantly exactly 1 time 2225730 (42.96%) aligned concordantly >1 times 66.59% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1729264 (33.38%) aligned concordantly 0 times 1225321 (23.65%) aligned concordantly exactly 1 time 2226206 (42.97%) aligned concordantly >1 times 66.62% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1731422 (33.42%) aligned concordantly 0 times 1222651 (23.60%) aligned concordantly exactly 1 time 2226718 (42.98%) aligned concordantly >1 times 66.58% overall alignment rate Processed 5180791 sequences in total 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1733234 (33.46%) aligned concordantly 0 times 1222442 (23.60%) aligned concordantly exactly 1 time 2225115 (42.95%) aligned concordantly >1 times 66.54% overall alignment rate Successfully deleted the temporary files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 2974562 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 545925 Sequence pairs did not map uniquely: 1660304 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1489039 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1485523 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 130852378 Total methylated C's in CpG context: 3287950 Total methylated C's in CHG context: 154801 Total methylated C's in CHH context: 705775 Total methylated C's in Unknown context: 18886 Total unmethylated C's in CpG context: 12680631 Total unmethylated C's in CHG context: 22061477 Total unmethylated C's in CHH context: 91961744 Total unmethylated C's in Unknown context: 126085 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.0% Now waiting for all child processes to complete Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 2975872 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 546412 Sequence pairs did not map uniquely: 1658507 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1489656 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1486216 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 130992634 Total methylated C's in CpG context: 3287261 Total methylated C's in CHG context: 155354 Total methylated C's in CHH context: 705996 Total methylated C's in Unknown context: 19153 Total unmethylated C's in CpG context: 12688530 Total unmethylated C's in CHG context: 22080576 Total unmethylated C's in CHH context: 92074917 Total unmethylated C's in Unknown context: 126714 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 2975819 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 546305 Sequence pairs did not map uniquely: 1658667 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1490076 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1485743 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 130951296 Total methylated C's in CpG context: 3287095 Total methylated C's in CHG context: 156344 Total methylated C's in CHH context: 704890 Total methylated C's in Unknown context: 19171 Total unmethylated C's in CpG context: 12685568 Total unmethylated C's in CHG context: 22091236 Total unmethylated C's in CHH context: 92026163 Total unmethylated C's in Unknown context: 125933 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.2% 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1728633 (33.37%) aligned concordantly 0 times 1226073 (23.67%) aligned concordantly exactly 1 time 2226085 (42.97%) aligned concordantly >1 times 66.63% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1732653 (33.44%) aligned concordantly 0 times 1222079 (23.59%) aligned concordantly exactly 1 time 2226059 (42.97%) aligned concordantly >1 times 66.56% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1727667 (33.35%) aligned concordantly 0 times 1225309 (23.65%) aligned concordantly exactly 1 time 2227815 (43.00%) aligned concordantly >1 times 66.65% overall alignment rate Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 2977153 Mapping efficiency: 57.5% Sequence pairs with no alignments under any condition: 546079 Sequence pairs did not map uniquely: 1657559 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1490979 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1486174 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 131026041 Total methylated C's in CpG context: 3297435 Total methylated C's in CHG context: 155358 Total methylated C's in CHH context: 703061 Total methylated C's in Unknown context: 18699 Total unmethylated C's in CpG context: 12690738 Total unmethylated C's in CHG context: 22105712 Total unmethylated C's in CHH context: 92073737 Total unmethylated C's in Unknown context: 126145 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1732268 (33.44%) aligned concordantly 0 times 1223176 (23.61%) aligned concordantly exactly 1 time 2225347 (42.95%) aligned concordantly >1 times 66.56% overall alignment rate Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 2974761 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 544901 Sequence pairs did not map uniquely: 1661129 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1489965 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1484795 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 130906352 Total methylated C's in CpG context: 3289558 Total methylated C's in CHG context: 155086 Total methylated C's in CHH context: 704434 Total methylated C's in Unknown context: 19170 Total unmethylated C's in CpG context: 12679696 Total unmethylated C's in CHG context: 22076218 Total unmethylated C's in CHH context: 92001360 Total unmethylated C's in Unknown context: 125764 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.2% Processed 5000000 sequence pairs so far 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1728441 (33.36%) aligned concordantly 0 times 1223610 (23.62%) aligned concordantly exactly 1 time 2228740 (43.02%) aligned concordantly >1 times 66.64% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 1732840 (33.45%) aligned concordantly 0 times 1221767 (23.58%) aligned concordantly exactly 1 time 2226184 (42.97%) aligned concordantly >1 times 66.55% overall alignment rate Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 2974289 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 546651 Sequence pairs did not map uniquely: 1659851 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1489343 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1484946 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 130889891 Total methylated C's in CpG context: 3288923 Total methylated C's in CHG context: 154880 Total methylated C's in CHH context: 705248 Total methylated C's in Unknown context: 19048 Total unmethylated C's in CpG context: 12673882 Total unmethylated C's in CHG context: 22059117 Total unmethylated C's in CHH context: 92007841 Total unmethylated C's in Unknown context: 126636 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 20723164. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.1 /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.1 /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.2 /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.2 /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.3 /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.3 /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.4 /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.4 /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.5 /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.5 /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.6 /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.6 /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.7 /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.7 /tmp/13-wgbs-Qui3-1123286/Qui3_R1.fq.gz.temp.8 /tmp/13-wgbs-Qui3-1123286/Qui3_R2.fq.gz.temp.8 Now merging BAM files Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.2_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.3_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.4_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.5_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.6_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.7_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Qui3_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1_bismark_bt2_PE_report.txt Now merging temporary reports Qui3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Qui3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 41446330 Number of paired-end alignments with a unique best hit: 23803175 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 4367286 Sequence pairs did not map uniquely: 13275869 Sequence pairs which were discarded because genomic sequence could not be extracted: 2 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 11919458 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 11883715 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1047457619 Total methylated C's in CpG context: 26326058 Total methylated C's in CHG context: 1243346 Total methylated C's in CHH context: 5639286 Total methylated C's in Unknown context: 152156 Total unmethylated C's in CpG context: 101463337 Total unmethylated C's in CHG context: 176620425 Total unmethylated C's in CHH context: 736165167 Total unmethylated C's in Unknown context: 1009112 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% Deleting temporary report files... Qui3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 58m 18s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Qui3_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Qui3_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Qui3_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Qui3_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Qui3_pe.bam: 23803173 Total number duplicated alignments removed: 1694560 (7.12%) Duplicated alignments were found at: 1579138 different position(s) Total count of deduplicated leftover sequences: 22108613 (92.88% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Qui3_R1.fq.gz -2 output/13-wgbs/trimmed/Qui3_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui3-1123286 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Qui3_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Qui3_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Qui3_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui3_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui3_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui3_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Qui3_R1.fq.gz -2 output/13-wgbs/trimmed/Qui3_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui3-1123286 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Qui3_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Qui3_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21500000 Processed lines: 21000000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 22000000 Processed lines: 21500000 Processed lines: 22000000 Finished processing child process. Exiting.. Processed lines: 22000000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Processed lines: 22000000 Processed lines: 22000000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.8 Processed 22108613 lines in total Total number of methylation call strings processed: 44217226 Final Cytosine Methylation Report ================================= Total number of C's analysed: 740428889 Total methylated C's in CpG context: 18544364 Total methylated C's in CHG context: 769395 Total methylated C's in CHH context: 3528064 Total C to T conversions in CpG context: 71950973 Total C to T conversions in CHG context: 124900286 Total C to T conversions in CHH context: 520735807 C methylated in CpG context: 20.5% C methylated in non-CpG context: 0.7% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui3_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui3_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui3_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui3_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui3_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Qui3_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui3_pe.deduplicated.txt.gz Writing bedGraph to file: Qui3_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Qui3_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Qui3_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Qui3_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Qui3_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Qui3.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Qui3.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1412033 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1771189 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3151340 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 3013550 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2966344 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2656282 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2919896 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1552390 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2876981 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2731160 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Qui3.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Qui3.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Qui3_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Processed 41500000 lines Processed 42000000 lines Processed 42500000 lines Processed 43000000 lines Processed 43500000 lines Processed 44000000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Qui3_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1888432987 34.69 378413849 32.06 4.990 C 864478416 15.88 211781786 17.94 4.082 G 957366201 17.58 211810957 17.95 4.520 T 1734017014 31.85 378309330 32.05 4.584 AA 696161435 12.88 128492079 10.89 5.418 AC 296445542 5.48 68264877 5.78 4.343 AG 299699584 5.54 62424886 5.29 4.801 AT 583162908 10.79 119230832 10.10 4.891 CA 357711511 6.62 80836853 6.85 4.425 CC 149586749 2.77 42358709 3.59 3.531 CG 104940697 1.94 26104181 2.21 4.020 CT 245570516 4.54 62481783 5.29 3.930 GA 330038671 6.11 67679435 5.73 4.876 GC 139662293 2.58 33452245 2.83 4.175 GG 174558117 3.23 42378301 3.59 4.119 GT 306100632 5.66 68300800 5.79 4.482 TA 490733513 9.08 101400983 8.59 4.840 TC 272505282 5.04 67705770 5.74 4.025 TG 371300223 6.87 80903356 6.85 4.589 TT 587067431 10.86 128294772 10.87 4.576 [Fri Oct 9 15:19:08 PDT 2026] Qui3 done