[Fri Oct 9 12:53:36 PDT 2026] Qui2 (Qui/Quilhua) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 37248902 total bases: 5624584202 Q20 bases: 5553012526(98.7275%) Q30 bases: 5357316851(95.2482%) Q40 bases: 5357316851(95.2482%) Read2 before filtering: total reads: 37248902 total bases: 5624584202 Q20 bases: 5546827386(98.6176%) Q30 bases: 5353834420(95.1863%) Q40 bases: 5353834420(95.1863%) Read1 after filtering: total reads: 36627727 total bases: 5065717056 Q20 bases: 5017442236(99.047%) Q30 bases: 4866068337(96.0588%) Q40 bases: 4866068337(96.0588%) Read2 after filtering: total reads: 36627727 total bases: 5067805331 Q20 bases: 5018135856(99.0199%) Q30 bases: 4862639204(95.9516%) Q40 bases: 4862639204(95.9516%) Filtering result: reads passed filter: 73255454 reads failed due to low quality: 644014 reads failed due to too many N: 1892 reads failed due to too short: 596444 reads with adapter trimmed: 8101702 bases trimmed due to adapters: 163934720 Duplication rate: 5.18274% Insert size peak (evaluated by paired-end reads): 189 JSON report: output/13-wgbs/fastp/Qui2.fastp.json HTML report: output/13-wgbs/fastp/Qui2.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui2 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui2 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Qui2_R1.fq.gz -O output/13-wgbs/trimmed/Qui2_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Qui2.fastp.json --html output/13-wgbs/fastp/Qui2.fastp.html fastp v1.0.1, time used: 73 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Qui2_R1.fq.gz output/13-wgbs/trimmed/Qui2_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Qui2-1874711 Temporary files will be written into the directory: /tmp/13-wgbs-Qui2-1874711/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui2_R1.fq.gz and output/13-wgbs/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui2_R1.fq.gz and output/13-wgbs/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui2_R1.fq.gz and output/13-wgbs/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui2_R1.fq.gz and output/13-wgbs/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui2_R1.fq.gz and output/13-wgbs/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui2_R1.fq.gz and output/13-wgbs/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui2_R1.fq.gz and output/13-wgbs/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui2_R1.fq.gz and output/13-wgbs/trimmed/Qui2_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui2_R1.fq.gz for PID: 1875985 and offset 8 (sequences written out: 4578465) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4578466) Finished subdividing output/13-wgbs/trimmed/Qui2_R2.fq.gz for PID: 1875985 and offset 8 (sequences written out: 4578465) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui2_R2.fq.gz<) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.8 to /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.8_C_to_T.fastq Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.7 to /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.5 to /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.6 to /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.4 to /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.1 to /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.2 to /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.3 to /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.3_C_to_T.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.8 (4578465 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.8 to /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.7 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.7 to /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.5 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.5 to /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.6 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.6 to /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.4 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.4 to /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.1 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.1 to /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.3 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.3 to /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.2 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.2 to /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.2_G_to_A.fastq Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.8 (4578465 sequences in total) Input files are Qui2_R1.fq.gz.temp.8_C_to_T.fastq and Qui2_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.7 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.7_C_to_T.fastq and Qui2_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.5 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.5_C_to_T.fastq and Qui2_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.6 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.6_C_to_T.fastq and Qui2_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.4 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.4_C_to_T.fastq and Qui2_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.1 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.1_C_to_T.fastq and Qui2_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.3 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.3_C_to_T.fastq and Qui2_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.2 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.2_C_to_T.fastq and Qui2_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:51765:1042_1:N:0:CATAAGCC+TATCGGCT/1 99 Chromosome_2A_CT_converted 39432930 6 141M = 39432945 156 TATTTTTTATGTATAATAAAATAAAAAGTATGTTAAATTGGGTTAAATGTAATATGGTTTAGAAGAGGTTATGAAATATATGTTATGTTTATTTTTTTGATGTATGAAAATTAATATGTTAATAAGTTATATTGTTTATTA IIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIII9II9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9 AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:51765:1042_2:N:0:CATAAGCC+TATCGGCT/2 147 Chromosome_2A_CT_converted 39432945 6 141M = 39432930 -156 ATAAAATAAAAAGTATGTTAAATTGGGTTAAATGTAATATGGTTTAGAAGAGGTTATGAAATATATGTTATGTTTATTTTTTTGATGTATGAAAATTAATATGTTAATAAGTTATATTGTTTATTATATTTATATAAAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:1582:1056_1:N:0:CATAAGCC+TNTCGGCT/1 77 * 0 0 * * 0 0 TGTTTAATATATATTTAAATGTGTGTTTATAATTTTTATAAAGATAAAATTATGAATATTTTAAATTTTTTGTTATATATAAAATGTATATGTATATATGTTGTGAATGTTGAATTGAGTGAAGTATTAAAAAGTTTATGG IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:1582:1056_2:N:0:CATAAGCC+TNTCGGCT/2 141 * 0 0 * * 0 0 CCTAACTAAATCATAATTATCACTTAAAACACACCATAAACTTTTTAATACTTCACTCAATTCAACATTCACAACATATATACATATACATTTTATATATAACAAAAAATTTAAAATATTCATAATTTTATCTTTATAAAA III9IIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:37640:1042_1:N:0:CATAAGCC+TATCGGCT/1 99 Chromosome_1B_CT_converted 69334704 1 141M = 69334832 269 TAGTTTTTTTTTTGTAAATTATGTTTTAAGATATGATTTGTTTATTGTTATTTGTATTTTATATAATGATTTATATAAGTATTATTTTGTTTTTATTATATAGAATGTATATAAGGAGATATGAAATTTATTTTTGAATGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIIIIIIIIIIIIIII*IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:37640:1042_2:N:0:CATAAGCC+TATCGGCT/2 147 Chromosome_1B_CT_converted 69334832 1 141M = 69334704 -269 TATTTTTGAATGTTTATAGGTTTTAGTAATTTTTTATGAATTTTAATTTTTTAATTATTGATTGGTTATATTTATTTTATATTTATTTTTATTTATGTAGATTAATAATTTTTATTTAAGTAGTTGATTTTTTTGTATTTT IIIII9IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:140A0 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:43901:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 TTTATATTTAGTATTTGATGTTTAATTTTGTTTAAGTTATGATATAATTAATATTAAAATTTGTATGAGTAATTTGTAAAAAGAATAATAAATTTATTTATTAATAAATGAAAAGAAATTTTAGATATTTGGAAATAAAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:43901:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 TATTAAATACCAAATTATATATATATTATCATATAATTTAATCATACTTTTATTTCCAAATATCTAAAATTTCTTTTCATTTATTAATAAATAAATTTATTATTCTTTTTACAAATTACTCATACAAATTTTAATATTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:39872:1042_1:N:0:CATAAGCC+TATCGGCT/1 99 Chromosome_6A_CT_converted 67424570 6 141M = 67424809 380 TGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-18 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:75A23G41 YS:i:-24 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:39872:1042_2:N:0:CATAAGCC+TATCGGCT/2 147 Chromosome_6A_CT_converted 67424809 6 141M = 67424570 -380 TATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATAGATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATAGATAGATTAATGATAGTGTGTTTTATTGTATAATTAATATATAGATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-24 XS:i:-24 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:4A11G77T9A36 YS:i:-12 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:38238:1042_1:N:0:CATAAGCC+TATCGGCT/1 99 Chromosome_10A_CT_converted 40424304 6 141M = 40424398 235 ATGGTGTGTGTGTGTGTGTGTTATTGATAGAGTATATATTTAAGTGTAAATGTGATGTATGAATATTTTGATATATGTAATTATTTTTTAATGTGTTTTTTAATTAATTTTTGTTGAAAAATTATAAGATTTTTAATGGTT IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-11 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:38238:1042_2:N:0:CATAAGCC+TATCGGCT/2 147 Chromosome_10A_CT_converted 40424398 6 141M = 40424304 -235 GTTTTTTAATTAATTTTTGTTGAAAAATTATAAGATTTTTAATGGTTGTGTTAGAATTTTTATAATGGTTTTGTTTTATTGATTTTTTTTATATGGTGATTTTAAAGTGATATAAGTATTTTGATGATGAGTATTTTAATG 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:36151:1042_1:N:0:CATAAGCC+TATCGGCT/1 99 Chromosome_5B_CT_converted 108855960 1 141M = 108856144 325 TATAAATATATAAATTGTGTTTTATTGTATTAGAAGAAGAATAAAATTTATTTGTTATTTAGTTGTAGATTAGAATGATTAAATTTTTTTTAAATTGTTTATTGAATTGTTTGTAGGAATTTGGGAAGGAGTGGTAGTAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:36151:1042_2:N:0:CATAAGCC+TATCGGCT/2 147 Chromosome_5B_CT_converted 108856144 1 141M = 108855960 -325 AGAGGAATATAAATGTTTTAGTTAATTTGTATTTTATTTATGTATTAATTTTTAAGGAAGAATAATATATTTATAGAAATTTGATATGGATGATTATATATTGTAATAATAATATTTTGAAATTGAAAATGTTTAAATTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:40018:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 AAATTTTATTAATAAAGTTGAAAAATATTAAGTTTATGTGGTAATTATAAATGATATTTGATGATTTTAGATTTTTATTTTTAAGTGTTTGTTTTTTAAAATTATATTTAATTTAAATTAAAATTAATTATATTTTTTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:40018:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 TTCCATTCTCAAATTTTACAAATATCATCACTACAACAAAAATATATTTATTAACTTATTTATCAAATTATTTATTAAACCACACCAATTTATAAAATAATTCTTCAAATTTTCAACCAAAAAAAATAAAACAAAAAAACA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:1582:1056_1:N:0:CATAAGCC+TNTCGGCT/1 83 Chromosome_4A_GA_converted 52134602 42 141M = 52134569 -174 CCATAAACTTTTTAATACTTCACTCAATTCAACATTCACAACATATATACATATACATTTTATATATAACAAAAAATTTAAAATATTCATAATTTTATCTTTATAAAAATTATAAACACACATTTAAATATATATTAAACA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:1582:1056_2:N:0:CATAAGCC+TNTCGGCT/2 163 Chromosome_4A_GA_converted 52134569 42 141M = 52134602 174 CCTAACTAAATCATAATTATCACTTAAAACACACCATAAACTTTTTAATACTTCACTCAATTCAACATTCACAACATATATACATATACATTTTATATATAACAAAAAATTTAAAATATTCATAATTTTATCTTTATAAAA III9IIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:51765:1042_1:N:0:CATAAGCC+TATCGGCT/1 83 Chromosome_7B_GA_converted 38128478 1 141M = 38128463 -156 TAATAAACAATATAACTTATTAACATATTAATTTTCATACATCAAAAAAATAAACATAACATATATTTCATAACCTCTTCTAAACCATATTACATTTAACCCAATTTAACATACTTTTTATTTTATTATACATAAAAAATA 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9II9IIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:30T110 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:51765:1042_2:N:0:CATAAGCC+TATCGGCT/2 163 Chromosome_7B_GA_converted 38128463 1 141M = 38128478 156 AATTTTATATAAATATAATAAACAATATAACTTATTAACATATTAATTTTCATACATCAAAAAAATAAACATAACATATATTTCATAACCTCTTCTAAACCATATTACATTTAACCCAATTTAACATACTTTTTATTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:45T95 YS:i:-6 YT:Z:CP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.8 and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.7 and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.7 Found first alignment: LH00129:489:23JFWNLT4:8:1101:39872:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 TGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:39872:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 AATCTATATATTAATTATACAATAAAACACACTATCATTAATCTATCTATTAATTATACAATAAAACACACTATCTTTAATCTATCTATTAATTATACAATAAAACACACTATCTTTAATCTATATATTAATTATACAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:43901:1042_1:N:0:CATAAGCC+TATCGGCT/1 83 Chromosome_5B_GA_converted 56540801 42 141M = 56540755 -187 CTTTTATTTCCAAATATCTAAAATTTCTTTTCATTTATTAATAAATAAATTTATTATTCTTTTTACAAATTACTCATACAAATTTTAATATTAATTATATCATAACTTAAACAAAATTAAACATCAAATACTAAATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:43901:1042_2:N:0:CATAAGCC+TATCGGCT/2 163 Chromosome_5B_GA_converted 56540755 42 141M = 56540801 187 TATTAAATACCAAATTATATATATATTATCATATAATTTAATCATACTTTTATTTCCAAATATCTAAAATTTCTTTTCATTTATTAATAAATAAATTTATTATTCTTTTTACAAATTACTCATACAAATTTTAATATTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:37640:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 TAGTTTTTTTTTTGTAAATTATGTTTTAAGATATGATTTGTTTATTGTTATTTGTATTTTATATAATGATTTATATAAGTATTATTTTGTTTTTATTATATAGAATGTATATAAGGAGATATGAAATTTATTTTTGAATGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIIIIIIIIIIIIIII*IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:37640:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 AAAATACAAAAAAATCAACTACTTAAATAAAAATTATTAATCTACATAAATAAAAATAAATATAAAATAAATATAACCAATCAATAATTAAAAAATTAAAATTCATAAAAAATTACTAAAACCTATAAACATTCAAAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII9IIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:36151:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 TATAAATATATAAATTGTGTTTTATTGTATTAGAAGAAGAATAAAATTTATTTGTTATTTAGTTGTAGATTAGAATGATTAAATTTTTTTTAAATTGTTTATTGAATTGTTTGTAGGAATTTGGGAAGGAGTGGTAGTAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:36151:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 TAAATTTAAACATTTTCAATTTCAAAATATTATTATTACAATATATAATCATCCATATCAAATTTCTATAAATATATTATTCTTCCTTAAAAATTAATACATAAATAAAATACAAATTAACTAAAACATTTATATTCCTCT IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:40018:1042_1:N:0:CATAAGCC+TATCGGCT/1 83 Chromosome_10A_GA_converted 3834458 42 141M = 3834259 -340 TAAAAAAAATATAATTAATTTTAATTTAAATTAAATATAATTTTAAAAAACAAACACTTAAAAATAAAAATCTAAAATCATCAAATATCATTTATAATTACCACATAAACTTAATATTTTTCAACTTTATTAATAAAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:40018:1042_2:N:0:CATAAGCC+TATCGGCT/2 163 Chromosome_10A_GA_converted 3834259 42 141M = 3834458 340 TTCCATTCTCAAATTTTACAAATATCATCACTACAACAAAAATATATTTATTAACTTATTTATCAAATTATTTATTAAACCACACCAATTTATAAAATAATTCTTCAAATTTTCAACCAAAAAAAATAAAACAAAAAAACA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:38238:1042_1:N:0:CATAAGCC+TATCGGCT/1 83 Chromosome_1B_GA_converted 214066503 2 4M2I96M2I37M = 214066416 -224 AACCATTAAAAATCTTATAATTTTTCAACAAAAATTAATTAAAAAACACATTAAAAAATAATTACATATATCAAAATATTCATACATCACATTTACACTTAAATATATACTCTATCAATAACACACACACACACACACCAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIII AS:i:-70 XS:i:-67 XN:i:0 XM:i:8 XO:i:2 XG:i:4 NM:i:12 MD:Z:3A7T65C33T5T16A0C0A0 YS:i:-60 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:38238:1042_2:N:0:CATAAGCC+TATCGGCT/2 163 Chromosome_1B_GA_converted 214066416 2 28M1I1M1I62M7I41M = 214066503 224 CATTAAAATACTCATCATCAAAATACTTATATCACTTTAAAATCACCATATAAAAAAAATCAATAAAACAAAACCATTATAAAAATTCTAACACAACCATTAAAAATCTTATAATTTTTCAACAAAAATTAATTAAAAAAC IIIIIIIII9IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9 AS:i:-60 XS:i:-65 XN:i:0 XM:i:3 XO:i:3 XG:i:9 NM:i:12 MD:Z:46C35T15T33 YS:i:-70 YT:Z:CP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.4 and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.6 and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.2 and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.1 and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.5 and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.3 and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.3 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2136:50673:7025_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 1 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2136:50665:7039_1:N:0:CATAAGCC+TGTCGGCT Chromosome_4A 1 Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1537219 (33.57%) aligned concordantly 0 times 1064315 (23.25%) aligned concordantly exactly 1 time 1976932 (43.18%) aligned concordantly >1 times 66.43% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1540245 (33.64%) aligned concordantly 0 times 1062566 (23.21%) aligned concordantly exactly 1 time 1975655 (43.15%) aligned concordantly >1 times 66.36% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 2608704 Mapping efficiency: 57.0% Sequence pairs with no alignments under any condition: 507826 Sequence pairs did not map uniquely: 1461936 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1306011 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1302692 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113505555 Total methylated C's in CpG context: 3010479 Total methylated C's in CHG context: 141657 Total methylated C's in CHH context: 640675 Total methylated C's in Unknown context: 15243 Total unmethylated C's in CpG context: 10842978 Total unmethylated C's in CHG context: 19162945 Total unmethylated C's in CHH context: 79706821 Total unmethylated C's in Unknown context: 109849 C methylated in CpG context: 21.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.2% Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1536936 (33.57%) aligned concordantly 0 times 1063020 (23.22%) aligned concordantly exactly 1 time 1978510 (43.21%) aligned concordantly >1 times 66.43% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1540900 (33.66%) aligned concordantly 0 times 1061873 (23.19%) aligned concordantly exactly 1 time 1975693 (43.15%) aligned concordantly >1 times 66.34% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 2611016 Mapping efficiency: 57.0% Sequence pairs with no alignments under any condition: 507418 Sequence pairs did not map uniquely: 1460032 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1306913 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1304103 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113559145 Total methylated C's in CpG context: 3001224 Total methylated C's in CHG context: 142000 Total methylated C's in CHH context: 640718 Total methylated C's in Unknown context: 15519 Total unmethylated C's in CpG context: 10870510 Total unmethylated C's in CHG context: 19169414 Total unmethylated C's in CHH context: 79735279 Total unmethylated C's in Unknown context: 110719 C methylated in CpG context: 21.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.3% 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1536762 (33.56%) aligned concordantly 0 times 1061758 (23.19%) aligned concordantly exactly 1 time 1979946 (43.24%) aligned concordantly >1 times 66.44% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1538097 (33.59%) aligned concordantly 0 times 1061735 (23.19%) aligned concordantly exactly 1 time 1978634 (43.22%) aligned concordantly >1 times 66.41% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 2610150 Mapping efficiency: 57.0% Sequence pairs with no alignments under any condition: 507104 Sequence pairs did not map uniquely: 1461212 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1305766 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1304384 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113518450 Total methylated C's in CpG context: 3000898 Total methylated C's in CHG context: 142220 Total methylated C's in CHH context: 640381 Total methylated C's in Unknown context: 15478 Total unmethylated C's in CpG context: 10866274 Total unmethylated C's in CHG context: 19161162 Total unmethylated C's in CHH context: 79707515 Total unmethylated C's in Unknown context: 110815 C methylated in CpG context: 21.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.3% 4578465 reads; of these: 4578465 (100.00%) were paired; of these: 1535665 (33.54%) aligned concordantly 0 times 1065361 (23.27%) aligned concordantly exactly 1 time 1977439 (43.19%) aligned concordantly >1 times 66.46% overall alignment rate 4578465 reads; of these: 4578465 (100.00%) were paired; of these: 1540975 (33.66%) aligned concordantly 0 times 1062787 (23.21%) aligned concordantly exactly 1 time 1974703 (43.13%) aligned concordantly >1 times 66.34% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1538417 (33.60%) aligned concordantly 0 times 1062133 (23.20%) aligned concordantly exactly 1 time 1977916 (43.20%) aligned concordantly >1 times 66.40% overall alignment rate Processed 4578465 sequences in total 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1538643 (33.61%) aligned concordantly 0 times 1063194 (23.22%) aligned concordantly exactly 1 time 1976629 (43.17%) aligned concordantly >1 times 66.39% overall alignment rate Successfully deleted the temporary files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578465 Number of paired-end alignments with a unique best hit: 2609978 Mapping efficiency: 57.0% Sequence pairs with no alignments under any condition: 506911 Sequence pairs did not map uniquely: 1461576 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1306927 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1303051 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113569221 Total methylated C's in CpG context: 3004057 Total methylated C's in CHG context: 141737 Total methylated C's in CHH context: 640972 Total methylated C's in Unknown context: 15253 Total unmethylated C's in CpG context: 10860123 Total unmethylated C's in CHG context: 19182875 Total unmethylated C's in CHH context: 79739457 Total unmethylated C's in Unknown context: 110550 C methylated in CpG context: 21.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.1% Now waiting for all child processes to complete Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 2611311 Mapping efficiency: 57.0% Sequence pairs with no alignments under any condition: 507419 Sequence pairs did not map uniquely: 1459736 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1305858 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1305453 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113580650 Total methylated C's in CpG context: 3009697 Total methylated C's in CHG context: 142732 Total methylated C's in CHH context: 639944 Total methylated C's in Unknown context: 15336 Total unmethylated C's in CpG context: 10866994 Total unmethylated C's in CHG context: 19178661 Total unmethylated C's in CHH context: 79742622 Total unmethylated C's in Unknown context: 109859 C methylated in CpG context: 21.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.2% Chromosomal sequence could not be extracted for LH00129:492:23M2VFLT4:2:2309:45843:14017_1:N:0:CATAAGCC+TATCGGCT Chromosome_6A 76092826 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1537378 (33.58%) aligned concordantly 0 times 1063996 (23.24%) aligned concordantly exactly 1 time 1977092 (43.18%) aligned concordantly >1 times 66.42% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1539709 (33.63%) aligned concordantly 0 times 1063464 (23.23%) aligned concordantly exactly 1 time 1975293 (43.14%) aligned concordantly >1 times 66.37% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 2610301 Mapping efficiency: 57.0% Sequence pairs with no alignments under any condition: 507508 Sequence pairs did not map uniquely: 1460657 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1305952 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1304348 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113545584 Total methylated C's in CpG context: 3008389 Total methylated C's in CHG context: 142203 Total methylated C's in CHH context: 641683 Total methylated C's in Unknown context: 15262 Total unmethylated C's in CpG context: 10864783 Total unmethylated C's in CHG context: 19166620 Total unmethylated C's in CHH context: 79721906 Total unmethylated C's in Unknown context: 109806 C methylated in CpG context: 21.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.2% 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1537129 (33.57%) aligned concordantly 0 times 1063413 (23.23%) aligned concordantly exactly 1 time 1977924 (43.20%) aligned concordantly >1 times 66.43% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1540522 (33.65%) aligned concordantly 0 times 1062228 (23.20%) aligned concordantly exactly 1 time 1975716 (43.15%) aligned concordantly >1 times 66.35% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 2610101 Mapping efficiency: 57.0% Sequence pairs with no alignments under any condition: 507839 Sequence pairs did not map uniquely: 1460526 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1306058 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1304042 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113540568 Total methylated C's in CpG context: 3006040 Total methylated C's in CHG context: 142220 Total methylated C's in CHH context: 641318 Total methylated C's in Unknown context: 15319 Total unmethylated C's in CpG context: 10865996 Total unmethylated C's in CHG context: 19163713 Total unmethylated C's in CHH context: 79721281 Total unmethylated C's in Unknown context: 110638 C methylated in CpG context: 21.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.2% 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1536399 (33.56%) aligned concordantly 0 times 1065010 (23.26%) aligned concordantly exactly 1 time 1977057 (43.18%) aligned concordantly >1 times 66.44% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1541074 (33.66%) aligned concordantly 0 times 1061697 (23.19%) aligned concordantly exactly 1 time 1975695 (43.15%) aligned concordantly >1 times 66.34% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 2610002 Mapping efficiency: 57.0% Sequence pairs with no alignments under any condition: 508120 Sequence pairs did not map uniquely: 1460344 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1308079 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1301923 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113546648 Total methylated C's in CpG context: 3004600 Total methylated C's in CHG context: 142356 Total methylated C's in CHH context: 640973 Total methylated C's in Unknown context: 14904 Total unmethylated C's in CpG context: 10869393 Total unmethylated C's in CHG context: 19165861 Total unmethylated C's in CHH context: 79723465 Total unmethylated C's in Unknown context: 110130 C methylated in CpG context: 21.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.9% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 18313860. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.1 /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.1 /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.2 /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.2 /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.3 /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.3 /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.4 /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.4 /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.5 /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.5 /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.6 /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.6 /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.7 /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.7 /tmp/13-wgbs-Qui2-1874711/Qui2_R1.fq.gz.temp.8 /tmp/13-wgbs-Qui2-1874711/Qui2_R2.fq.gz.temp.8 Now merging BAM files Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.2_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.3_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.4_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.5_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.6_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.7_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Qui2_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1_bismark_bt2_PE_report.txt Now merging temporary reports Qui2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Qui2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 36627727 Number of paired-end alignments with a unique best hit: 20881563 Mapping efficiency: 57.0% Sequence pairs with no alignments under any condition: 4060145 Sequence pairs did not map uniquely: 11686019 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 10451564 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 10429996 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 908365821 Total methylated C's in CpG context: 24045384 Total methylated C's in CHG context: 1137125 Total methylated C's in CHH context: 5126664 Total methylated C's in Unknown context: 122314 Total unmethylated C's in CpG context: 86907051 Total unmethylated C's in CHG context: 153351251 Total unmethylated C's in CHH context: 637798346 Total unmethylated C's in Unknown context: 882366 C methylated in CpG context: 21.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.2% Deleting temporary report files... Qui2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 52m 17s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Qui2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Qui2_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Qui2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Qui2_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Qui2_pe.bam: 20881560 Total number duplicated alignments removed: 1332633 (6.38%) Duplicated alignments were found at: 1247176 different position(s) Total count of deduplicated leftover sequences: 19548927 (93.62% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Qui2_R1.fq.gz -2 output/13-wgbs/trimmed/Qui2_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui2-1874711 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Qui2_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Qui2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Qui2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui2_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui2_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui2_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Qui2_R1.fq.gz -2 output/13-wgbs/trimmed/Qui2_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui2-1874711 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Qui2_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Qui2_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Now waiting for all child processes to complete Finished processing child process. Exiting.. Processed lines: 19500000 Finished processing child process. Exiting.. Processed lines: 19500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Processed lines: 19500000 Processed lines: 19500000 Finished processing child process. Exiting.. Processed lines: 19500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.8 Processed 19548927 lines in total Total number of methylation call strings processed: 39097854 Final Cytosine Methylation Report ================================= Total number of C's analysed: 652716162 Total methylated C's in CpG context: 17211203 Total methylated C's in CHG context: 711608 Total methylated C's in CHH context: 3232875 Total C to T conversions in CpG context: 62588126 Total C to T conversions in CHG context: 110234401 Total C to T conversions in CHH context: 458737949 C methylated in CpG context: 21.6% C methylated in non-CpG context: 0.7% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui2_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui2_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui2_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui2_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui2_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Qui2_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui2_pe.deduplicated.txt.gz Writing bedGraph to file: Qui2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Qui2_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Qui2_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Qui2_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Qui2_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Qui2.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Qui2.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1351513 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1636828 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 2974520 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2855437 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2818186 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2516637 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2778462 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1400277 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2669218 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2607823 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Qui2.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Qui2.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Qui2_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Qui2_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1686788794 35.04 378413849 32.06 4.458 C 755001257 15.68 211781786 17.94 3.565 G 846774739 17.59 211810957 17.95 3.998 T 1525689253 31.69 378309330 32.05 4.033 AA 629699818 13.17 128492079 10.89 4.901 AC 260917260 5.46 68264877 5.78 3.822 AG 267809811 5.60 62424886 5.29 4.290 AT 516781766 10.81 119230832 10.10 4.334 CA 314644870 6.58 80836853 6.85 3.892 CC 129171109 2.70 42358709 3.59 3.049 CG 91747724 1.92 26104181 2.21 3.515 CT 213627892 4.47 62481783 5.29 3.419 GA 295404434 6.18 67679435 5.73 4.365 GC 121985285 2.55 33452245 2.83 3.647 GG 153849671 3.22 42378301 3.59 3.630 GT 269338958 5.63 68300800 5.79 3.943 TA 434755824 9.10 101400983 8.59 4.287 TC 237453211 4.97 67705770 5.74 3.507 TG 327300526 6.85 80903356 6.85 4.046 TT 515288160 10.78 128294772 10.87 4.016 [Fri Oct 9 14:53:18 PDT 2026] Qui2 done