[Fri Oct 9 11:29:56 PDT 2026] Qui1 (Qui/Quilhua) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 39325033 total bases: 5938079983 Q20 bases: 5870610810(98.8638%) Q30 bases: 5696704896(95.9351%) Q40 bases: 5696704896(95.9351%) Read2 before filtering: total reads: 39325033 total bases: 5938079983 Q20 bases: 5863510309(98.7442%) Q30 bases: 5686813816(95.7686%) Q40 bases: 5686813816(95.7686%) Read1 after filtering: total reads: 38720614 total bases: 5338797963 Q20 bases: 5294000740(99.1609%) Q30 bases: 5160766716(96.6653%) Q40 bases: 5160766716(96.6653%) Read2 after filtering: total reads: 38720614 total bases: 5340552410 Q20 bases: 5294813491(99.1436%) Q30 bases: 5157895060(96.5798%) Q40 bases: 5157895060(96.5798%) Filtering result: reads passed filter: 77441228 reads failed due to low quality: 615766 reads failed due to too many N: 1620 reads failed due to too short: 591452 reads with adapter trimmed: 11202113 bases trimmed due to adapters: 209482108 Duplication rate: 5.90184% Insert size peak (evaluated by paired-end reads): 182 JSON report: output/13-wgbs/fastp/Qui1.fastp.json HTML report: output/13-wgbs/fastp/Qui1.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui1 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui1 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Qui1_R1.fq.gz -O output/13-wgbs/trimmed/Qui1_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Qui1.fastp.json --html output/13-wgbs/fastp/Qui1.fastp.html fastp v1.0.1, time used: 73 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Qui1_R1.fq.gz output/13-wgbs/trimmed/Qui1_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Qui1-2939139 Temporary files will be written into the directory: /tmp/13-wgbs-Qui1-2939139/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui1_R1.fq.gz and output/13-wgbs/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui1_R1.fq.gz and output/13-wgbs/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui1_R1.fq.gz and output/13-wgbs/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui1_R1.fq.gz and output/13-wgbs/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui1_R1.fq.gz and output/13-wgbs/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui1_R1.fq.gz and output/13-wgbs/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui1_R1.fq.gz and output/13-wgbs/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui1_R1.fq.gz and output/13-wgbs/trimmed/Qui1_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Qui1_R1.fq.gz for PID: 2939991 and offset 8 (sequences written out: 4840076) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4840077) Finished subdividing output/13-wgbs/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui1_R1.fq.gz<) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4840076) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.1 to /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.2 to /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.3 to /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui1_R2.fq.gz for PID: 2939991 and offset 8 (sequences written out: 4840076) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.8 to /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4840076) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.7 to /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.5 to /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.4 to /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.6 to /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.6_C_to_T.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.1 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.1 to /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.2 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.2 to /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.7 (4840076 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.7 to /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.3 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.3 to /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.8 (4840076 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.8 to /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.5 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.5 to /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.4 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.4 to /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.6 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.6 to /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.6_G_to_A.fastq Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.2 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.2_C_to_T.fastq and Qui1_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.7 (4840076 sequences in total) Input files are Qui1_R1.fq.gz.temp.7_C_to_T.fastq and Qui1_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.3 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.3_C_to_T.fastq and Qui1_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.8 (4840076 sequences in total) Input files are Qui1_R1.fq.gz.temp.8_C_to_T.fastq and Qui1_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.1 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.1_C_to_T.fastq and Qui1_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.5 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.5_C_to_T.fastq and Qui1_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.4 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.4_C_to_T.fastq and Qui1_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.6 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.6_C_to_T.fastq and Qui1_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:28029:1042_1:N:0:CTGTCACT+ANTATTAA/1 99 Chromosome_4A_CT_converted 54205037 42 141M = 54205086 190 GTTGAGTGGATAATTGTTTTGTGGGTTTTTTGGTAAGTTATGGTTTTTAATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:28029:1042_2:N:0:CTGTCACT+ANTATTAA/2 147 Chromosome_4A_CT_converted 54205086 42 141M = 54205037 -190 ATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTTAGTATATTAATTATATGTAGTTTGTGTTATTTAGTATTTTGTTGATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:138A1G0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:31038:1042_1:N:0:CTGTCACT+ANTATTAA/1 77 * 0 0 * * 0 0 TATTGTATATGAGAGTTTTTTAAAGGGAAATAATTTAAATGTATTTTGTATATTAAATTAAAGTTTTATTGTTTAGATGTATTGAATTTTATATTTTTTATAATTTTTTTTAGATATTATATTTTTTGTAAAATATTGTTT III99IIII9IIIIIIIIIIII9II*IIII9IIIIIIIIIIIIII9III9III9I9IIIIIIIIIIIIIIIIII9I9IIIIIIIIIIIIIIIII*IIII9II9II9IIIII9IIIIIIIIII9I9III*9IIII999IIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:31038:1042_2:N:0:CTGTCACT+ANTATTAA/2 141 * 0 0 * * 0 0 ACTCACAAATAAATAAATTCTATATTCAACAATAAAACATTAAACTTTCTATTCATTACAATTTCTTTAACCTTTCTATAAACTATCTCTTTATTAACATTCTAAACAATATTTTACAAAAAATATAATATCTAAAAAAAA IIIIIIIIIIIIIIII9I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:36507:1042_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_6A_CT_converted 11507376 11 141M = 11507417 182 ATATATGTATTTTTTTTGATAAATGTTTTTGAAATAATTGTAAATATTAGAGATAAAGTATGTAAAAATAAGGGTATTTGTATAGTGTGAAAAGAAATGAAATTTATTGAAATAAAATTTAAATATATTGAAATAAAATGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII AS:i:-12 XS:i:-41 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:5A86T48 YS:i:-24 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:36507:1042_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_6A_CT_converted 11507417 11 141M = 11507376 -182 AAATATTAGAGATAAAGTATGTAAAAATAAGGGTATTTGTATAGTGTGAAAAGAAATGAAATTTATTGAAATAAAATTTAAATATATTGAAATAAAATGAAATTTATTGATATGAAATGAATTTAATTGGAATAAAATTTT IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII AS:i:-24 XS:i:-36 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:51T86A0G0A0 YS:i:-12 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:28013:1042_1:N:0:CTGTCACT+ANTATTAA/1 99 Chromosome_4A_CT_converted 54205037 42 141M = 54205086 190 GTTGAGTGGATAATTGTTTTGTGGGTTTTTTGGTAAGTTATGGTTTTTAATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:28013:1042_2:N:0:CTGTCACT+ANTATTAA/2 147 Chromosome_4A_CT_converted 54205086 42 141M = 54205037 -190 ATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTTAGTATATTAATTATATGTAGTTTGTGTTATTTAGTATTTTGTTGATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:138A1G0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:30844:1042_1:N:0:CTGTCACT+ANTATTAA/1 99 Chromosome_7B_CT_converted 139614165 1 141M = 139614198 174 ATTAATTAATTTTATAAGTTATAATTAATGATAATATATTTTTTAAAAATAAGAATGAAAATGTATATTGTAAATATTAATATGTGGTATAGTAAAGATTTGATGAAGATGTATTTTTTAAAATGTATGTGATTTGAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:30844:1042_2:N:0:CTGTCACT+ANTATTAA/2 147 Chromosome_7B_CT_converted 139614198 1 141M = 139614165 -174 ATATATTTTTTAAAAATAAGAATGAAAATGTATATTGTAAATATTAATATGTGGTATAGTAAAGATTTGATGAAGATGTATTTTTTAAAATGTATGTGATTTGAAATATATTAAATTGAAGGGGGTAAGAAATATGTTATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:29404:1042_1:N:0:CTGTCACT+ANTATTAA/1 99 Chromosome_5B_CT_converted 87245584 42 141M = 87245773 330 TAAATTTTGATTTAGATGTTGATTAGAATATAGAGTTTGAAGTATATTAAAGTTTTGGGATTTGGTTGTATTTAATTGTTTATAGGTTTTGTTTATAATAGTTTTTTATGGAAGTTATATTTAAGTTTGTTATATAATATA IIIIIIIIIIIIIIII9II9IIIIII9IIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29404:1042_2:N:0:CTGTCACT+ANTATTAA/2 147 Chromosome_5B_CT_converted 87245773 42 141M = 87245584 -330 AAATTGTTTTTTATATTTGTGGTTTATTGATAAATTAATAGTTTATTAATTATTGATTAGGTAGTAGTTTGTTTTATTTTTATTGGTTATGTAAGTTATGTGATTTTTGGTTTGTTGTTTTGTTTATGTAATGGTAGGTTT IIIIIIIIIII9IIIIIIIIII9IIIIII9IIIIIIIIII9IIIIIII9IIIII99IIIIII9IIIII9IIII9IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:138G2 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:27042:1042_1:N:0:CTGTCACT+ANTATTAA/1 99 Chromosome_4A_CT_converted 21285240 42 141M = 21285515 414 ATGTTTATATTTTTTTTGGAATTTATTATTATAAAATTTGTATATGAAGGGGTTAGTAATAAAGTTAATGATATAAATTTGATTTAAAAAGGTTATTGTTATTAGTTTATTTTTATTAAGAATAAATTAAAAGTTTGTGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-11 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:27042:1042_2:N:0:CTGTCACT+ANTATTAA/2 147 Chromosome_4A_CT_converted 21285515 42 1M2I138M = 21285240 -414 GTTTTTTTTTTTTTTTTTTTTTAATGTTGTATTAAGGGTATTATAGGTTGATGGTGAATAATTTGATATTTTTGGTTTATTGATATTATTGATGTAGAAAGTGGAGAAAGATTTAGGATTTTTAGATTGGTTGAAGATTTT *9*9*9*II9II9IIII9IIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-11 XN:i:0 XM:i:0 XO:i:1 XG:i:2 NM:i:2 MD:Z:139 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:44468:1042_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_5B_CT_converted 44008024 42 67M1I73M = 44008288 405 TTTGGTTGGGAATGTTATATTTTTTTATTAAAATTATGTGGGATGTAAAAGTATATTTAATATGTGAGGGGGTTATTTAAAGTTATTAAAAGTAGATTAGTTATTGTTTTTGGGATTAAAAAGTATTGTTATTTGTTATGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII AS:i:-8 XN:i:0 XM:i:0 XO:i:1 XG:i:1 NM:i:1 MD:Z:140 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:44468:1042_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_5B_CT_converted 44008288 42 141M = 44008024 -405 AATGTTATTAAATTTTTGTTATTATATTGTAGAGTTGATTTTTTTTAAGTAATTGATAAATTTTTATTATTGTAAGTTTTAAGTTAATTGTATATATGTTTATTATAAGTAAGAGTAATTTTGTAGTAAATAAATTATTTT IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:17A123 YS:i:-8 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:28013:1042_1:N:0:CTGTCACT+ANTATTAA/1 77 * 0 0 * * 0 0 GTTGAGTGGATAATTGTTTTGTGGGTTTTTTGGTAAGTTATGGTTTTTAATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:28013:1042_2:N:0:CTGTCACT+ANTATTAA/2 141 * 0 0 * * 0 0 AAAATCAACAAAATACTAAATAACACAAACTACATATAATTAATATACTAACAATATAATCCACCACAAACAAAAATTAAATATTAAAATCTACAAACATACAATCCTAACTATTTCATCCATACTTCACCCATACAATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:28029:1042_1:N:0:CTGTCACT+ANTATTAA/1 77 * 0 0 * * 0 0 GTTGAGTGGATAATTGTTTTGTGGGTTTTTTGGTAAGTTATGGTTTTTAATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:28029:1042_2:N:0:CTGTCACT+ANTATTAA/2 141 * 0 0 * * 0 0 AAAATCAACAAAATACTAAATAACACAAACTACATATAATTAATATACTAACAATATAATCCACCACAAACAAAAATTAAATATTAAAATCTACAAACATACAATCCTAACTATTTCATCCATACTTCACCCATACAATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:30844:1042_1:N:0:CTGTCACT+ANTATTAA/1 83 Chromosome_7B_GA_converted 178563329 1 141M = 178563296 -174 TATTTCAAATCACATACATTTTAAAAAATACATCTTCATCAAATCTTTACTATACCACATATTAATATTTACAATATACATTTTCATTCTTATTTTTAAAAAATATATTATCATTAATTATAACTTATAAAATTAATTAAT IIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:30844:1042_2:N:0:CTGTCACT+ANTATTAA/2 163 Chromosome_7B_GA_converted 178563296 1 141M = 178563329 174 AATAACATATTTCTTACCCCCTTCAATTTAATATATTTCAAATCACATACATTTTAAAAAATACATCTTCATCAAATCTTTACTATACCACATATTAATATTTACAATATACATTTTCATTCTTATTTTTAAAAAATATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:27042:1042_1:N:0:CTGTCACT+ANTATTAA/1 77 * 0 0 * * 0 0 ATGTTTATATTTTTTTTGGAATTTATTATTATAAAATTTGTATATGAAGGGGTTAGTAATAAAGTTAATGATATAAATTTGATTTAAAAAGGTTATTGTTATTAGTTTATTTTTATTAAGAATAAATTAAAAGTTTGTGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:27042:1042_2:N:0:CTGTCACT+ANTATTAA/2 141 * 0 0 * * 0 0 AAAATCTTCAACCAATCTAAAAATCCTAAATCTTTCTCCACTTTCTACATCAATAATATCAATAAACCAAAAATATCAAATTATTCACCATCAACCTATAATACCCTTAATACAACATTAAAAAAAAAAAAAAAAAAAAAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII9IIII9II9II*9*9*9* YT:Z:UP >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:31038:1042_1:N:0:CTGTCACT+ANTATTAA/1 83 Chromosome_2A_GA_converted 42905550 42 141M = 42905447 -244 AAACAATATTTTACAAAAAATATAATATCTAAAAAAAATTATAAAAAATATAAAATTCAATACATCTAAACAATAAAACTTTAATTTAATATACAAAATACATTTAAATTATTTCCCTTTAAAAAACTCTCATATACAATA IIII999IIII9*III9I9IIIIIIIIII9IIIII9II9II9IIII*IIIIIIIIIIIIIIIII9I9IIIIIIIIIIIIIIIIII9I9III9III9IIIIIIIIIIIIII9IIII*II9IIIIIIIIIIII9IIII99III AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:31038:1042_2:N:0:CTGTCACT+ANTATTAA/2 163 Chromosome_2A_GA_converted 42905447 42 141M = 42905550 244 ACTCACAAATAAATAAATTCTATATTCAACAATAAAACATTAAACTTTCTATTCATTACAATTTCTTTAACCTTTCTATAAACTATCTCTTTATTAACATTCTAAACAATATTTTACAAAAAATATAATATCTAAAAAAAA IIIIIIIIIIIIIIII9I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:44T96 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:36507:1042_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 ATATATGTATTTTTTTTGATAAATGTTTTTGAAATAATTGTAAATATTAGAGATAAAGTATGTAAAAATAAGGGTATTTGTATAGTGTGAAAAGAAATGAAATTTATTGAAATAAAATTTAAATATATTGAAATAAAATGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:36507:1042_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 AAAATTTTATTCCAATTAAATTCATTTCATATCAATAAATTTCATTTTATTTCAATATATTTAAATTTTATTTCAATAAATTTCATTTCTTTTCACACTATACAAATACCCTTATTTTTACATACTTTATCTCTAATATTT IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:29404:1042_1:N:0:CTGTCACT+ANTATTAA/1 77 * 0 0 * * 0 0 TAAATTTTGATTTAGATGTTGATTAGAATATAGAGTTTGAAGTATATTAAAGTTTTGGGATTTGGTTGTATTTAATTGTTTATAGGTTTTGTTTATAATAGTTTTTTATGGAAGTTATATTTAAGTTTGTTATATAATATA IIIIIIIIIIIIIIII9II9IIIIII9IIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:29404:1042_2:N:0:CTGTCACT+ANTATTAA/2 141 * 0 0 * * 0 0 AAACCTACCATTACATAAACAAAACAACAAACCAAAAATCACATAACTTACATAACCAATAAAAATAAAACAAACTACTACCTAATCAATAATTAATAAACTATTAATTTATCAATAAACCACAAATATAAAAAACAATTT IIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIII9IIIII9IIIIII99IIIII9IIIIIII9IIIIIIIIII9IIIIII9IIIIIIIIII9IIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:44468:1042_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 TTTGGTTGGGAATGTTATATTTTTTTATTAAAATTATGTGGGATGTAAAAGTATATTTAATATGTGAGGGGGTTATTTAAAGTTATTAAAAGTAGATTAGTTATTGTTTTTGGGATTAAAAAGTATTGTTATTTGTTATGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:44468:1042_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 AAAATAATTTATTTACTACAAAATTACTCTTACTTATAATAAACATATATACAATTAACTTAAAACTTACAATAATAAAAATTTATCAATTACTTAAAAAAAATCAACTCTACAATATAATAACAAAAATTTAATAACATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.2 and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.3 and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.1 and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.6 and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.7 and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.5 and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.4 and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.8 and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.8 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 4000000 sequence pairs so far 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1605846 (33.18%) aligned concordantly 0 times 1137509 (23.50%) aligned concordantly exactly 1 time 2096722 (43.32%) aligned concordantly >1 times 66.82% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1606210 (33.19%) aligned concordantly 0 times 1138217 (23.52%) aligned concordantly exactly 1 time 2095650 (43.30%) aligned concordantly >1 times 66.81% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 2765219 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 509884 Sequence pairs did not map uniquely: 1564974 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1383352 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1381867 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 124489083 Total methylated C's in CpG context: 2947922 Total methylated C's in CHG context: 160687 Total methylated C's in CHH context: 712172 Total methylated C's in Unknown context: 17861 Total unmethylated C's in CpG context: 12558320 Total unmethylated C's in CHG context: 21142157 Total unmethylated C's in CHH context: 86967825 Total unmethylated C's in Unknown context: 119410 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.0% Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1604506 (33.15%) aligned concordantly 0 times 1139174 (23.54%) aligned concordantly exactly 1 time 2096397 (43.31%) aligned concordantly >1 times 66.85% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1605229 (33.17%) aligned concordantly 0 times 1135834 (23.47%) aligned concordantly exactly 1 time 2099014 (43.37%) aligned concordantly >1 times 66.83% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 2763070 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 510294 Sequence pairs did not map uniquely: 1566713 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1383253 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1379817 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 124394317 Total methylated C's in CpG context: 2938529 Total methylated C's in CHG context: 160197 Total methylated C's in CHH context: 711185 Total methylated C's in Unknown context: 17715 Total unmethylated C's in CpG context: 12563508 Total unmethylated C's in CHG context: 21122437 Total unmethylated C's in CHH context: 86898461 Total unmethylated C's in Unknown context: 119657 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1605984 (33.18%) aligned concordantly 0 times 1136697 (23.49%) aligned concordantly exactly 1 time 2097396 (43.33%) aligned concordantly >1 times 66.82% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1603521 (33.13%) aligned concordantly 0 times 1139827 (23.55%) aligned concordantly exactly 1 time 2096729 (43.32%) aligned concordantly >1 times 66.87% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 2764278 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 510320 Sequence pairs did not map uniquely: 1565479 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1385087 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1379191 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 124403730 Total methylated C's in CpG context: 2936140 Total methylated C's in CHG context: 160533 Total methylated C's in CHH context: 711865 Total methylated C's in Unknown context: 17389 Total unmethylated C's in CpG context: 12566411 Total unmethylated C's in CHG context: 21126469 Total unmethylated C's in CHH context: 86902312 Total unmethylated C's in Unknown context: 118840 C methylated in CpG context: 18.9% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.8% 4840076 reads; of these: 4840076 (100.00%) were paired; of these: 1607284 (33.21%) aligned concordantly 0 times 1136745 (23.49%) aligned concordantly exactly 1 time 2096047 (43.31%) aligned concordantly >1 times 66.79% overall alignment rate 4840076 reads; of these: 4840076 (100.00%) were paired; of these: 1605026 (33.16%) aligned concordantly 0 times 1139703 (23.55%) aligned concordantly exactly 1 time 2095347 (43.29%) aligned concordantly >1 times 66.84% overall alignment rate Processed 4840076 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840076 Number of paired-end alignments with a unique best hit: 2764359 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 510918 Sequence pairs did not map uniquely: 1564799 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1384768 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1379591 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 124439140 Total methylated C's in CpG context: 2938386 Total methylated C's in CHG context: 160872 Total methylated C's in CHH context: 712010 Total methylated C's in Unknown context: 17558 Total unmethylated C's in CpG context: 12577199 Total unmethylated C's in CHG context: 21120584 Total unmethylated C's in CHH context: 86930089 Total unmethylated C's in Unknown context: 119260 C methylated in CpG context: 18.9% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.8% Now waiting for all child processes to complete 4840076 reads; of these: 4840076 (100.00%) were paired; of these: 1606820 (33.20%) aligned concordantly 0 times 1137841 (23.51%) aligned concordantly exactly 1 time 2095415 (43.29%) aligned concordantly >1 times 66.80% overall alignment rate 4840076 reads; of these: 4840076 (100.00%) were paired; of these: 1604024 (33.14%) aligned concordantly 0 times 1138768 (23.53%) aligned concordantly exactly 1 time 2097284 (43.33%) aligned concordantly >1 times 66.86% overall alignment rate Processed 4840076 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840076 Number of paired-end alignments with a unique best hit: 2764053 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 510234 Sequence pairs did not map uniquely: 1565789 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1383910 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1380143 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 124407436 Total methylated C's in CpG context: 2940401 Total methylated C's in CHG context: 159850 Total methylated C's in CHH context: 714058 Total methylated C's in Unknown context: 17668 Total unmethylated C's in CpG context: 12567443 Total unmethylated C's in CHG context: 21114676 Total unmethylated C's in CHH context: 86911008 Total unmethylated C's in Unknown context: 119267 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1606445 (33.19%) aligned concordantly 0 times 1136553 (23.48%) aligned concordantly exactly 1 time 2097079 (43.33%) aligned concordantly >1 times 66.81% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1603947 (33.14%) aligned concordantly 0 times 1137409 (23.50%) aligned concordantly exactly 1 time 2098721 (43.36%) aligned concordantly >1 times 66.86% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 2760694 Mapping efficiency: 57.0% Sequence pairs with no alignments under any condition: 510684 Sequence pairs did not map uniquely: 1568699 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1380072 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1380622 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 124269724 Total methylated C's in CpG context: 2937006 Total methylated C's in CHG context: 159607 Total methylated C's in CHH context: 710559 Total methylated C's in Unknown context: 17531 Total unmethylated C's in CpG context: 12555341 Total unmethylated C's in CHG context: 21105117 Total unmethylated C's in CHH context: 86802094 Total unmethylated C's in Unknown context: 118377 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1603215 (33.12%) aligned concordantly 0 times 1140501 (23.56%) aligned concordantly exactly 1 time 2096361 (43.31%) aligned concordantly >1 times 66.88% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1606372 (33.19%) aligned concordantly 0 times 1138030 (23.51%) aligned concordantly exactly 1 time 2095675 (43.30%) aligned concordantly >1 times 66.81% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 2763032 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 509967 Sequence pairs did not map uniquely: 1567078 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1383095 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1379937 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 124339490 Total methylated C's in CpG context: 2944404 Total methylated C's in CHG context: 160605 Total methylated C's in CHH context: 710281 Total methylated C's in Unknown context: 17612 Total unmethylated C's in CpG context: 12560550 Total unmethylated C's in CHG context: 21112222 Total unmethylated C's in CHH context: 86851428 Total unmethylated C's in Unknown context: 118868 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1607493 (33.21%) aligned concordantly 0 times 1136877 (23.49%) aligned concordantly exactly 1 time 2095707 (43.30%) aligned concordantly >1 times 66.79% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1605820 (33.18%) aligned concordantly 0 times 1138947 (23.53%) aligned concordantly exactly 1 time 2095310 (43.29%) aligned concordantly >1 times 66.82% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 2764712 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 511025 Sequence pairs did not map uniquely: 1564340 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1383066 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1381646 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 124469711 Total methylated C's in CpG context: 2939434 Total methylated C's in CHG context: 161428 Total methylated C's in CHH context: 710841 Total methylated C's in Unknown context: 17593 Total unmethylated C's in CpG context: 12573379 Total unmethylated C's in CHG context: 21141645 Total unmethylated C's in CHH context: 86942984 Total unmethylated C's in Unknown context: 119121 C methylated in CpG context: 18.9% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 19360304. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.1 /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.1 /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.2 /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.2 /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.3 /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.3 /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.4 /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.4 /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.5 /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.5 /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.6 /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.6 /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.7 /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.7 /tmp/13-wgbs-Qui1-2939139/Qui1_R1.fq.gz.temp.8 /tmp/13-wgbs-Qui1-2939139/Qui1_R2.fq.gz.temp.8 Now merging BAM files Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.2_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.3_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.4_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.5_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.6_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.7_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Qui1_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1_bismark_bt2_PE_report.txt Now merging temporary reports Qui1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Qui1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 38720614 Number of paired-end alignments with a unique best hit: 22109417 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 4083326 Sequence pairs did not map uniquely: 12527871 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 11066603 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 11042814 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 995212631 Total methylated C's in CpG context: 23522222 Total methylated C's in CHG context: 1283779 Total methylated C's in CHH context: 5692971 Total methylated C's in Unknown context: 140927 Total unmethylated C's in CpG context: 100522151 Total unmethylated C's in CHG context: 168985307 Total unmethylated C's in CHH context: 695206201 Total unmethylated C's in Unknown context: 952800 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% Deleting temporary report files... Qui1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 56m 29s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Qui1_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Qui1_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Qui1_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Qui1_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Qui1_pe.bam: 22109417 Total number duplicated alignments removed: 1556082 (7.04%) Duplicated alignments were found at: 1456048 different position(s) Total count of deduplicated leftover sequences: 20553335 (92.96% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Qui1_R1.fq.gz -2 output/13-wgbs/trimmed/Qui1_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui1-2939139 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Qui1_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Qui1_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Qui1_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui1_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui1_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui1_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Qui1_R1.fq.gz -2 output/13-wgbs/trimmed/Qui1_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui1-2939139 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Qui1_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Qui1_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Finished processing child process. Exiting.. Processed lines: 20500000 Processed lines: 20500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Processed lines: 20500000 Processed lines: 20500000 Finished processing child process. Exiting.. Now waiting for all child processes to complete All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.8 Processed 20553335 lines in total Total number of methylation call strings processed: 41106670 Final Cytosine Methylation Report ================================= Total number of C's analysed: 681607898 Total methylated C's in CpG context: 16050161 Total methylated C's in CHG context: 827077 Total methylated C's in CHH context: 3701600 Total C to T conversions in CpG context: 68978789 Total C to T conversions in CHG context: 115705012 Total C to T conversions in CHH context: 476345259 C methylated in CpG context: 18.9% C methylated in non-CpG context: 0.8% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui1_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui1_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui1_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui1_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui1_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Qui1_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui1_pe.deduplicated.txt.gz Writing bedGraph to file: Qui1_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Qui1_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Qui1_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Qui1_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Qui1_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Qui1.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Qui1.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1476957 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1780912 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3231922 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 3083415 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 3075296 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2709052 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2986792 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1501088 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 3025829 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2807962 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Qui1.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Qui1.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Qui1_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Qui1_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1715601508 33.90 378413849 32.06 4.534 C 823032258 16.26 211781786 17.94 3.886 G 900538790 17.80 211810957 17.95 4.252 T 1621005565 32.03 378309330 32.05 4.285 AA 616914771 12.28 128492079 10.89 4.801 AC 277005264 5.51 68264877 5.78 4.058 AG 275600145 5.49 62424886 5.29 4.415 AT 534285278 10.64 119230832 10.10 4.481 CA 334053619 6.65 80836853 6.85 4.132 CC 145567099 2.90 42358709 3.59 3.437 CG 102004660 2.03 26104181 2.21 3.908 CT 235044109 4.68 62481783 5.29 3.762 GA 302748577 6.03 67679435 5.73 4.473 GC 134402858 2.68 33452245 2.83 4.018 GG 165856197 3.30 42378301 3.59 3.914 GT 290946367 5.79 68300800 5.79 4.260 TA 449299287 8.94 101400983 8.59 4.431 TC 260066479 5.18 67705770 5.74 3.841 TG 350609526 6.98 80903356 6.85 4.334 TT 549431016 10.94 128294772 10.87 4.283 [Fri Oct 9 13:36:28 PDT 2026] Qui1 done