[Fri Oct 9 11:29:43 PDT 2026] Pum5 (Pum/Pumalin) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 22785307 total bases: 3440581357 Q20 bases: 3400725532(98.8416%) Q30 bases: 3296353389(95.808%) Q40 bases: 3296353389(95.808%) Read2 before filtering: total reads: 22785307 total bases: 3440581357 Q20 bases: 3395341730(98.6851%) Q30 bases: 3284913244(95.4755%) Q40 bases: 3284913244(95.4755%) Read1 after filtering: total reads: 22411610 total bases: 3102940169 Q20 bases: 3076217248(99.1388%) Q30 bases: 2995784498(96.5466%) Q40 bases: 2995784498(96.5466%) Read2 after filtering: total reads: 22411610 total bases: 3103986879 Q20 bases: 3075020329(99.0668%) Q30 bases: 2986593824(96.218%) Q40 bases: 2986593824(96.218%) Filtering result: reads passed filter: 44823220 reads failed due to low quality: 358562 reads failed due to too many N: 930 reads failed due to too short: 387902 reads with adapter trimmed: 4371487 bases trimmed due to adapters: 98663864 Duplication rate: 3.5443% Insert size peak (evaluated by paired-end reads): 230 JSON report: output/13-wgbs/fastp/Pum5.fastp.json HTML report: output/13-wgbs/fastp/Pum5.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/PUM5 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/PUM5 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Pum5_R1.fq.gz -O output/13-wgbs/trimmed/Pum5_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Pum5.fastp.json --html output/13-wgbs/fastp/Pum5.fastp.html fastp v1.0.1, time used: 48 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Pum5_R1.fq.gz output/13-wgbs/trimmed/Pum5_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Pum5-1800724 Temporary files will be written into the directory: /tmp/13-wgbs-Pum5-1800724/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum5_R1.fq.gz and output/13-wgbs/trimmed/Pum5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum5_R1.fq.gz and output/13-wgbs/trimmed/Pum5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum5_R1.fq.gz and output/13-wgbs/trimmed/Pum5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum5_R1.fq.gz and output/13-wgbs/trimmed/Pum5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum5_R1.fq.gz and output/13-wgbs/trimmed/Pum5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum5_R1.fq.gz and output/13-wgbs/trimmed/Pum5_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum5_R1.fq.gz and output/13-wgbs/trimmed/Pum5_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum5_R1.fq.gz and output/13-wgbs/trimmed/Pum5_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Pum5_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum5_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 2801452) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum5_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum5_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum5_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum5_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 2801452) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum5_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum5_R1.fq.gz for PID: 1801610 and offset 8 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum5_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum5_R1.fq.gz.temp.4 to /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum5_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum5_R1.fq.gz.temp.5 to /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum5_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum5_R1.fq.gz.temp.3 to /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum5_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 2801452) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum5_R1.fq.gz.temp.1 to /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum5_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum5_R1.fq.gz.temp.6 to /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum5_R2.fq.gz for PID: 1801610 and offset 8 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum5_R1.fq.gz.temp.8 to /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum5_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 2801452) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum5_R1.fq.gz.temp.2 to /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum5_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 2801451) Using the subset file >/tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum5_R1.fq.gz.temp.7 to /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.7_C_to_T.fastq Created C -> T converted version of the FastQ file Pum5_R1.fq.gz.temp.5 (2801451 sequences in total) Writing a G -> A converted version of the input file Pum5_R2.fq.gz.temp.5 to /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Pum5_R1.fq.gz.temp.4 (2801451 sequences in total) Writing a G -> A converted version of the input file Pum5_R2.fq.gz.temp.4 to /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Pum5_R1.fq.gz.temp.3 (2801451 sequences in total) Writing a G -> A converted version of the input file Pum5_R2.fq.gz.temp.3 to /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Pum5_R1.fq.gz.temp.1 (2801452 sequences in total) Writing a G -> A converted version of the input file Pum5_R2.fq.gz.temp.1 to /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Pum5_R1.fq.gz.temp.6 (2801451 sequences in total) Writing a G -> A converted version of the input file Pum5_R2.fq.gz.temp.6 to /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Pum5_R1.fq.gz.temp.8 (2801451 sequences in total) Writing a G -> A converted version of the input file Pum5_R2.fq.gz.temp.8 to /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Pum5_R1.fq.gz.temp.2 (2801452 sequences in total) Writing a G -> A converted version of the input file Pum5_R2.fq.gz.temp.2 to /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Pum5_R1.fq.gz.temp.7 (2801451 sequences in total) Writing a G -> A converted version of the input file Pum5_R2.fq.gz.temp.7 to /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.7_G_to_A.fastq Created G -> A converted version of the FastQ file Pum5_R2.fq.gz.temp.5 (2801451 sequences in total) Input files are Pum5_R1.fq.gz.temp.5_C_to_T.fastq and Pum5_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum5_R2.fq.gz.temp.4 (2801451 sequences in total) Input files are Pum5_R1.fq.gz.temp.4_C_to_T.fastq and Pum5_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum5_R2.fq.gz.temp.3 (2801451 sequences in total) Input files are Pum5_R1.fq.gz.temp.3_C_to_T.fastq and Pum5_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum5_R2.fq.gz.temp.1 (2801452 sequences in total) Input files are Pum5_R1.fq.gz.temp.1_C_to_T.fastq and Pum5_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum5_R2.fq.gz.temp.6 (2801451 sequences in total) Input files are Pum5_R1.fq.gz.temp.6_C_to_T.fastq and Pum5_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum5_R2.fq.gz.temp.8 (2801451 sequences in total) Input files are Pum5_R1.fq.gz.temp.8_C_to_T.fastq and Pum5_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum5_R2.fq.gz.temp.7 (2801451 sequences in total) Input files are Pum5_R1.fq.gz.temp.7_C_to_T.fastq and Pum5_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum5_R2.fq.gz.temp.2 (2801452 sequences in total) Input files are Pum5_R1.fq.gz.temp.2_C_to_T.fastq and Pum5_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:2282:42235:26488_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 GAATATTAAAATTATGTTTTAGATATATTAAAATAAAAGTGTGTATTATTTATTTTTTTGTATTTAGTAGATTAGAAGTGATAAATGAATTAGAAAGGTTAAATGAGGAATATGGTTTGTTTTTAGTTGATAAAGTTTGTA IIIIII9IIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIII9IIIIII9II YT:Z:UP LH00129:489:23JFWNLT4:8:2282:42235:26488_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 TTAAAATATAAATAAAATTACCAAATATAAAATAAATACCAAATTCACTTAAATTACAATTATAATAATAAACATTACAAAAACAATATTATTACAAACTTTATCAACTAAAAACAAACCATATTCCTCATTTAACCTTTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I99III9III9IIII9IIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2452:4891:5190_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TTGGTATAATGTAGGTGATTTTTTTGGTATTTTTGTAAGATTTTAATTTAATAAGTTGATTTGATATTTAAATAAAGGAAATTTTGTAGATTTGATGATTATTTTAAGGAGAAAAGGGTAAAATAATATTATTTTTGAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2452:4891:5190_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 ATAAAAATAATACTACATACTTCAAATATTAAAATTTTTATAAAAATTATACAAATCTTAATATTTCTTCTCCTTAAATAAACCCTCTTTTACACCAAATTAAAAAAAAAAAATAAAACAAAATCAAAAATACATTTAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I9*III9IIIIIIIIIII9IIIIII9I9* YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1221:35366:8118_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_8B_CT_converted 24189652 0 78M2I61M = 24189873 362 GTGTTTATAGAGAGAGAGAATAATGTATAGAGTGTGTTTATAGGGAGAGAGAATGATGTATAGAGTGTGTTTATATGGAAAGAGAATGGTGTATAGAGTGTGTTTATAGAGAAAGAGAATGGTGTATAGAGTGTGTTTGTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-59 XS:i:-54 XN:i:0 XM:i:8 XO:i:1 XG:i:2 NM:i:10 MD:Z:10G10G46T6A31G2G8A16A2 YS:i:-60 YT:Z:CP LH00129:489:23JFWNLT4:8:1221:35366:8118_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_8B_CT_converted 24189873 0 141M = 24189652 -362 TATATTGTGTTTATAGGGAAAGAGAATAATGTATAGAGTGTGTTTATGGGGAAAGAGAATGGTGTATAGAGTGTGTTTATAGGGAAAGAGAATGATGAAGAGAGTGTGTTTATAGGGAGAGAGAATGATGTATAGAGTGTG III99IIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-60 XS:i:-60 XN:i:0 XM:i:10 XO:i:0 XG:i:0 NM:i:10 MD:Z:2G1G14G7G19A4G17A14G11T1T41 YS:i:-59 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2390:3387:20407_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_1B_CT_converted 99925103 42 141M = 99925138 176 GTATTGAGATGTTAATTGAGGTTTTTATTTGTAGGAGTATATTAGGTAAAATGTATATTATATATATATAGTAAAATTGTAGAAAAAGTTTATGGTATAGGTAATAGGTAGAAATAAGAGTATTGTAAATGGTATAATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:106A34 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:2390:3387:20407_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_1B_CT_converted 99925138 42 141M = 99925103 -176 AGTATATTAGGTAAAATGTATATTATATATATATAGTAAAATTGTAGAAAAAGTTTATGGTATAGGTAATAGGTAGAAATAAGAGTATTGTAAATGGTATAATATATGTTTGTTGGATAATGAAATTTAATTTGGAAGTAT IIIIIII9IIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:71A69 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1258:2537:12546_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TTTATTAGTAAAATTTATTTTTTTGGTTTTTTTTTTGTTTATTGGATTAGTAGTGAAATGATGTGAAGAAAGTTATTGATAAAGTGGATGTAATTGAGAATGTTAAGATATTGGTAAGTTGTAGAAGGTGATTAAATGGGG II9IIIIIIIII*IIIIIIIIIIIIIIIIIIIII9IIIIIII99I99I9III9IIIIIIIIIIII99I9IIII9*IIIIII9IIIIIIIII9II*III*IIIII****9I9I*III*III*9I9III*999IIII9I*III YT:Z:UP LH00129:489:23JFWNLT4:8:1258:2537:12546_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 TAATTAATTAAATATTATTTAACATTCCTCTCAAAACTATTTCACTCATATAAAAACATCACCACTACCAATAAAAAACTACACAATTTCCATATAATCCTCTACTTAACACTTATAACCTTTAAACAAAACAAAATCTTT 99999**99***9*9*99*99*9**9*999999999**999II*999III*I9I**IIII*99*99I9II999*99II9I*99*9I*99*I***II***9**9*99*999II9I*I*9I9*I*IIII*9***99**I99I9 YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2164:36272:1308_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_2A_CT_converted 30077503 24 120M6D2M2D1M2D18M = 30077802 440 AAATTTTATTTAGTGAAATTGATAGTTTTTAAGATATTTTGAATTTGAGAGAATAATAGTAAGGGGTAAAATTAAAAGTTTAATGTTTGATAAAAAATTAAATTTATATAGTTTTTATTATAGTTTAAAATTAAATATGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-45 XN:i:0 XM:i:0 XO:i:3 XG:i:10 NM:i:10 MD:Z:120^AGATTT2^TT1^TT18 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:2164:36272:1308_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_2A_CT_converted 30077802 24 141M = 30077503 -440 TTAAATTGAATGTGTTATTAATGTTAGATGATAGAAATTTAATATTAGAGTTTTTATTTTTTTTTTTTTTAATTATTTGAATTTAGATTTTTATTTGATATTGGTTATAGATTTTGTTTTTAAATTAGTTTAATATTTATA III999IIIIIIII9III9*III999I9III99IIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:7A133 YS:i:-45 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2158:5037:17661_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_1B_CT_converted 228348611 42 141M = 228348649 179 TTTATAGGATTGAAAATTTGTAATTTGATGGTAATGTTGTTAAATATTATGATATAGGATTGTTTGGTGTATGTGAAAAGTGATTTTATGAATGTAGATATTATTGTGATAGAGGGTTGGTAAGTTTTGGATGAATGGAGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:2158:5037:17661_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_1B_CT_converted 228348649 42 141M = 228348611 -179 GTTAAATATTATGATATAGGATTGTTTGGTGTATGTGAAAAGTGATTTTATGAATGTAGATATTATTGTGATAGAGGGTTGGTAAGTTTTGGATGAATGGAGTTTGTGTAAATTTTAAAAGGAATTTTGTTTATTTTGGTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1369:50923:15839_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_1B_CT_converted 113123231 1 141M = 113123367 277 ATAATTATAAATTAAAAGTTAATTTAAAGAGATGTGTTTTGAGGTTTATTTTAAAATTAGATAATGAAGTATATTGTTTGAGTTTAAAAGGTAGAGAATTTTAGAGATTTGATGTAATTTTGTTTAAATGTTGATTTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:116G24 YS:i:-24 YT:Z:CP LH00129:489:23JFWNLT4:8:1369:50923:15839_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_1B_CT_converted 113123367 1 141M = 113123231 -277 TTTATATTTTTTTGTATGTGTTTGAGGTATTTTGAGAAGATGTAGAGATTTGGATTTTAGTGATTGTGTGGGATTGTAAATTGTAAGGATATTTTTTATGTAAATTGGAGATAGGTTGTTGAGAGATTTTAAAGTATGTAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-24 XS:i:-24 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:7G24G96G8A2 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1369:50923:15839_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_1B_GA_converted 103112089 12 141M = 103111953 -277 ATAAAAATCAACATTTAAACAAAATTACATCAAATCTCTAAAATTCTCTACCTTTTAAACTCAAACAATATACTTCATTATCTAATTTTAAAATAAACCTCAAAACACATCTCTTTAAATTAACTTTTAATTTATAATTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:24C116 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1369:50923:15839_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_1B_GA_converted 103111953 12 141M = 103112089 277 CTACATACTTTAAAATCTCTCAACAACCTATCTCCAATTTACATAAAAAATATCCTTACAATTTACAATCCCACACAATCACTAAAATCCAAATCTCTACATCTTCTCAAAATACCTCAAACACATACAAAAAAATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-24 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:2164:36272:1308_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 AAATTTTATTTAGTGAAATTGATAGTTTTTAAGATATTTTGAATTTGAGAGAATAATAGTAAGGGGTAAAATTAAAAGTTTAATGTTTGATAAAAAATTAAATTTATATAGTTTTTATTATAGTTTAAAATTAAATATGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2164:36272:1308_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 TATAAATATTAAACTAATTTAAAAACAAAATCTATAACCAATATCAAATAAAAATCTAAATTCAAATAATTAAAAAAAAAAAAAATAAAAACTCTAATATTAAATTTCTATCATCTAACATTAATAACACATTCAATTTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIII99III9I999III*9III9IIIIIIII999III YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:2282:42235:26488_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_4A_GA_converted 12912554 42 141M = 12912462 -233 TACAAACTTTATCAACTAAAAACAAACCATATTCCTCATTTAACCTTTCTAATTCATTTATCACTTCTAATCTACTAAATACAAAAAAATAAATAATACACACTTTTATTTTAATATATCTAAAACATAATTTTAATATTC II9IIIIII9IIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIII9IIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:2282:42235:26488_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_4A_GA_converted 12912462 42 141M = 12912554 233 TTAAAATATAAATAAAATTACCAAATATAAAATAAATACCAAATTCACTTAAATTACAATTATAATAATAAACATTACAAAAACAATATTATTACAAACTTTATCAACTAAAAACAAACCATATTCCTCATTTAACCTTTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I99III9III9IIII9IIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1221:35366:8118_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_10A_GA_converted 34032286 18 141M = 34032061 -366 TACAAACACACTCTATACACCATTCTCTTTCTCTATAAACACACTCTATACACCATTCTCTTTCCATATAAACACACTCTATACATCATTCTCTCTCCCTATAAACACACTCTATACATTATTCTCTCTCTCTATAAACAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-60 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:2T138 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1221:35366:8118_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_10A_GA_converted 34032061 18 141M = 34032286 366 CACACTCTATACATCATTCTCTCTCCCTATAAACACACTCTCTTCATCATTCTCTTTCCCTATAAACACACTCTATACACCATTCTCTTTCCCCATAAACACACTCTATACATTATTCTCTTTCCCTATAAACACAATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIII99III AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP >>> Writing bisulfite mapping results to Pum5_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum5_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum5_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum5_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:2452:4891:5190_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_6B_GA_converted 49350480 42 141M = 49350216 -405 AATTCAAAAATAATATTATTTTACCCTTTTCTCCTTAAAATAATCATCAAATCTACAAAATTTCCTTTATTTAAATATCAAATCAACTTATTAAATTAAAATCTTACAAAAATACCAAAAAAATCACCTACATTATACCAA IIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:2452:4891:5190_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_6B_GA_converted 49350216 42 141M = 49350480 405 ATAAAAATAATACTACATACTTCAAATATTAAAATTTTTATAAAAATTATACAAATCTTAATATTTCTTCTCCTTAAATAAACCCTCTTTTACACCAAATTAAAAAAAAAAAATAAAACAAAATCAAAAATACATTTAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I9*III9IIIIIIIIIII9IIIIII9I9* AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:111C29 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1258:2537:12546_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_6B_GA_converted 44068495 42 141M = 44068294 -342 CCCCATTTAATCACCTTCTACAACTTACCAATATCTTAACATTCTCAATTACATCCACTTTATCAATAACTTTCTTCACATCATTTCACTACTAATCCAATAAACAAAAAAAAAACCAAAAAAATAAATTTTACTAATAAA III*I9IIII999*III9I9*III*III*I9I9****IIIII*III*II9IIIIIIIII9IIIIII*9IIII9I99IIIIIIIIIIII9III9I99I99IIIIIII9IIIIIIIIIIIIIIIIIIIII*IIIIIIIII9II AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-24 YT:Z:CP LH00129:489:23JFWNLT4:8:1258:2537:12546_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_6B_GA_converted 44068294 42 141M = 44068495 342 TAATTAATTAAATATTATTTAACATTCCTCTCAAAACTATTTCACTCATATAAAAACATCACCACTACCAATAAAAAACTACACAATTTCCATATAATCCTCTACTTAACACTTATAACCTTTAAACAAAACAAAATCTTT 99999**99***9*9*99*99*9**9*999999999**999II*999III*I9I**IIII*99*99I9II999*99II9I*99*9I*99*I***II***9**9*99*999II9I*I*9I9*I*IIII*9***99**I99I9 AS:i:-24 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:36A46A5A11A39 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Pum5_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:2158:5037:17661_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TTTATAGGATTGAAAATTTGTAATTTGATGGTAATGTTGTTAAATATTATGATATAGGATTGTTTGGTGTATGTGAAAAGTGATTTTATGAATGTAGATATTATTGTGATAGAGGGTTGGTAAGTTTTGGATGAATGGAGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2158:5037:17661_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 TACCAAAATAAACAAAATTCCTTTTAAAATTTACACAAACTCCATTCATCCAAAACTTACCAACCCTCTATCACAATAATATCTACATTCATAAAATCACTTTTCACATACACCAAACAATCCTATATCATAATATTTAAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:2390:3387:20407_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 GTATTGAGATGTTAATTGAGGTTTTTATTTGTAGGAGTATATTAGGTAAAATGTATATTATATATATATAGTAAAATTGTAGAAAAAGTTTATGGTATAGGTAATAGGTAGAAATAAGAGTATTGTAAATGGTATAATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2390:3387:20407_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 ATACTTCCAAATTAAATTTCATTATCCAACAAACATATATTATACCATTTACAATACTCTTATTTCTACCTATTACCTATACCATAAACTTTTTCTACAATTTTACTATATATATATAATATACATTTTACCTAATATACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIII9IIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Pum5_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum5_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum5_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.5 and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.7 and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.1 and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.8 and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.3 and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.2 and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.4 and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.6 and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.6 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far 2801452 reads; of these: 2801452 (100.00%) were paired; of these: 986844 (35.23%) aligned concordantly 0 times 643348 (22.96%) aligned concordantly exactly 1 time 1171260 (41.81%) aligned concordantly >1 times 64.77% overall alignment rate 2801452 reads; of these: 2801452 (100.00%) were paired; of these: 988246 (35.28%) aligned concordantly 0 times 643203 (22.96%) aligned concordantly exactly 1 time 1170003 (41.76%) aligned concordantly >1 times 64.72% overall alignment rate Processed 2801452 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 2801452 Number of paired-end alignments with a unique best hit: 1568531 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 358553 Sequence pairs did not map uniquely: 874368 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 785048 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 783483 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 69297645 Total methylated C's in CpG context: 1643090 Total methylated C's in CHG context: 71063 Total methylated C's in CHH context: 315217 Total methylated C's in Unknown context: 8165 Total unmethylated C's in CpG context: 6795174 Total unmethylated C's in CHG context: 11757080 Total unmethylated C's in CHH context: 48716021 Total unmethylated C's in Unknown context: 74557 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 987589 (35.25%) aligned concordantly 0 times 642759 (22.94%) aligned concordantly exactly 1 time 1171103 (41.80%) aligned concordantly >1 times 64.75% overall alignment rate 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 989136 (35.31%) aligned concordantly 0 times 642421 (22.93%) aligned concordantly exactly 1 time 1169894 (41.76%) aligned concordantly >1 times 64.69% overall alignment rate Processed 2801451 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 2801451 Number of paired-end alignments with a unique best hit: 1566605 Mapping efficiency: 55.9% Sequence pairs with no alignments under any condition: 360260 Sequence pairs did not map uniquely: 874586 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 784403 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 782202 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 69230077 Total methylated C's in CpG context: 1639746 Total methylated C's in CHG context: 71208 Total methylated C's in CHH context: 314808 Total methylated C's in Unknown context: 8235 Total unmethylated C's in CpG context: 6777381 Total unmethylated C's in CHG context: 11754729 Total unmethylated C's in CHH context: 48672205 Total unmethylated C's in Unknown context: 75001 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2358:38165:8931_1:N:0:TGAGTACT+GACAATAA Chromosome_9B 91966292 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 987144 (35.24%) aligned concordantly 0 times 642989 (22.95%) aligned concordantly exactly 1 time 1171318 (41.81%) aligned concordantly >1 times 64.76% overall alignment rate 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 989057 (35.31%) aligned concordantly 0 times 642077 (22.92%) aligned concordantly exactly 1 time 1170317 (41.78%) aligned concordantly >1 times 64.69% overall alignment rate Processed 2801451 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 2801451 Number of paired-end alignments with a unique best hit: 1567015 Mapping efficiency: 55.9% Sequence pairs with no alignments under any condition: 359117 Sequence pairs did not map uniquely: 875319 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 784926 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 782088 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 69245008 Total methylated C's in CpG context: 1638231 Total methylated C's in CHG context: 70952 Total methylated C's in CHH context: 314293 Total methylated C's in Unknown context: 8267 Total unmethylated C's in CpG context: 6781187 Total unmethylated C's in CHG context: 11749737 Total unmethylated C's in CHH context: 48690608 Total unmethylated C's in Unknown context: 75238 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 987559 (35.25%) aligned concordantly 0 times 642343 (22.93%) aligned concordantly exactly 1 time 1171549 (41.82%) aligned concordantly >1 times 64.75% overall alignment rate 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 987893 (35.26%) aligned concordantly 0 times 642898 (22.95%) aligned concordantly exactly 1 time 1170660 (41.79%) aligned concordantly >1 times 64.74% overall alignment rate Processed 2801451 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 2801451 Number of paired-end alignments with a unique best hit: 1567244 Mapping efficiency: 55.9% Sequence pairs with no alignments under any condition: 359171 Sequence pairs did not map uniquely: 875036 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 784195 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 783049 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 69232282 Total methylated C's in CpG context: 1641148 Total methylated C's in CHG context: 70949 Total methylated C's in CHH context: 315048 Total methylated C's in Unknown context: 8476 Total unmethylated C's in CpG context: 6786308 Total unmethylated C's in CHG context: 11740750 Total unmethylated C's in CHH context: 48678079 Total unmethylated C's in Unknown context: 75047 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.1% Now waiting for all child processes to complete 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 987121 (35.24%) aligned concordantly 0 times 642423 (22.93%) aligned concordantly exactly 1 time 1171907 (41.83%) aligned concordantly >1 times 64.76% overall alignment rate 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 987712 (35.26%) aligned concordantly 0 times 642057 (22.92%) aligned concordantly exactly 1 time 1171682 (41.82%) aligned concordantly >1 times 64.74% overall alignment rate Processed 2801451 sequences in total 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 987240 (35.24%) aligned concordantly 0 times 641945 (22.91%) aligned concordantly exactly 1 time 1172266 (41.84%) aligned concordantly >1 times 64.76% overall alignment rate Successfully deleted the temporary files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 2801451 Number of paired-end alignments with a unique best hit: 1566630 Mapping efficiency: 55.9% Sequence pairs with no alignments under any condition: 359068 Sequence pairs did not map uniquely: 875753 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 784424 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 782206 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 69201109 Total methylated C's in CpG context: 1638840 Total methylated C's in CHG context: 70775 Total methylated C's in CHH context: 313899 Total methylated C's in Unknown context: 8129 Total unmethylated C's in CpG context: 6779542 Total unmethylated C's in CHG context: 11742688 Total unmethylated C's in CHH context: 48655365 Total unmethylated C's in Unknown context: 74666 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.8% 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 986689 (35.22%) aligned concordantly 0 times 642935 (22.95%) aligned concordantly exactly 1 time 1171827 (41.83%) aligned concordantly >1 times 64.78% overall alignment rate Processed 2801451 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 2801451 Number of paired-end alignments with a unique best hit: 1568226 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 358522 Sequence pairs did not map uniquely: 874703 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 784607 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 783619 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 69258848 Total methylated C's in CpG context: 1640253 Total methylated C's in CHG context: 71132 Total methylated C's in CHH context: 314148 Total methylated C's in Unknown context: 8260 Total unmethylated C's in CpG context: 6784300 Total unmethylated C's in CHG context: 11753178 Total unmethylated C's in CHH context: 48695837 Total unmethylated C's in Unknown context: 75193 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% 2801452 reads; of these: 2801452 (100.00%) were paired; of these: 987143 (35.24%) aligned concordantly 0 times 642446 (22.93%) aligned concordantly exactly 1 time 1171863 (41.83%) aligned concordantly >1 times 64.76% overall alignment rate 2801452 reads; of these: 2801452 (100.00%) were paired; of these: 988153 (35.27%) aligned concordantly 0 times 641923 (22.91%) aligned concordantly exactly 1 time 1171376 (41.81%) aligned concordantly >1 times 64.73% overall alignment rate Processed 2801452 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 2801452 Number of paired-end alignments with a unique best hit: 1568305 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 359029 Sequence pairs did not map uniquely: 874118 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 785012 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 783293 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 69288114 Total methylated C's in CpG context: 1644741 Total methylated C's in CHG context: 70444 Total methylated C's in CHH context: 314609 Total methylated C's in Unknown context: 8217 Total unmethylated C's in CpG context: 6788694 Total unmethylated C's in CHG context: 11764251 Total unmethylated C's in CHH context: 48705375 Total unmethylated C's in Unknown context: 75103 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 986074 (35.20%) aligned concordantly 0 times 643458 (22.97%) aligned concordantly exactly 1 time 1171919 (41.83%) aligned concordantly >1 times 64.80% overall alignment rate 2801451 reads; of these: 2801451 (100.00%) were paired; of these: 987696 (35.26%) aligned concordantly 0 times 642577 (22.94%) aligned concordantly exactly 1 time 1171178 (41.81%) aligned concordantly >1 times 64.74% overall alignment rate Processed 2801451 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 2801451 Number of paired-end alignments with a unique best hit: 1567419 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 358877 Sequence pairs did not map uniquely: 875155 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 784755 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 782664 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 69239771 Total methylated C's in CpG context: 1640233 Total methylated C's in CHG context: 70549 Total methylated C's in CHH context: 314424 Total methylated C's in Unknown context: 8436 Total unmethylated C's in CpG context: 6785256 Total unmethylated C's in CHG context: 11751751 Total unmethylated C's in CHH context: 48677558 Total unmethylated C's in Unknown context: 74805 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.1% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 11205804. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.1 /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.1 /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.2 /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.2 /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.3 /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.3 /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.4 /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.4 /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.5 /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.5 /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.6 /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.6 /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.7 /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.7 /tmp/13-wgbs-Pum5-1800724/Pum5_R1.fq.gz.temp.8 /tmp/13-wgbs-Pum5-1800724/Pum5_R2.fq.gz.temp.8 Now merging BAM files Pum5_R1.fq.gz.temp.1_bismark_bt2_pe.bam Pum5_R1.fq.gz.temp.2_bismark_bt2_pe.bam Pum5_R1.fq.gz.temp.3_bismark_bt2_pe.bam Pum5_R1.fq.gz.temp.4_bismark_bt2_pe.bam Pum5_R1.fq.gz.temp.5_bismark_bt2_pe.bam Pum5_R1.fq.gz.temp.6_bismark_bt2_pe.bam Pum5_R1.fq.gz.temp.7_bismark_bt2_pe.bam Pum5_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Pum5_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Pum5_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Pum5_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Pum5_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Pum5_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Pum5_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Pum5_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Pum5_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Pum5_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1_bismark_bt2_PE_report.txt Now merging temporary reports Pum5_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Pum5_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Pum5_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Pum5_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Pum5_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Pum5_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Pum5_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Pum5_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Pum5_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 22411610 Number of paired-end alignments with a unique best hit: 12539975 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 2872597 Sequence pairs did not map uniquely: 6999038 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 6277370 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 6262604 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 553992854 Total methylated C's in CpG context: 13126282 Total methylated C's in CHG context: 567072 Total methylated C's in CHH context: 2516446 Total methylated C's in Unknown context: 66185 Total unmethylated C's in CpG context: 54277842 Total unmethylated C's in CHG context: 94014164 Total unmethylated C's in CHH context: 389491048 Total unmethylated C's in Unknown context: 599610 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% Deleting temporary report files... Pum5_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Pum5_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 33m 59s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Pum5_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Pum5_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Pum5_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Pum5_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Pum5_pe.bam: 12539974 Total number duplicated alignments removed: 527741 (4.21%) Duplicated alignments were found at: 505077 different position(s) Total count of deduplicated leftover sequences: 12012233 (95.79% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Pum5_R1.fq.gz -2 output/13-wgbs/trimmed/Pum5_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Pum5-1800724 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Pum5_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Pum5_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Pum5_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum5_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum5_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Pum5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum5_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Pum5_R1.fq.gz -2 output/13-wgbs/trimmed/Pum5_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Pum5-1800724 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum5_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Pum5_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Pum5_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Finished processing child process. Exiting.. Processed lines: 12000000 Processed lines: 12000000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Processed lines: 12000000 Finished processing child process. Exiting.. Processed lines: 12000000 Now waiting for all child processes to complete Processed lines: 12000000 Finished processing child process. Exiting.. Processed lines: 12000000 Finished processing child process. Exiting.. Processed lines: 12000000 Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.8 Processed 12012233 lines in total Total number of methylation call strings processed: 24024466 Final Cytosine Methylation Report ================================= Total number of C's analysed: 425933672 Total methylated C's in CpG context: 10057694 Total methylated C's in CHG context: 351795 Total methylated C's in CHH context: 1582325 Total C to T conversions in CpG context: 41857386 Total C to T conversions in CHG context: 72344334 Total C to T conversions in CHH context: 299740138 C methylated in CpG context: 19.4% C methylated in non-CpG context: 0.5% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum5_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum5_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum5_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum5_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum5_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Pum5_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum5_pe.deduplicated.txt.gz Writing bedGraph to file: Pum5_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Pum5_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Pum5_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Pum5_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum5_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Pum5_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Pum5.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Pum5.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1213172 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1436476 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 2652311 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2570781 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2492782 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2216054 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2430200 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1179054 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2396120 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2308525 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Pum5.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Pum5.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 0 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Pum5_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Pum5_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1007515952 34.52 378413849 32.06 2.662 C 465154529 15.94 211781786 17.94 2.196 G 515819228 17.67 211810957 17.95 2.435 T 930362164 31.87 378309330 32.05 2.459 AA 367630077 12.69 128492079 10.89 2.861 AC 159531872 5.50 68264877 5.78 2.337 AG 161475568 5.57 62424886 5.29 2.587 AT 311913986 10.76 119230832 10.10 2.616 CA 192172703 6.63 80836853 6.85 2.377 CC 80565833 2.78 42358709 3.59 1.902 CG 56369099 1.95 26104181 2.21 2.159 CT 132500485 4.57 62481783 5.29 2.121 GA 176945358 6.11 67679435 5.73 2.614 GC 75122143 2.59 33452245 2.83 2.246 GG 93726968 3.23 42378301 3.59 2.212 GT 166357940 5.74 68300800 5.79 2.436 TA 263416411 9.09 101400983 8.59 2.598 TC 146583701 5.06 67705770 5.74 2.165 TG 200559567 6.92 80903356 6.85 2.479 TT 313084682 10.80 128294772 10.87 2.440 [Fri Oct 9 12:52:07 PDT 2026] Pum5 done