[Fri Oct 9 11:29:23 PDT 2026] Pum4 (Pum/Pumalin) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 30650313 total bases: 4628197263 Q20 bases: 4574859556(98.8475%) Q30 bases: 4435726985(95.8414%) Q40 bases: 4435726985(95.8414%) Read2 before filtering: total reads: 30650313 total bases: 4628197263 Q20 bases: 4568081121(98.7011%) Q30 bases: 4422373766(95.5528%) Q40 bases: 4422373766(95.5528%) Read1 after filtering: total reads: 30156298 total bases: 4170762620 Q20 bases: 4135073867(99.1443%) Q30 bases: 4027992709(96.5769%) Q40 bases: 4027992709(96.5769%) Read2 after filtering: total reads: 30156298 total bases: 4172169560 Q20 bases: 4134068418(99.0868%) Q30 bases: 4018297310(96.3119%) Q40 bases: 4018297310(96.3119%) Filtering result: reads passed filter: 60312596 reads failed due to low quality: 480886 reads failed due to too many N: 1238 reads failed due to too short: 505906 reads with adapter trimmed: 6612511 bases trimmed due to adapters: 140591475 Duplication rate: 3.101% Insert size peak (evaluated by paired-end reads): 190 JSON report: output/13-wgbs/fastp/Pum4.fastp.json HTML report: output/13-wgbs/fastp/Pum4.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/PUM4 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/PUM4 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Pum4_R1.fq.gz -O output/13-wgbs/trimmed/Pum4_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Pum4.fastp.json --html output/13-wgbs/fastp/Pum4.fastp.html fastp v1.0.1, time used: 89 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Pum4_R1.fq.gz output/13-wgbs/trimmed/Pum4_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Pum4-1046736 Temporary files will be written into the directory: /tmp/13-wgbs-Pum4-1046736/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum4_R1.fq.gz and output/13-wgbs/trimmed/Pum4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum4_R1.fq.gz and output/13-wgbs/trimmed/Pum4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum4_R1.fq.gz and output/13-wgbs/trimmed/Pum4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum4_R1.fq.gz and output/13-wgbs/trimmed/Pum4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum4_R1.fq.gz and output/13-wgbs/trimmed/Pum4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum4_R1.fq.gz and output/13-wgbs/trimmed/Pum4_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum4_R1.fq.gz and output/13-wgbs/trimmed/Pum4_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum4_R1.fq.gz and output/13-wgbs/trimmed/Pum4_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Pum4_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum4_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum4_R1.fq.gz for PID: 1048064 and offset 8 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum4_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 3769538) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum4_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum4_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum4_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum4_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 3769538) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum4_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 3769538) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum4_R1.fq.gz.temp.2 to /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum4_R2.fq.gz for PID: 1048064 and offset 8 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum4_R1.fq.gz.temp.8 to /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum4_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum4_R1.fq.gz.temp.3 to /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum4_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum4_R1.fq.gz.temp.4 to /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum4_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum4_R1.fq.gz.temp.6 to /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum4_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum4_R1.fq.gz.temp.5 to /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum4_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 3769537) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum4_R1.fq.gz.temp.7 to /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum4_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 3769538) Using the subset file >/tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum4_R1.fq.gz.temp.1 to /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.1_C_to_T.fastq Created C -> T converted version of the FastQ file Pum4_R1.fq.gz.temp.2 (3769538 sequences in total) Writing a G -> A converted version of the input file Pum4_R2.fq.gz.temp.2 to /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Pum4_R1.fq.gz.temp.8 (3769537 sequences in total) Writing a G -> A converted version of the input file Pum4_R2.fq.gz.temp.8 to /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Pum4_R1.fq.gz.temp.3 (3769537 sequences in total) Writing a G -> A converted version of the input file Pum4_R2.fq.gz.temp.3 to /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Pum4_R1.fq.gz.temp.5 (3769537 sequences in total) Writing a G -> A converted version of the input file Pum4_R2.fq.gz.temp.5 to /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Pum4_R1.fq.gz.temp.6 (3769537 sequences in total) Writing a G -> A converted version of the input file Pum4_R2.fq.gz.temp.6 to /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Pum4_R1.fq.gz.temp.4 (3769537 sequences in total) Writing a G -> A converted version of the input file Pum4_R2.fq.gz.temp.4 to /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Pum4_R1.fq.gz.temp.7 (3769537 sequences in total) Writing a G -> A converted version of the input file Pum4_R2.fq.gz.temp.7 to /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Pum4_R1.fq.gz.temp.1 (3769538 sequences in total) Writing a G -> A converted version of the input file Pum4_R2.fq.gz.temp.1 to /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.1_G_to_A.fastq Created G -> A converted version of the FastQ file Pum4_R2.fq.gz.temp.6 (3769537 sequences in total) Input files are Pum4_R1.fq.gz.temp.6_C_to_T.fastq and Pum4_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum4_R2.fq.gz.temp.2 (3769538 sequences in total) Input files are Pum4_R1.fq.gz.temp.2_C_to_T.fastq and Pum4_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum4_R2.fq.gz.temp.8 (3769537 sequences in total) Input files are Pum4_R1.fq.gz.temp.8_C_to_T.fastq and Pum4_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum4_R2.fq.gz.temp.3 (3769537 sequences in total) Input files are Pum4_R1.fq.gz.temp.3_C_to_T.fastq and Pum4_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum4_R2.fq.gz.temp.5 (3769537 sequences in total) Input files are Pum4_R1.fq.gz.temp.5_C_to_T.fastq and Pum4_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum4_R2.fq.gz.temp.4 (3769537 sequences in total) Input files are Pum4_R1.fq.gz.temp.4_C_to_T.fastq and Pum4_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum4_R2.fq.gz.temp.7 (3769537 sequences in total) Input files are Pum4_R1.fq.gz.temp.7_C_to_T.fastq and Pum4_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum4_R2.fq.gz.temp.1 (3769538 sequences in total) Input files are Pum4_R1.fq.gz.temp.1_C_to_T.fastq and Pum4_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1342:12043:9113_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 AGTAATTATTATAATATGATAATTTATTTATTTTTTGTTTTGATAATAATTTGGAGTGAGAGGAAGTTAATTATAATTTTGTTATTAGATTTTGTTTTGATAATTATTGATATGTATGGTAAAGTATTATGTATTGTATGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1342:12043:9113_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 CAAAATAAAAAATACACATTATACACAAATACATACAATACATAATACTTTACCATACATATCAATAATTATCAAAACAAAATCTAATAACAAAATTATAATTAACTTCCTCTCACTCCAAATTATTATCAAAACAAAAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1196:25173:16442_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_6A_CT_converted 67590530 42 141M = 67590612 223 ATTATATAGTATAGTGAAAATATGTATAAATTTTTTATATGTTTTATAGAATTATTAAATAGTTGAGTTTATTGTTTATAAAAATATTTGTGTTTTTGAGAAATGAAAATGAAATTTGATTTTTATATTTATTTTTTGTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:8A132 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1196:25173:16442_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_6A_CT_converted 67590612 42 141M = 67590530 -223 AATATTTGTGTTTTTGAGAAATGAAAATGAAATTTGATTTTTATATTTATTTTTTGTTAGTTGTTAGATGAAGTTAGTAAGTGTTGTGTGTAAATGATTTATTTAATAAAGGTGTAAATTTTTAATTATTGTTTTTTTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:80A60 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1389:48035:11874_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_5B_CT_converted 95637776 26 141M = 95637808 173 GTTTAATAGAATTTTGTGAAATTTTGTAGTTAATAAGGATATATTGTGTAGATTTGTATGTTTTTAGAAAATTTTGATTTAATAATTTTTTTGGGTGTTGTGTTTTTTTTGAATTTAAAATTTTGAGTTTGTTTGTTTTGT I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII9IIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIII9IIIIIIIIIIIII9IIIIIII9IIIIIIIIIIII9IIIIIIIIII AS:i:-6 XS:i:-80 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:59A81 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1389:48035:11874_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_5B_CT_converted 95637808 26 141M = 95637776 -173 ATAAGGATATATTGTGTAGATTTGTATGTTTTTAGAAAATTTTGATTTAATAATTTTTTTGGGTGTTGTGTTTTTTTTGAATTTAAAATTTTGAGTTTGTTTGTTTTGTTTTTGTAGTAATGTATAGTATTATTATTTATT IIIIIIIII9IIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIII AS:i:-6 XS:i:-54 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:27A113 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2437:27147:10500_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 ATATAGTTAATGAAAATATTAAAGTTATGTTATATAGTGAATTAAAATATTAAAGTTATGTTATATAGTGAATTAAAATATTAAAGTTATGTTATATAGTGAATTAAAATATTAAAGTTATGTTATATTGTTAATTAAAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9 YT:Z:UP LH00129:489:23JFWNLT4:8:2437:27147:10500_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 TATATAACATAACTTTAATATTTTAATTAACAATATAACATAACTTTAATATTTTAATTCACTATATAACATAACTTTAATATTTTAATTCACTATATAACATAACTTTAATATTTTAATTCACTATATAACATAACTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII* YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2370:5021:11355_1:N:0:CTGTCACT+AATACTAA/1 99 Chromosome_7B_CT_converted 162959216 1 141M = 162959278 203 TAATGTTATGATGTAAATATAATTTATAATATGTAATTTTTGAGTTATTAGTTTTTTTGTGATGGAGATATGTTTAGAGTTTTGTTGAATGTTTGAGTGGGTATAAGATGTATATATGTATTATAGAGTAGTTATGTAAAT 9I*I9I*II9II9I*I*II9I9999999I*99*II*I99II9*9*9I99II9I9II9999*I9999999I99II99I*99**II9I9I999I99I*99**9I*999*I9*I9IIIIII99IIIIII9II9I9III9IIII9 AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:44A96 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:2370:5021:11355_2:N:0:CTGTCACT+AATACTAA/2 147 Chromosome_7B_CT_converted 162959278 1 141M = 162959216 -203 TGGAGATATGTTTAGAGTTTTGTTGAATGTTTGAGTGGGTATAAGATGTATATATGTATTATAGAGTAGTTATGTAAATATGGATAAAAGTATTGGAAATGTAAATTTTGTTTATATTAGTTGTTGGTATATATTAAATTG 9IIIIIIII*IIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIII9I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2261:49483:29095_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 AAAAATTGATTATATGTAGAATATGATTTTTTATATTAAATTAGTTAAGAAATATGAATATTATATGTAATAATGGAATATTGTTTTATAAATATGGGAGTTTGGTGATGGAGAAGTTGAAATTATTTTGTTTAAGGGTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2261:49483:29095_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 TAACTATTTTAACACCCCTACTTAATCCAAATAATTTCACATCTCAAATCAATAAAATATAACTTTACAAAATATCAATTAAATATCTTTTAAAAAAATAACACATCATCACCATATTTAAAAAAAAATACATCACAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9 YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:2352:11226:19917_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_7B_CT_converted 136022324 1 141M = 136022346 163 AGGGGAATGTGTTGTATTAAATTAATTTTTTTATTTATTGTTTTTTTGTATGTTATGAAGTTATAAATAGAGTTTTATTTTATATTGGTGTTGTTGTTGTGGTTTGGTGGTGTTGGGTTTAGTAGTTGTAATTTTGGATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:2352:11226:19917_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_7B_CT_converted 136022346 1 141M = 136022324 -163 TAATTTTTTTATTTATTGTTTTTTTGTATGTTATGAAGTTATAAATAGAGTTTTATTTTATATTGGTGTTGTTGTTGTGGTTTGGTGGTGTTGGGTTTAGTAGTTGTAATTTTGGATTTTGGTATTTTTGGGGTTGTTATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1462:3589:15685_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 GGTATTATTTGTTAGATAATAATGTTAAATTGTTGGATAATAATGTTGAATTGTTAGATAATTATGTTGATTTGTTAGTTAATTATGGTTGATTTGTTAGTTAGTTATGTTGAATTGTTAGTTAATTATGTTAATTTGTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1462:3589:15685_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 ATTAACTAACAAATCAACATAATTAACTAACAAATTAACATAATTAACTAACAATTCAACATAACTAACTAACAAATCAACCATAATTAACTAACAAATCAACATAATTATCTAACAATTCAACATTATTATCCAACAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1342:12043:9113_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_2A_GA_converted 43713904 42 141M = 43713874 -171 ACATACAATACATAATACTTTACCATACATATCAATAATTATCAAAACAAAATCTAATAACAAAATTATAATTAACTTCCTCTCACTCCAAATTATTATCAAAACAAAAAATAAATAAATTATCATATTATAATAATTACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:3C19A117 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1342:12043:9113_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_2A_GA_converted 43713874 42 141M = 43713904 171 CAAAATAAAAAATACACATTATACACAAATACATACAATACATAATACTTTACCATACATATCAATAATTATCAAAACAAAATCTAATAACAAAATTATAATTAACTTCCTCTCACTCCAAATTATTATCAAAACAAAAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:33C19A87 YS:i:-12 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:2261:49483:29095_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_6B_GA_converted 14807113 1 141M = 14806902 -352 TAACCCTTAAACAAAATAATTTCAACTTCTCCATCACCAAACTCCCATATTTATAAAACAATATTCCATTATTACATATAATATTCATATTTCTTAACTAATTTAATATAAAAAATCATATTCTACATATAATCAATTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:2261:49483:29095_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_6B_GA_converted 14806902 1 141M = 14807113 352 TAACTATTTTAACACCCCTACTTAATCCAAATAATTTCACATCTCAAATCAATAAAATATAACTTTACAAAATATCAATTAAATATCTTTTAAAAAAATAACACATCATCACCATATTTAAAAAAAAATACATCACAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9 AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1462:3589:15685_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_1B_GA_converted 193353081 1 141M = 193353054 -168 TAACAAATTAACATAATTAACTAACAATTCAACATAACTAACTAACAAATCAACCATAATTAACTAACAAATCAACATAATTATCTAACAATTCAACATTATTATCCAACAATTTAACATTATTATCTAACAAATAATACC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1462:3589:15685_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_1B_GA_converted 193353054 1 141M = 193353081 168 ATTAACTAACAAATCAACATAATTAACTAACAAATTAACATAATTAACTAACAATTCAACATAACTAACTAACAAATCAACCATAATTAACTAACAAATCAACATAATTATCTAACAATTCAACATTATTATCCAACAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Pum4_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum4_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1389:48035:11874_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_2A_GA_converted 37930285 15 141M = 37930253 -173 ACAAAACAAACAAACTCAAAATTTTAAATTCAAAAAAAACACAACACCCAAAAAAATTATTAAATCAAAATTTTCTAAAAACATACAAATCTACACAATATATCCTTATTAACTACAAAATTTCACAAAATTCTATTAAAC IIIIIIIIII9IIIIIIIIIIII9IIIIIII9IIIIIIIIIIIII9IIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIII9IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I AS:i:-30 XS:i:-60 XN:i:0 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:23C17T3T27C63C3 YS:i:-24 YT:Z:CP LH00129:489:23JFWNLT4:8:1389:48035:11874_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_2A_GA_converted 37930253 15 141M = 37930285 173 AATAAATAATAATACTATACATTACTACAAAAACAAAACAAACAAACTCAAAATTTTAAATTCAAAAAAAACACAACACCCAAAAAAATTATTAAATCAAAATTTTCTAAAAACATACAAATCTACACAATATATCCTTAT IIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIII9IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIII9IIIIIIIII AS:i:-24 XS:i:-54 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:55C17T3T27C35 YS:i:-30 YT:Z:CP >>> Writing bisulfite mapping results to Pum4_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum4_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:2370:5021:11355_1:N:0:CTGTCACT+AATACTAA/1 83 Chromosome_7B_GA_converted 163231689 11 141M = 163231627 -203 ATTTACATAACTACTCTATAATACATATATACATCTTATACCCACTCAAACATTCAACAAAACTCTAAACATATCTCCATCACAAAAAAACTAATAACTCAAAAATTACATATTATAAATTATATTTACATCATAACATTA 9IIII9III9I9II9IIIIII99IIIIII9I*9I*999*I9**99*I99I999I9I9II**99*I99II99I9999999I*9999II9I9II99I9*9*9II99I*II*99*I9999999I9II*I*I9II9II*I9I*I9 AS:i:-24 XS:i:-78 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:16A19C36C22T44 YS:i:-30 YT:Z:CP LH00129:489:23JFWNLT4:8:2370:5021:11355_2:N:0:CTGTCACT+AATACTAA/2 163 Chromosome_7B_GA_converted 163231627 11 141M = 163231689 203 CAATTTAATATATACCAACAACTAATATAAACAAAATTTACATTTCCAATACTTTTATCCATATTTACATAACTACTCTATAATACATATATACATCTTATACCCACTCAAACATTCAACAAAACTCTAAACATATCTCCA II9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I9IIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII*IIIIIIII9 AS:i:-30 XS:i:-20 XN:i:0 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:40A4A32A19C36C5 YS:i:-24 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:2437:27147:10500_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_10A_GA_converted 14115900 30 141M = 14115881 -160 ATTTTAATTAACAATATAACATAACTTTAATATTTTAATTCACTATATAACATAACTTTAATATTTTAATTCACTATATAACATAACTTTAATATTTTAATTCACTATATAACATAACTTTAATATTTTCATTAACTATAT 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:2437:27147:10500_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_10A_GA_converted 14115881 30 141M = 14115900 160 TATATAACATAACTTTAATATTTTAATTAACAATATAACATAACTTTAATATTTTAATTCACTATATAACATAACTTTAATATTTTAATTCACTATATAACATAACTTTAATATTTTAATTCACTATATAACATAACTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII* AS:i:0 XS:i:-18 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Pum4_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1196:25173:16442_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_6A_GA_converted 67582707 42 141M = 67582625 -223 TAACAAAAAATAAATATAAAAATCAAATTTCATTTTCATTTCTCAAAAACACAAATATTTTTATAAACAATAAACTCAACTATTTAATAATTCTATAAAACATATAAAAAATTTATACATATTTTCACTATACTATATAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:132T8 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1196:25173:16442_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_6A_GA_converted 67582625 42 141M = 67582707 223 TAAAAAAAAACAATAATTAAAAATTTACACCTTTATTAAATAAATCATTTACACACAACACTTACTAACTTCATCTAACAACTAACAAAAAATAAATATAAAAATCAAATTTCATTTTCATTTCTCAAAAACACAAATATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:60T80 YS:i:-6 YT:Z:CP >>> Writing bisulfite mapping results to Pum4_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum4_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:2352:11226:19917_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 AGGGGAATGTGTTGTATTAAATTAATTTTTTTATTTATTGTTTTTTTGTATGTTATGAAGTTATAAATAGAGTTTTATTTTATATTGGTGTTGTTGTTGTGGTTTGGTGGTGTTGGGTTTAGTAGTTGTAATTTTGGATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2352:11226:19917_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 AATAACAACCCCAAAAATACCAAAATCCAAAATTACAACTACTAAACCCAACACCACCAAACCACAACAACAACACCAATATAAAATAAAACTCTATTTATAACTTCATAACATACAAAAAAACAATAAATAAAAAAATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Pum4_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.6 and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.3 and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.2 and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.8 and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.5 and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.1 and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.7 and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.4 and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.4 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2358:38165:8931_1:N:0:TGAGTACT+GACAATAA Chromosome_9B 91966292 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1308916 (34.72%) aligned concordantly 0 times 869273 (23.06%) aligned concordantly exactly 1 time 1591348 (42.22%) aligned concordantly >1 times 65.28% overall alignment rate 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1308072 (34.70%) aligned concordantly 0 times 869013 (23.05%) aligned concordantly exactly 1 time 1592452 (42.25%) aligned concordantly >1 times 65.30% overall alignment rate Processed 3769537 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 3769537 Number of paired-end alignments with a unique best hit: 2120588 Mapping efficiency: 56.3% Sequence pairs with no alignments under any condition: 460673 Sequence pairs did not map uniquely: 1188276 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1060842 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1059746 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 94144871 Total methylated C's in CpG context: 2224187 Total methylated C's in CHG context: 103212 Total methylated C's in CHH context: 455475 Total methylated C's in Unknown context: 11694 Total unmethylated C's in CpG context: 9293681 Total unmethylated C's in CHG context: 15978526 Total unmethylated C's in CHH context: 66089790 Total unmethylated C's in Unknown context: 99120 C methylated in CpG context: 19.3% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.6% 3769538 reads; of these: 3769538 (100.00%) were paired; of these: 1306856 (34.67%) aligned concordantly 0 times 871832 (23.13%) aligned concordantly exactly 1 time 1590850 (42.20%) aligned concordantly >1 times 65.33% overall alignment rate 3769538 reads; of these: 3769538 (100.00%) were paired; of these: 1308839 (34.72%) aligned concordantly 0 times 870396 (23.09%) aligned concordantly exactly 1 time 1590303 (42.19%) aligned concordantly >1 times 65.28% overall alignment rate Processed 3769538 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 3769538 Number of paired-end alignments with a unique best hit: 2120350 Mapping efficiency: 56.2% Sequence pairs with no alignments under any condition: 461068 Sequence pairs did not map uniquely: 1188120 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1061803 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1058547 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 94113511 Total methylated C's in CpG context: 2230757 Total methylated C's in CHG context: 103264 Total methylated C's in CHH context: 457732 Total methylated C's in Unknown context: 11722 Total unmethylated C's in CpG context: 9293738 Total unmethylated C's in CHG context: 15968889 Total unmethylated C's in CHH context: 66059131 Total unmethylated C's in Unknown context: 98532 C methylated in CpG context: 19.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.6% 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1308970 (34.72%) aligned concordantly 0 times 870380 (23.09%) aligned concordantly exactly 1 time 1590187 (42.19%) aligned concordantly >1 times 65.28% overall alignment rate 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1308809 (34.72%) aligned concordantly 0 times 872332 (23.14%) aligned concordantly exactly 1 time 1588396 (42.14%) aligned concordantly >1 times 65.28% overall alignment rate Processed 3769537 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 3769537 Number of paired-end alignments with a unique best hit: 2120944 Mapping efficiency: 56.3% Sequence pairs with no alignments under any condition: 460822 Sequence pairs did not map uniquely: 1187771 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1060972 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1059972 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 94194481 Total methylated C's in CpG context: 2228362 Total methylated C's in CHG context: 102594 Total methylated C's in CHH context: 457968 Total methylated C's in Unknown context: 11918 Total unmethylated C's in CpG context: 9314087 Total unmethylated C's in CHG context: 15991293 Total unmethylated C's in CHH context: 66100177 Total unmethylated C's in Unknown context: 99287 C methylated in CpG context: 19.3% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.7% 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1308664 (34.72%) aligned concordantly 0 times 871161 (23.11%) aligned concordantly exactly 1 time 1589712 (42.17%) aligned concordantly >1 times 65.28% overall alignment rate 3769538 reads; of these: 3769538 (100.00%) were paired; of these: 1308592 (34.71%) aligned concordantly 0 times 871688 (23.12%) aligned concordantly exactly 1 time 1589258 (42.16%) aligned concordantly >1 times 65.29% overall alignment rate 3769538 reads; of these: 3769538 (100.00%) were paired; of these: 1311197 (34.78%) aligned concordantly 0 times 868706 (23.05%) aligned concordantly exactly 1 time 1589635 (42.17%) aligned concordantly >1 times 65.22% overall alignment rate 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1307834 (34.69%) aligned concordantly 0 times 870377 (23.09%) aligned concordantly exactly 1 time 1591326 (42.22%) aligned concordantly >1 times 65.31% overall alignment rate Processed 3769537 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 3769537 Number of paired-end alignments with a unique best hit: 2121576 Mapping efficiency: 56.3% Sequence pairs with no alignments under any condition: 460307 Sequence pairs did not map uniquely: 1187654 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1061849 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1059727 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 94171157 Total methylated C's in CpG context: 2229531 Total methylated C's in CHG context: 102957 Total methylated C's in CHH context: 457783 Total methylated C's in Unknown context: 11753 Total unmethylated C's in CpG context: 9303407 Total unmethylated C's in CHG context: 15990924 Total unmethylated C's in CHH context: 66086555 Total unmethylated C's in Unknown context: 98290 C methylated in CpG context: 19.3% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.7% Processed 3769538 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 3769538 Number of paired-end alignments with a unique best hit: 2119362 Mapping efficiency: 56.2% Sequence pairs with no alignments under any condition: 462068 Sequence pairs did not map uniquely: 1188108 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1061885 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1057476 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 94102217 Total methylated C's in CpG context: 2228640 Total methylated C's in CHG context: 102203 Total methylated C's in CHH context: 456887 Total methylated C's in Unknown context: 11658 Total unmethylated C's in CpG context: 9300972 Total unmethylated C's in CHG context: 15968094 Total unmethylated C's in CHH context: 66045421 Total unmethylated C's in Unknown context: 98137 C methylated in CpG context: 19.3% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.6% 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1308616 (34.72%) aligned concordantly 0 times 869042 (23.05%) aligned concordantly exactly 1 time 1591879 (42.23%) aligned concordantly >1 times 65.28% overall alignment rate 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1308867 (34.72%) aligned concordantly 0 times 869281 (23.06%) aligned concordantly exactly 1 time 1591389 (42.22%) aligned concordantly >1 times 65.28% overall alignment rate Processed 3769537 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 3769537 Number of paired-end alignments with a unique best hit: 2118879 Mapping efficiency: 56.2% Sequence pairs with no alignments under any condition: 462253 Sequence pairs did not map uniquely: 1188405 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1060274 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1058605 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 94059787 Total methylated C's in CpG context: 2229413 Total methylated C's in CHG context: 103702 Total methylated C's in CHH context: 457015 Total methylated C's in Unknown context: 11938 Total unmethylated C's in CpG context: 9282570 Total unmethylated C's in CHG context: 15965013 Total unmethylated C's in CHH context: 66022074 Total unmethylated C's in Unknown context: 98699 C methylated in CpG context: 19.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.8% 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1310192 (34.76%) aligned concordantly 0 times 869331 (23.06%) aligned concordantly exactly 1 time 1590014 (42.18%) aligned concordantly >1 times 65.24% overall alignment rate 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1308072 (34.70%) aligned concordantly 0 times 870898 (23.10%) aligned concordantly exactly 1 time 1590567 (42.20%) aligned concordantly >1 times 65.30% overall alignment rate Processed 3769537 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 3769537 Number of paired-end alignments with a unique best hit: 2119841 Mapping efficiency: 56.2% Sequence pairs with no alignments under any condition: 461526 Sequence pairs did not map uniquely: 1188170 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1060872 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1058969 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 94124167 Total methylated C's in CpG context: 2226059 Total methylated C's in CHG context: 103227 Total methylated C's in CHH context: 456383 Total methylated C's in Unknown context: 11837 Total unmethylated C's in CpG context: 9298955 Total unmethylated C's in CHG context: 15973072 Total unmethylated C's in CHH context: 66066471 Total unmethylated C's in Unknown context: 99016 C methylated in CpG context: 19.3% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.7% Now waiting for all child processes to complete 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1310482 (34.77%) aligned concordantly 0 times 869568 (23.07%) aligned concordantly exactly 1 time 1589487 (42.17%) aligned concordantly >1 times 65.23% overall alignment rate 3769537 reads; of these: 3769537 (100.00%) were paired; of these: 1308568 (34.71%) aligned concordantly 0 times 870571 (23.09%) aligned concordantly exactly 1 time 1590398 (42.19%) aligned concordantly >1 times 65.29% overall alignment rate Processed 3769537 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 3769537 Number of paired-end alignments with a unique best hit: 2121237 Mapping efficiency: 56.3% Sequence pairs with no alignments under any condition: 461632 Sequence pairs did not map uniquely: 1186668 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1063061 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1058176 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 94160649 Total methylated C's in CpG context: 2229539 Total methylated C's in CHG context: 102850 Total methylated C's in CHH context: 455924 Total methylated C's in Unknown context: 11849 Total unmethylated C's in CpG context: 9298149 Total unmethylated C's in CHG context: 15991292 Total unmethylated C's in CHH context: 66082895 Total unmethylated C's in Unknown context: 99346 C methylated in CpG context: 19.3% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.7% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 15078148. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.1 /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.1 /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.2 /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.2 /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.3 /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.3 /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.4 /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.4 /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.5 /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.5 /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.6 /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.6 /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.7 /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.7 /tmp/13-wgbs-Pum4-1046736/Pum4_R1.fq.gz.temp.8 /tmp/13-wgbs-Pum4-1046736/Pum4_R2.fq.gz.temp.8 Now merging BAM files Pum4_R1.fq.gz.temp.1_bismark_bt2_pe.bam Pum4_R1.fq.gz.temp.2_bismark_bt2_pe.bam Pum4_R1.fq.gz.temp.3_bismark_bt2_pe.bam Pum4_R1.fq.gz.temp.4_bismark_bt2_pe.bam Pum4_R1.fq.gz.temp.5_bismark_bt2_pe.bam Pum4_R1.fq.gz.temp.6_bismark_bt2_pe.bam Pum4_R1.fq.gz.temp.7_bismark_bt2_pe.bam Pum4_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Pum4_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Pum4_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Pum4_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Pum4_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Pum4_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Pum4_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Pum4_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Pum4_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Pum4_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1_bismark_bt2_PE_report.txt Now merging temporary reports Pum4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Pum4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Pum4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Pum4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Pum4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Pum4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Pum4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Pum4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Pum4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 30156298 Number of paired-end alignments with a unique best hit: 16962777 Mapping efficiency: 56.2% Sequence pairs with no alignments under any condition: 3690349 Sequence pairs did not map uniquely: 9503172 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 8491558 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 8471218 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 753070840 Total methylated C's in CpG context: 17826488 Total methylated C's in CHG context: 824009 Total methylated C's in CHH context: 3655167 Total methylated C's in Unknown context: 94369 Total unmethylated C's in CpG context: 74385559 Total unmethylated C's in CHG context: 127827103 Total unmethylated C's in CHH context: 528552514 Total unmethylated C's in Unknown context: 790427 C methylated in CpG context: 19.3% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.7% Deleting temporary report files... Pum4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Pum4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 44m 1s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Pum4_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Pum4_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Pum4_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Pum4_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Pum4_pe.bam: 16962776 Total number duplicated alignments removed: 594061 (3.50%) Duplicated alignments were found at: 570376 different position(s) Total count of deduplicated leftover sequences: 16368715 (96.50% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Pum4_R1.fq.gz -2 output/13-wgbs/trimmed/Pum4_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Pum4-1046736 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Pum4_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Pum4_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Pum4_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum4_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum4_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Pum4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum4_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Pum4_R1.fq.gz -2 output/13-wgbs/trimmed/Pum4_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Pum4-1046736 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum4_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Pum4_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Pum4_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.8 Processed 16368715 lines in total Total number of methylation call strings processed: 32737430 Final Cytosine Methylation Report ================================= Total number of C's analysed: 571028422 Total methylated C's in CpG context: 13466605 Total methylated C's in CHG context: 525912 Total methylated C's in CHH context: 2361613 Total C to T conversions in CpG context: 56547846 Total C to T conversions in CHG context: 96983247 Total C to T conversions in CHH context: 401143199 C methylated in CpG context: 19.2% C methylated in non-CpG context: 0.6% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum4_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum4_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum4_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum4_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum4_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Pum4_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum4_pe.deduplicated.txt.gz Writing bedGraph to file: Pum4_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Pum4_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Pum4_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Pum4_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum4_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Pum4_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Pum4.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Pum4.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1368663 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1688023 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 2997235 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2881691 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2836841 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2518999 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2761311 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1426565 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2792340 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2617087 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Pum4.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Pum4.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Pum4_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Pum4_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1371527336 34.35 378413849 32.06 3.624 C 639789879 16.02 211781786 17.94 3.021 G 706910400 17.71 211810957 17.95 3.337 T 1274310759 31.92 378309330 32.05 3.368 AA 498513941 12.58 128492079 10.89 3.880 AC 218320252 5.51 68264877 5.78 3.198 AG 219955433 5.55 62424886 5.29 3.524 AT 425269798 10.73 119230832 10.10 3.567 CA 263058837 6.64 80836853 6.85 3.254 CC 111441036 2.81 42358709 3.59 2.631 CG 78012585 1.97 26104181 2.21 2.989 CT 182381631 4.60 62481783 5.29 2.919 GA 241182905 6.08 67679435 5.73 3.564 GC 103643396 2.61 33452245 2.83 3.098 GG 128922619 3.25 42378301 3.59 3.042 GT 228099579 5.75 68300800 5.79 3.340 TA 358751056 9.05 101400983 8.59 3.538 TC 201762333 5.09 67705770 5.74 2.980 TG 274960024 6.94 80903356 6.85 3.399 TT 429657714 10.84 128294772 10.87 3.349 [Fri Oct 9 13:10:54 PDT 2026] Pum4 done