[Fri Oct 9 11:29:23 PDT 2026] Pum3 (Pum/Pumalin) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 32550439 total bases: 4915116289 Q20 bases: 4858179998(98.8416%) Q30 bases: 4709097691(95.8085%) Q40 bases: 4709097691(95.8085%) Read2 before filtering: total reads: 32550439 total bases: 4915116289 Q20 bases: 4850523716(98.6858%) Q30 bases: 4692837045(95.4776%) Q40 bases: 4692837045(95.4776%) Read1 after filtering: total reads: 32017056 total bases: 4432895965 Q20 bases: 4394709750(99.1386%) Q30 bases: 4279803715(96.5465%) Q40 bases: 4279803715(96.5465%) Read2 after filtering: total reads: 32017056 total bases: 4434397385 Q20 bases: 4393027882(99.0671%) Q30 bases: 4266735889(96.2191%) Q40 bases: 4266735889(96.2191%) Filtering result: reads passed filter: 64034112 reads failed due to low quality: 511638 reads failed due to too many N: 1276 reads failed due to too short: 553852 reads with adapter trimmed: 6243969 bases trimmed due to adapters: 140869708 Duplication rate: 4.92082% Insert size peak (evaluated by paired-end reads): 225 JSON report: output/13-wgbs/fastp/Pum3.fastp.json HTML report: output/13-wgbs/fastp/Pum3.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/PUM3 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/PUM3 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Pum3_R1.fq.gz -O output/13-wgbs/trimmed/Pum3_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Pum3.fastp.json --html output/13-wgbs/fastp/Pum3.fastp.html fastp v1.0.1, time used: 88 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Pum3_R1.fq.gz output/13-wgbs/trimmed/Pum3_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Pum3-1046738 Temporary files will be written into the directory: /tmp/13-wgbs-Pum3-1046738/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum3_R1.fq.gz and output/13-wgbs/trimmed/Pum3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum3_R1.fq.gz and output/13-wgbs/trimmed/Pum3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum3_R1.fq.gz and output/13-wgbs/trimmed/Pum3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum3_R1.fq.gz and output/13-wgbs/trimmed/Pum3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum3_R1.fq.gz and output/13-wgbs/trimmed/Pum3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum3_R1.fq.gz and output/13-wgbs/trimmed/Pum3_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum3_R1.fq.gz and output/13-wgbs/trimmed/Pum3_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum3_R1.fq.gz and output/13-wgbs/trimmed/Pum3_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Pum3_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum3_R1.fq.gz for PID: 1048080 and offset 8 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum3_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum3_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum3_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum3_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum3_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum3_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum3_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum3_R1.fq.gz.temp.5 to /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum3_R2.fq.gz for PID: 1048080 and offset 8 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum3_R1.fq.gz.temp.8 to /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum3_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum3_R1.fq.gz.temp.3 to /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum3_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum3_R1.fq.gz.temp.6 to /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum3_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum3_R1.fq.gz.temp.2 to /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum3_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4002132) Finished subdividing output/13-wgbs/trimmed/Pum3_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum3_R2.fq.gz<) Input files are in FastQ format Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum3_R1.fq.gz.temp.1 to /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.1_C_to_T.fastq Writing a C -> T converted version of the input file Pum3_R1.fq.gz.temp.4 to /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum3_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4002132) Using the subset file >/tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum3_R1.fq.gz.temp.7 to /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.7_C_to_T.fastq Created C -> T converted version of the FastQ file Pum3_R1.fq.gz.temp.5 (4002132 sequences in total) Writing a G -> A converted version of the input file Pum3_R2.fq.gz.temp.5 to /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Pum3_R1.fq.gz.temp.8 (4002132 sequences in total) Writing a G -> A converted version of the input file Pum3_R2.fq.gz.temp.8 to /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Pum3_R1.fq.gz.temp.3 (4002132 sequences in total) Writing a G -> A converted version of the input file Pum3_R2.fq.gz.temp.3 to /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Pum3_R1.fq.gz.temp.2 (4002132 sequences in total) Writing a G -> A converted version of the input file Pum3_R2.fq.gz.temp.2 to /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Pum3_R1.fq.gz.temp.6 (4002132 sequences in total) Writing a G -> A converted version of the input file Pum3_R2.fq.gz.temp.6 to /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Pum3_R1.fq.gz.temp.1 (4002132 sequences in total) Writing a G -> A converted version of the input file Pum3_R2.fq.gz.temp.1 to /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Pum3_R1.fq.gz.temp.4 (4002132 sequences in total) Writing a G -> A converted version of the input file Pum3_R2.fq.gz.temp.4 to /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Pum3_R1.fq.gz.temp.7 (4002132 sequences in total) Writing a G -> A converted version of the input file Pum3_R2.fq.gz.temp.7 to /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.7_G_to_A.fastq Created G -> A converted version of the FastQ file Pum3_R2.fq.gz.temp.5 (4002132 sequences in total) Input files are Pum3_R1.fq.gz.temp.5_C_to_T.fastq and Pum3_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum3_R2.fq.gz.temp.3 (4002132 sequences in total) Input files are Pum3_R1.fq.gz.temp.3_C_to_T.fastq and Pum3_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum3_R2.fq.gz.temp.8 (4002132 sequences in total) Input files are Pum3_R1.fq.gz.temp.8_C_to_T.fastq and Pum3_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum3_R2.fq.gz.temp.2 (4002132 sequences in total) Input files are Pum3_R1.fq.gz.temp.2_C_to_T.fastq and Pum3_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum3_R2.fq.gz.temp.6 (4002132 sequences in total) Created G -> A converted version of the FastQ file Pum3_R2.fq.gz.temp.1 (4002132 sequences in total) Input files are Pum3_R1.fq.gz.temp.6_C_to_T.fastq and Pum3_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Input files are Pum3_R1.fq.gz.temp.1_C_to_T.fastq and Pum3_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum3_R2.fq.gz.temp.4 (4002132 sequences in total) Input files are Pum3_R1.fq.gz.temp.4_C_to_T.fastq and Pum3_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum3_R2.fq.gz.temp.7 (4002132 sequences in total) Input files are Pum3_R1.fq.gz.temp.7_C_to_T.fastq and Pum3_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1250:41919:5316_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_1B_CT_converted 7884151 0 22M5I1M1I112M = 7884151 135 TTATATTAAAATGAAATTTAAAGGAAGTAATATATTGTGTAATGTAAATTATAGAAAATATATGATGTTATAATTAAATGATGTTGTAGTAGTGTGAGATAGAAAATTTTATATGGTTGTTTTATATGGGTAAAGTTGATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII AS:i:-82 XN:i:0 XM:i:9 XO:i:2 XG:i:6 NM:i:15 MD:Z:4T3T0T0G2T3G5T1T47A61 YS:i:-82 YT:Z:CP LH00129:489:23JFWNLT4:8:1250:41919:5316_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_1B_CT_converted 7884151 0 22M5I1M1I112M = 7884151 -135 TTATATTAAAATGAAATTTAAAGGAAGTAATATATTGTGTAATGTAAATTATAGAAAATATATGATGTTATAATTAAATGATGTTGTAGTAGTGTGAGATAGAAAATTTTATATGGTTGTTTTATATGGGTAAAGTTGATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-82 XN:i:0 XM:i:9 XO:i:2 XG:i:6 NM:i:15 MD:Z:4T3T0T0G2T3G5T1T47A61 YS:i:-82 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1466:41515:11397_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_6A_CT_converted 66997983 35 141M = 66998068 226 TTGTTTTTATGTAAATTAGTTTAAAATGTAAATATATATATTATGATTTGTTTATGTATTGATTGATATATATGTATTTAATTTTTTTTTATATGATGTTTTGTAGAATTTAAATAATAAGTAAATATGTTAGAATAAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1466:41515:11397_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_6A_CT_converted 66998068 35 141M = 66997983 -226 TTTTTATATGATGTTTTGTAGAATTTAAATAATAAGTAAATATGTTAGAATAAATTAATAGAAATATTAATTTATTTTATTATTTATTATTATAATTTTGTTATAGAAGTTTGTTGTAAAATATTGTAATTTGTGTAGTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-83 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2112:26249:22649_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_2A_CT_converted 74046704 40 141M = 74046862 293 ATTAAAAGGTATATTGATATTGTTTAATTATTGTAATGTGTGTATTTTTGAGATAATTTATTAAATGTATAATAATGAAAAAGTGGTTGTAATATTTAAATTATTAATAATGAGATAAAAATAAGTTTTTTAATAAATTGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-35 YT:Z:CP LH00129:489:23JFWNLT4:8:2112:26249:22649_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_2A_CT_converted 74046862 40 130M6I5M = 74046704 -293 TATTTATTTTTGTATATTTATGATGTTATTATATGTGTTGATTTTAGTAATAGGGTATTGTATGTTTATGATATTATAGTATATATGTGATTAGTAAATTATGTGGAAGGGGTATATTGATAATATTAGGTTTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-35 XN:i:0 XM:i:2 XO:i:1 XG:i:6 NM:i:8 MD:Z:132G0G1 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1312:21678:14396_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TATAAATATTAGATGATAGATAGAGTTATTTTGTTTTGATTGAAGTGAGATTAAAGATGGTGGTTGTTTATTAATGTATTTGTAATAGTGGGATTATGTGATTTATATTATTTGTTTGTAGGTAGGTAATATAGTTTTATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1312:21678:14396_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAACTAAATTATATATTTAAATTTAAAAAATAACTAAATTTAAATTTAATTCTACACCTAATACAATATACATTATCATACTACAAATTAAATTCTAACAATCTAATTAACTCACTAACCATTATTATAAAACTATATTAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1312:6792:6633_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TAGTTAATAGATTTTAATATTGGAGTTTTTAAAGTGTTGTGTTGGTTTTGTTTTTAGTGTTATATTTTTAAAGGGATTTTTTTGTATTGATTATTTTTTGTTATTTTTAATTTTTTTTTTTAAAGTAATAGTAATGTATAT IIIIIIII9IIIIIIIIIIIIIIIII99IIIII99IIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIII9II*II*IIIIII9I9I9IIIIIIIIIII9III99III9IIIIIII99III99II*I9II9III9I9*I9* YT:Z:UP LH00129:489:23JFWNLT4:8:1312:6792:6633_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAAATTATACATAAAACTACTAATACAACAATACCTCTACAAAAAAAATAAAAATATAATACATCATCTCTTCTAATACTACAACAATCTCATATAAAAATATACATTACTATTACTTTAAAAAAAAAAATTAAAAATAAC I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII999II YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2213:5862:13541_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_8B_CT_converted 26454711 1 141M = 26454706 -146 TTGTATGTATGTTATATGTAGGATTATATTGAAAATTAGTGTTATTGTTATATATGTAATTTTGGATGAATAAAGGTTTTTTTATTATTATATTATATAATAAAGTAATTTATGAAATTTATAGATTTTTTTATTTATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIII9IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:50A29A60 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:2213:5862:13541_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_8B_CT_converted 26454706 1 141M = 26454711 146 TTTGTTTGTATGTATGTTATATGTAGGATTATATTGAAAATTAGTGTTATTGTTATATATGTAATTTTGGATGAATAAAGGTTTTTTTATTATTATATTATATAATAAAGTAATTTATGAAATTTATAGATTTTTTTATTT III9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:55A29A55 YS:i:-12 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2123:31216:17717_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_10A_CT_converted 13066144 1 141M = 13066225 222 ATGATGATATGTGTATATTTTATATATATGTGGATTAAGTTTATGTTATTTAAGGGTAGTATATAATATTTATTTATATTGTAATGAATTTTTTATTGAAAAATATTAAATTTTAAATAGTTATTTTATTGAAGAAAGGAA IIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII9IIIIII9IIIIIII9IIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9III9IIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:2123:31216:17717_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_10A_CT_converted 13066225 1 141M = 13066144 -222 TAATGAATTTTTTATTGAAAAATATTAAATTTTAAATAGTTATTTTATTGAAGAAAGGAATAAAATATTTATGAAATGTATATTTTTGTTTGATTTATAAGTTTATTATATTTATAATTTTTGTTTATTTTGGTTTTGTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII AS:i:-12 XS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:138A1A0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2455:29776:2331_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TTTTTTTGTTTAATGGTTATAAGTGTTGAGTATATAGGTTTAAATTTTGTAGTTTTTTATTGGTAGTGGTGATGTTTTTATATGAGTGAAATATTTTTGAGAGGGATGTAAAATAATATTTAATTAATTGATAGATTTATG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2455:29776:2331_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 CCACTCTCATTTTATCACTAAACTATATATAAAAACTTAAAACTATCAAACCTAATAAAACTTATTTACAAATTATATATTATAACAATCCTAAATATAAATAACAAAAACCACAAAATTATCACAAATATAAAAAAATTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1466:41515:11397_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_7B_GA_converted 62827314 0 141M = 62827243 -212 AATTTATTCTAACATATTTACTTATTATTTAAATTCTACAAAACATCATATAAAAAAAAATTAAATACATATATATCAATCAATACATAAACAAATCATAATATATATATTTACATTTTAAACTAATTTACATAAAAACAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-16 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:95A44T0 YS:i:-70 YT:Z:CP LH00129:489:23JFWNLT4:8:1466:41515:11397_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_7B_GA_converted 62827243 0 5M5I15M9I107M = 62827314 212 TTACTACACAAATTACAATATTTTACAACAAACTTCTATAACAAAATTATAATAATAAATAATAAAATAAATTAATATTTCTATTAATTTATTCTAACATATTTACTTATTATTTAAATTCTACAAAACATCATATAAAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-70 XS:i:-83 XN:i:0 XM:i:3 XO:i:2 XG:i:14 NM:i:17 MD:Z:9T2C4C109 YS:i:-12 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1250:41919:5316_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_2A_GA_converted 43897075 38 141M = 43897075 -141 AATCAACTTTACCCATATAAAACAACCATATAAAATTTTCTATCTCACACTACTACAACATCATTTAATTATAACATCATATATTTTCTATAATTTACATTACACAATATATTACTTCCTTTAAATTTCATTTTAATATAA IIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-75 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1250:41919:5316_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_2A_GA_converted 43897075 38 141M = 43897075 141 AATCAACTTTACCCATATAAAACAACCATATAAAATTTTCTATCTCACACTACTACAACATCATTTAATTATAACATCATATATTTTCTATAATTTACATTACACAATATATTACTTCCTTTAAATTTCATTTTAATATAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-75 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:2112:26249:22649_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 ATTAAAAGGTATATTGATATTGTTTAATTATTGTAATGTGTGTATTTTTGAGATAATTTATTAAATGTATAATAATGAAAAAGTGGTTGTAATATTTAAATTATTAATAATGAGATAAAAATAAGTTTTTTAATAAATTGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2112:26249:22649_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAAAAAAAAAACCTAATATTATCAATATACCCCTTCCACATAATTTACTAATCACATATATACTATAATATCATAAACATACAATACCCTATTACTAAAATCAACACATATAATAACATCATAAATATACAAAAATAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:2213:5862:13541_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_8B_GA_converted 37350393 32 141M = 37350398 146 AAAATAAATAAAAAAATCTATAAATTTCATAAATTACTTTATTATATAATATAATAATAAAAAAACCTTTATTCATCCAAAATTACATATATAACAATAACACTAATTTTCAATATAATCCTACATATAACATACATACAA IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII9IIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-26 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:2213:5862:13541_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_8B_GA_converted 37350398 32 141M = 37350393 -146 AAATAAAAAAATCTATAAATTTCATAAATTACTTTATTATATAATATAATAATAAAAAAACCTTTATTCATCCAAAATTACATATATAACAATAACACTAATTTTCAATATAATCCTACATATAACATACATACAAACAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9III AS:i:0 XS:i:-26 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Pum3_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum3_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum3_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum3_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1312:6792:6633_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_6A_GA_converted 7683150 42 141M = 7683051 -240 ATATACATTACTATTACTTTAAAAAAAAAAATTAAAAATAACAAAAAATAATCAATACAAAAAAATCCCTTTAAAAATATAACACTAAAAACAAAACCAACACAACACTTTAAAAACTCCAATATTAAAATCTATTAACTA *9I*9I9III9II9I*II99III99IIIIIII9III99III9IIIIIIIIIII9I9I9IIIIII*II*II9IIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIII99IIIII99IIIIIIIIIIIIIIIII9IIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1312:6792:6633_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_6A_GA_converted 7683051 42 141M = 7683150 240 AAAATTATACATAAAACTACTAATACAACAATACCTCTACAAAAAAAATAAAAATATAATACATCATCTCTTCTAATACTACAACAATCTCATATAAAAATATACATTACTATTACTTTAAAAAAAAAAATTAAAAATAAC I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII999II AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:0T0T139 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:2123:31216:17717_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 ATGATGATATGTGTATATTTTATATATATGTGGATTAAGTTTATGTTATTTAAGGGTAGTATATAATATTTATTTATATTGTAATGAATTTTTTATTGAAAAATATTAAATTTTAAATAGTTATTTTATTGAAGAAAGGAA IIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII9IIIIII9IIIIIII9IIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9III9IIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2123:31216:17717_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAACAAAACCAAAATAAACAAAAATTATAAATATAATAAACTTATAAATCAAACAAAAATATACATTTCATAAATATTTTATTCCTTTCTTCAATAAAATAACTATTTAAAATTTAATATTTTTCAATAAAAAATTCATTA IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Pum3_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1312:21678:14396_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TATAAATATTAGATGATAGATAGAGTTATTTTGTTTTGATTGAAGTGAGATTAAAGATGGTGGTTGTTTATTAATGTATTTGTAATAGTGGGATTATGTGATTTATATTATTTGTTTGTAGGTAGGTAATATAGTTTTATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1312:21678:14396_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAACTAAATTATATATTTAAATTTAAAAAATAACTAAATTTAAATTTAATTCTACACCTAATACAATATACATTATCATACTACAAATTAAATTCTAACAATCTAATTAACTCACTAACCATTATTATAAAACTATATTAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Pum3_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:2455:29776:2331_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TTTTTTTGTTTAATGGTTATAAGTGTTGAGTATATAGGTTTAAATTTTGTAGTTTTTTATTGGTAGTGGTGATGTTTTTATATGAGTGAAATATTTTTGAGAGGGATGTAAAATAATATTTAATTAATTGATAGATTTATG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2455:29776:2331_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 CCACTCTCATTTTATCACTAAACTATATATAAAAACTTAAAACTATCAAACCTAATAAAACTTATTTACAAATTATATATTATAACAATCCTAAATATAAATAACAAAAACCACAAAATTATCACAAATATAAAAAAATTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Pum3_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum3_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.1 and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.6 and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.5 and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.3 and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.4 and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.2 and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.8 and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.7 and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.7 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2252:8119:10388_1:N:0:TGAGTACT+GACAATAA Chromosome_9B 91966292 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2358:38165:8931_1:N:0:TGAGTACT+GACAATAA Chromosome_9B 91966292 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1410215 (35.24%) aligned concordantly 0 times 919289 (22.97%) aligned concordantly exactly 1 time 1672628 (41.79%) aligned concordantly >1 times 64.76% overall alignment rate 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1410694 (35.25%) aligned concordantly 0 times 918483 (22.95%) aligned concordantly exactly 1 time 1672955 (41.80%) aligned concordantly >1 times 64.75% overall alignment rate Processed 4000000 sequence pairs so far Processed 4002132 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4002132 Number of paired-end alignments with a unique best hit: 2238968 Mapping efficiency: 55.9% Sequence pairs with no alignments under any condition: 512809 Sequence pairs did not map uniquely: 1250355 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1121051 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1117917 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 98897135 Total methylated C's in CpG context: 2341119 Total methylated C's in CHG context: 101148 Total methylated C's in CHH context: 450430 Total methylated C's in Unknown context: 11903 Total unmethylated C's in CpG context: 9699159 Total unmethylated C's in CHG context: 16788214 Total unmethylated C's in CHH context: 69517065 Total unmethylated C's in Unknown context: 106786 C methylated in CpG context: 19.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.0% 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1410150 (35.23%) aligned concordantly 0 times 917563 (22.93%) aligned concordantly exactly 1 time 1674419 (41.84%) aligned concordantly >1 times 64.77% overall alignment rate Processed 4000000 sequence pairs so far 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1412413 (35.29%) aligned concordantly 0 times 916617 (22.90%) aligned concordantly exactly 1 time 1673102 (41.81%) aligned concordantly >1 times 64.71% overall alignment rate Processed 4002132 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4002132 Number of paired-end alignments with a unique best hit: 2238915 Mapping efficiency: 55.9% Sequence pairs with no alignments under any condition: 513680 Sequence pairs did not map uniquely: 1249537 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1120764 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1118151 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 98893980 Total methylated C's in CpG context: 2346331 Total methylated C's in CHG context: 101571 Total methylated C's in CHH context: 448687 Total methylated C's in Unknown context: 11623 Total unmethylated C's in CpG context: 9676211 Total unmethylated C's in CHG context: 16776753 Total unmethylated C's in CHH context: 69544427 Total unmethylated C's in Unknown context: 106981 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.8% 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1410759 (35.25%) aligned concordantly 0 times 917789 (22.93%) aligned concordantly exactly 1 time 1673584 (41.82%) aligned concordantly >1 times 64.75% overall alignment rate 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1409983 (35.23%) aligned concordantly 0 times 918558 (22.95%) aligned concordantly exactly 1 time 1673591 (41.82%) aligned concordantly >1 times 64.77% overall alignment rate Processed 4000000 sequence pairs so far Processed 4002132 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4002132 Number of paired-end alignments with a unique best hit: 2240446 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 512429 Sequence pairs did not map uniquely: 1249257 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1120198 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1120247 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 98945535 Total methylated C's in CpG context: 2346166 Total methylated C's in CHG context: 101045 Total methylated C's in CHH context: 449542 Total methylated C's in Unknown context: 11873 Total unmethylated C's in CpG context: 9681538 Total unmethylated C's in CHG context: 16798688 Total unmethylated C's in CHH context: 69568556 Total unmethylated C's in Unknown context: 107644 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1408866 (35.20%) aligned concordantly 0 times 918320 (22.95%) aligned concordantly exactly 1 time 1674946 (41.85%) aligned concordantly >1 times 64.80% overall alignment rate Processed 4000000 sequence pairs so far 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1411689 (35.27%) aligned concordantly 0 times 917402 (22.92%) aligned concordantly exactly 1 time 1673041 (41.80%) aligned concordantly >1 times 64.73% overall alignment rate Processed 4002132 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4002132 Number of paired-end alignments with a unique best hit: 2239335 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 512325 Sequence pairs did not map uniquely: 1250472 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1121236 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1118099 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 98916954 Total methylated C's in CpG context: 2347464 Total methylated C's in CHG context: 100864 Total methylated C's in CHH context: 449285 Total methylated C's in Unknown context: 11997 Total unmethylated C's in CpG context: 9693283 Total unmethylated C's in CHG context: 16785318 Total unmethylated C's in CHH context: 69540740 Total unmethylated C's in Unknown context: 106519 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.1% 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1410715 (35.25%) aligned concordantly 0 times 917094 (22.92%) aligned concordantly exactly 1 time 1674323 (41.84%) aligned concordantly >1 times 64.75% overall alignment rate 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1410120 (35.23%) aligned concordantly 0 times 918843 (22.96%) aligned concordantly exactly 1 time 1673169 (41.81%) aligned concordantly >1 times 64.77% overall alignment rate 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1411682 (35.27%) aligned concordantly 0 times 917091 (22.92%) aligned concordantly exactly 1 time 1673359 (41.81%) aligned concordantly >1 times 64.73% overall alignment rate 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1412528 (35.29%) aligned concordantly 0 times 917186 (22.92%) aligned concordantly exactly 1 time 1672418 (41.79%) aligned concordantly >1 times 64.71% overall alignment rate Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4002132 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4002132 Number of paired-end alignments with a unique best hit: 2240588 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 512770 Sequence pairs did not map uniquely: 1248774 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1122111 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1118477 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 98993014 Total methylated C's in CpG context: 2348419 Total methylated C's in CHG context: 101686 Total methylated C's in CHH context: 449564 Total methylated C's in Unknown context: 11901 Total unmethylated C's in CpG context: 9693235 Total unmethylated C's in CHG context: 16805959 Total unmethylated C's in CHH context: 69594151 Total unmethylated C's in Unknown context: 107168 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.0% Processed 4002132 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4002132 Number of paired-end alignments with a unique best hit: 2239321 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 512663 Sequence pairs did not map uniquely: 1250148 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1121717 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1117604 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 98946649 Total methylated C's in CpG context: 2344366 Total methylated C's in CHG context: 101940 Total methylated C's in CHH context: 448531 Total methylated C's in Unknown context: 11898 Total unmethylated C's in CpG context: 9711228 Total unmethylated C's in CHG context: 16789231 Total unmethylated C's in CHH context: 69551353 Total unmethylated C's in Unknown context: 106826 C methylated in CpG context: 19.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.0% 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1410684 (35.25%) aligned concordantly 0 times 917600 (22.93%) aligned concordantly exactly 1 time 1673848 (41.82%) aligned concordantly >1 times 64.75% overall alignment rate 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1409139 (35.21%) aligned concordantly 0 times 918548 (22.95%) aligned concordantly exactly 1 time 1674445 (41.84%) aligned concordantly >1 times 64.79% overall alignment rate Processed 4000000 sequence pairs so far Processed 4002132 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4002132 Number of paired-end alignments with a unique best hit: 2241600 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 511410 Sequence pairs did not map uniquely: 1249122 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1122731 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1118868 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 99023728 Total methylated C's in CpG context: 2341569 Total methylated C's in CHG context: 101291 Total methylated C's in CHH context: 449697 Total methylated C's in Unknown context: 11812 Total unmethylated C's in CpG context: 9714069 Total unmethylated C's in CHG context: 16803083 Total unmethylated C's in CHH context: 69614019 Total unmethylated C's in Unknown context: 107407 C methylated in CpG context: 19.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% Now waiting for all child processes to complete 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1411048 (35.26%) aligned concordantly 0 times 918558 (22.95%) aligned concordantly exactly 1 time 1672526 (41.79%) aligned concordantly >1 times 64.74% overall alignment rate 4002132 reads; of these: 4002132 (100.00%) were paired; of these: 1412673 (35.30%) aligned concordantly 0 times 918227 (22.94%) aligned concordantly exactly 1 time 1671232 (41.76%) aligned concordantly >1 times 64.70% overall alignment rate Processed 4000000 sequence pairs so far Processed 4002132 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4002132 Number of paired-end alignments with a unique best hit: 2239576 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 513327 Sequence pairs did not map uniquely: 1249229 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1120169 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1119407 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 98970301 Total methylated C's in CpG context: 2341841 Total methylated C's in CHG context: 100759 Total methylated C's in CHH context: 446729 Total methylated C's in Unknown context: 11977 Total unmethylated C's in CpG context: 9694411 Total unmethylated C's in CHG context: 16793717 Total unmethylated C's in CHH context: 69592844 Total unmethylated C's in Unknown context: 107245 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.0% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 16008528. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.1 /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.1 /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.2 /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.2 /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.3 /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.3 /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.4 /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.4 /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.5 /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.5 /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.6 /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.6 /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.7 /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.7 /tmp/13-wgbs-Pum3-1046738/Pum3_R1.fq.gz.temp.8 /tmp/13-wgbs-Pum3-1046738/Pum3_R2.fq.gz.temp.8 Now merging BAM files Pum3_R1.fq.gz.temp.1_bismark_bt2_pe.bam Pum3_R1.fq.gz.temp.2_bismark_bt2_pe.bam Pum3_R1.fq.gz.temp.3_bismark_bt2_pe.bam Pum3_R1.fq.gz.temp.4_bismark_bt2_pe.bam Pum3_R1.fq.gz.temp.5_bismark_bt2_pe.bam Pum3_R1.fq.gz.temp.6_bismark_bt2_pe.bam Pum3_R1.fq.gz.temp.7_bismark_bt2_pe.bam Pum3_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Pum3_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Pum3_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Pum3_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Pum3_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Pum3_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Pum3_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Pum3_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Pum3_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Pum3_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1_bismark_bt2_PE_report.txt Now merging temporary reports Pum3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Pum3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Pum3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Pum3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Pum3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Pum3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Pum3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Pum3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Pum3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 32017056 Number of paired-end alignments with a unique best hit: 17918749 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 4101413 Sequence pairs did not map uniquely: 9996894 Sequence pairs which were discarded because genomic sequence could not be extracted: 2 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 8969977 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 8948770 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 791587296 Total methylated C's in CpG context: 18757275 Total methylated C's in CHG context: 810304 Total methylated C's in CHH context: 3592465 Total methylated C's in Unknown context: 94984 Total unmethylated C's in CpG context: 77563134 Total unmethylated C's in CHG context: 134340963 Total unmethylated C's in CHH context: 556523155 Total unmethylated C's in Unknown context: 856576 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.0% Deleting temporary report files... Pum3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Pum3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 43m 44s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Pum3_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Pum3_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Pum3_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Pum3_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Pum3_pe.bam: 17918747 Total number duplicated alignments removed: 1057449 (5.90%) Duplicated alignments were found at: 994488 different position(s) Total count of deduplicated leftover sequences: 16861298 (94.10% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Pum3_R1.fq.gz -2 output/13-wgbs/trimmed/Pum3_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Pum3-1046738 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Pum3_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Pum3_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Pum3_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum3_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum3_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Pum3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum3_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Pum3_R1.fq.gz -2 output/13-wgbs/trimmed/Pum3_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Pum3-1046738 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum3_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Pum3_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Pum3_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.8 Processed 16861298 lines in total Total number of methylation call strings processed: 33722596 Final Cytosine Methylation Report ================================= Total number of C's analysed: 597033542 Total methylated C's in CpG context: 14101137 Total methylated C's in CHG context: 495721 Total methylated C's in CHH context: 2227424 Total C to T conversions in CpG context: 58675537 Total C to T conversions in CHG context: 101406343 Total C to T conversions in CHH context: 420127380 C methylated in CpG context: 19.4% C methylated in non-CpG context: 0.5% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum3_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum3_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum3_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum3_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum3_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Pum3_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum3_pe.deduplicated.txt.gz Writing bedGraph to file: Pum3_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Pum3_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Pum3_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Pum3_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum3_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Pum3_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Pum3.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Pum3.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1346395 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1682149 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 2958551 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2869645 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2798415 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2463191 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2723069 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1376584 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2722652 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2591620 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Pum3.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Pum3.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Pum3_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Pum3_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1413814473 34.52 378413849 32.06 3.736 C 652692942 15.94 211781786 17.94 3.082 G 723864021 17.67 211810957 17.95 3.418 T 1305460343 31.87 378309330 32.05 3.451 AA 515848819 12.69 128492079 10.89 4.015 AC 223879777 5.51 68264877 5.78 3.280 AG 226629717 5.57 62424886 5.29 3.630 AT 437684125 10.76 119230832 10.10 3.671 CA 269663888 6.63 80836853 6.85 3.336 CC 113030177 2.78 42358709 3.59 2.668 CG 79102086 1.95 26104181 2.21 3.030 CT 185919878 4.57 62481783 5.29 2.976 GA 248322598 6.11 67679435 5.73 3.669 GC 105415575 2.59 33452245 2.83 3.151 GG 131526402 3.23 42378301 3.59 3.104 GT 233452393 5.74 68300800 5.79 3.418 TA 369664460 9.09 101400983 8.59 3.646 TC 205664204 5.06 67705770 5.74 3.038 TG 281428537 6.92 80903356 6.85 3.479 TT 439275639 10.80 128294772 10.87 3.424 [Fri Oct 9 13:10:37 PDT 2026] Pum3 done