[Fri Oct 9 15:19:20 PDT 2026] Rio5 (Rio/Rio_Pudeto) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 33380360 total bases: 5040434360 Q20 bases: 4978714428(98.7755%) Q30 bases: 4810722503(95.4426%) Q40 bases: 4810722503(95.4426%) Read2 before filtering: total reads: 33380360 total bases: 5040434360 Q20 bases: 4968891911(98.5806%) Q30 bases: 4800151010(95.2329%) Q40 bases: 4800151010(95.2329%) Read1 after filtering: total reads: 32773197 total bases: 4516123672 Q20 bases: 4476837799(99.1301%) Q30 bases: 4349633152(96.3134%) Q40 bases: 4349633152(96.3134%) Read2 after filtering: total reads: 32773197 total bases: 4518031814 Q20 bases: 4475741533(99.064%) Q30 bases: 4347639525(96.2286%) Q40 bases: 4347639525(96.2286%) Filtering result: reads passed filter: 65546394 reads failed due to low quality: 506754 reads failed due to too many N: 1136 reads failed due to too short: 706436 reads with adapter trimmed: 9542459 bases trimmed due to adapters: 196520334 Duplication rate: 3.91718% Insert size peak (evaluated by paired-end reads): 176 JSON report: output/13-wgbs/fastp/Rio5.fastp.json HTML report: output/13-wgbs/fastp/Rio5.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP5 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP5 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Rio5_R1.fq.gz -O output/13-wgbs/trimmed/Rio5_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Rio5.fastp.json --html output/13-wgbs/fastp/Rio5.fastp.html fastp v1.0.1, time used: 67 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Rio5_R1.fq.gz output/13-wgbs/trimmed/Rio5_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Rio5-1211844 Temporary files will be written into the directory: /tmp/13-wgbs-Rio5-1211844/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio5_R1.fq.gz and output/13-wgbs/trimmed/Rio5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio5_R1.fq.gz and output/13-wgbs/trimmed/Rio5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio5_R1.fq.gz and output/13-wgbs/trimmed/Rio5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio5_R1.fq.gz and output/13-wgbs/trimmed/Rio5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio5_R1.fq.gz and output/13-wgbs/trimmed/Rio5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio5_R1.fq.gz and output/13-wgbs/trimmed/Rio5_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio5_R1.fq.gz and output/13-wgbs/trimmed/Rio5_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio5_R1.fq.gz and output/13-wgbs/trimmed/Rio5_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Rio5_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio5_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio5_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio5_R1.fq.gz for PID: 1212710 and offset 8 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio5_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio5_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4096649) Finished subdividing output/13-wgbs/trimmed/Rio5_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio5_R1.fq.gz<) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio5_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio5_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio5_R1.fq.gz.temp.5 to /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio5_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio5_R1.fq.gz.temp.6 to /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio5_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio5_R1.fq.gz.temp.2 to /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio5_R2.fq.gz for PID: 1212710 and offset 8 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio5_R1.fq.gz.temp.8 to /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio5_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio5_R1.fq.gz.temp.1 to /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio5_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio5_R1.fq.gz.temp.7 to /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio5_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio5_R1.fq.gz.temp.4 to /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio5_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio5_R1.fq.gz.temp.3 to /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.3_C_to_T.fastq Created C -> T converted version of the FastQ file Rio5_R1.fq.gz.temp.5 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio5_R2.fq.gz.temp.5 to /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Rio5_R1.fq.gz.temp.2 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio5_R2.fq.gz.temp.2 to /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Rio5_R1.fq.gz.temp.1 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio5_R2.fq.gz.temp.1 to /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Rio5_R1.fq.gz.temp.8 (4096649 sequences in total) Writing a G -> A converted version of the input file Rio5_R2.fq.gz.temp.8 to /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Rio5_R1.fq.gz.temp.7 (4096649 sequences in total) Writing a G -> A converted version of the input file Rio5_R2.fq.gz.temp.7 to /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Rio5_R1.fq.gz.temp.4 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio5_R2.fq.gz.temp.4 to /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Rio5_R1.fq.gz.temp.6 (4096649 sequences in total) Writing a G -> A converted version of the input file Rio5_R2.fq.gz.temp.6 to /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Rio5_R1.fq.gz.temp.3 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio5_R2.fq.gz.temp.3 to /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.3_G_to_A.fastq Created G -> A converted version of the FastQ file Rio5_R2.fq.gz.temp.5 (4096650 sequences in total) Input files are Rio5_R1.fq.gz.temp.5_C_to_T.fastq and Rio5_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio5_R2.fq.gz.temp.2 (4096650 sequences in total) Input files are Rio5_R1.fq.gz.temp.2_C_to_T.fastq and Rio5_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio5_R2.fq.gz.temp.1 (4096650 sequences in total) Input files are Rio5_R1.fq.gz.temp.1_C_to_T.fastq and Rio5_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio5_R2.fq.gz.temp.8 (4096649 sequences in total) Input files are Rio5_R1.fq.gz.temp.8_C_to_T.fastq and Rio5_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio5_R2.fq.gz.temp.4 (4096650 sequences in total) Input files are Rio5_R1.fq.gz.temp.4_C_to_T.fastq and Rio5_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio5_R2.fq.gz.temp.7 (4096649 sequences in total) Input files are Rio5_R1.fq.gz.temp.7_C_to_T.fastq and Rio5_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio5_R2.fq.gz.temp.3 (4096650 sequences in total) Input files are Rio5_R1.fq.gz.temp.3_C_to_T.fastq and Rio5_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio5_R2.fq.gz.temp.6 (4096649 sequences in total) Input files are Rio5_R1.fq.gz.temp.6_C_to_T.fastq and Rio5_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1261:6388:3999_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 TATTGAATTGATTAATATGAAGGAATGTGAATATTGTTAATAAATAGAATGTTTTTTATGTATTTAAATGTTGAGTTGAAGGTAGAGATTTATTTTTTTTATGAAAAGGTGAAGATAATAAATGGTGATTAATTTTAGAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1261:6388:3999_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 AAATATTCCATACCAATTATTAAACCATTCTTTACACACTAATTTTAACTAATAATTCTCCATTTACCTAACCAAAATATAAAACTCACAACAAATATAACCAATCAACAAAAATAATATATCCAAAAATCCATATTTACC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1349:2011:18445_1:N:0:AGCGGCAA+GTGATGAA/1 99 Chromosome_8B_CT_converted 34943321 0 141M = 34943312 -150 GATTTTTGAAAGTGTTGTTGTTAATTTTTTAATAATATTATTATATAGGTAAATAGTTTATTTTTATTTAAATATTGAAGATATAGAAAATATGTATTTAATAAAAATTTGTGTAATTTTATGTGTGAATATTAGTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-54 XS:i:-72 XN:i:0 XM:i:9 XO:i:0 XG:i:0 NM:i:9 MD:Z:18G2A2A53T0T38A3T14G1G1 YS:i:-42 YT:Z:CP LH00129:489:23JFWNLT4:8:1349:2011:18445_2:N:0:AGCGGCAA+GTGATGAA/2 147 Chromosome_8B_CT_converted 34943312 0 141M = 34943321 150 ATGATTATGGATTTTTGAAAGTGTTGTTGTTAATTTTTTAATAATATTATTATATAGGTAAATAGTTTATTTTTATTTAAATATTGAAGATATAGAAAATATGTATTTAATAAAAATTTGTGTAATTTTATGTGTGAATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-42 XS:i:-60 XN:i:0 XM:i:7 XO:i:0 XG:i:0 NM:i:7 MD:Z:27G2A2A53T0T38A3T9 YS:i:-54 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2133:23312:9295_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 AGAGTATATGTTTGAATTTTAGTTATAGTGGTAAATTTGGTGTGTTGTTTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*I**999*****9*9**99* YT:Z:UP LH00129:489:23JFWNLT4:8:2133:23312:9295_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 AAAACATCATATAAAAAAAAAATATATAATATAATATAAATCTCAATAATCACCATACCATTAAAAAA IIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIII**I*I9I*II9I99*II*9**I99I*II9** YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1273:50406:1070_1:N:0:AGCGGCAA+GTGATGTA/1 99 Chromosome_7B_CT_converted 61116074 1 141M = 61116309 376 ATAATTGTTTTGTTTTATTTATATATAATATGTATTATTTATTTGTTGGTGATATTGAGAAAATAATGTTATAATATTGTATTATTAATTTTGATGTTATTTTTTGATAGTTGTTTTTTTTTTGTTTGAATAATGTTATTG IIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*9IIIIIII9IIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIII9IIII9IIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1273:50406:1070_2:N:0:AGCGGCAA+GTGATGTA/2 147 Chromosome_7B_CT_converted 61116309 1 141M = 61116074 -376 AGATTATTAAAAATAGTTATGTTATGGAAAATAAATTATTTATTTATATGTAAGTTGATTGTGGTTATAGATATTTTGTGGAAGAAATTTGTGTTAATTAGAGTGTGGAAAATAATGTGTGTATTTGTTAAAAATTGTTGA IIIIIIIIIIIIIIIIII9IIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1122:10757:5932_1:N:0:AGCGGCAA+GTGATGTA/1 99 Chromosome_1B_CT_converted 103436558 1 141M = 103436494 -205 ATAAGTATTTTATTTTGTTAGAGTTAATAGAAGATATATAATGATAAGTATTTTATTTTGTTAGAGTTAATAGAAGAATATATAATGATAAGTATTTTATTTTGTTAGAGTTAATAGAAGAATATATAATGATAAGTATTT IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIII9IIIIII*IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1122:10757:5932_2:N:0:AGCGGCAA+GTGATGTA/2 147 Chromosome_1B_CT_converted 103436494 1 141M = 103436558 205 TTAATAGAAGAATATATAATGATAAGTATTTTATTTTGTTAGAGTTATTAGAAGATATATAATGATAAGTATTTTATTTTGTTAGAGTTAATAGAAGATATATAATGATAAGTATTTTATTTTGTTAGAGTTAATAGAAGT II9I9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:140A0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2392:6250:8160_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 TTTTGTATTGTTTATAGGAGTTATGAGATTGATTATTGTTTGTTATTTTTATTTTTTAGTAAGAATATGAATGTTATGGATTGTGGTTTGTGTATTGAGGAAAAAAGATTAGGAAAATATGTGTGAGATTAAATATGTGTT IIIIIIIIIIIII*IIIIIIIIIIIIIIIII9I9IIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIII9IIIIIIIIIIIII9II9IIIIIII*IIIIIIIII9IIIIIII9IIII YT:Z:UP LH00129:489:23JFWNLT4:8:2392:6250:8160_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 AAAAAAAACACCTACTCTCTTAATATAAATTCAAAAATTTATTTAATCATACAATAAACATACACATTCATTAAAATAATTACAACACTAACACATATTTAATCTCACACATATTTTCCTAATCTTTTTTCCTCAATCCAC IIIIIIIIIIIIIIIII9IIIIIIIIII*III99I9III9IIIIIIIIIIII9IIII99IIIIIIIIIIIIIIIIII*I9IIIIIIIIIIII9*IIIIIII9II9I99II9II9I9I**I9999IIIIIIIIII*II*I9* YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1402:4956:24415_1:N:0:AGCGGCAA+GTGATGTG/1 77 * 0 0 * * 0 0 ATAGAAATAGTTGAGTAGTTATGATTGTGAAATATAATGTATATATGTATGAGAAAAAATAAGAATATTAGTGAATTTGATGGATATTTTTTGAATTGTATTTAATTAATGATTTATTTTATATAAGGAATGAGTTATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1402:4956:24415_2:N:0:AGCGGCAA+GTGATGTG/2 141 * 0 0 * * 0 0 AACACATAAATAAATAATAAACAAATAACTTTTTAACAAAAATCATTTTATAAAAAAAAACATTACTCAACATATATAACTTTATATAAAAAAAATTCATTTCAACAATTAATAATCTATATAACTCATTCCTTATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1334:1898:15979_1:N:0:AGCGGCAA+GTGATGTA/1 99 Chromosome_8B_CT_converted 5429132 42 141M = 5429309 318 GGTTAGGTGTTTAGGAGGAGTAAGTATTTGTTTGAGTTTTAGTTTTTGATTAAATAAAAATATGTGTATATTAAAATAATTATAATAGTTTTAATTTAGTTTTTAGATATTATTGTAAATTTTATGTAATATTAATTTAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1334:1898:15979_2:N:0:AGCGGCAA+GTGATGTA/2 147 Chromosome_8B_CT_converted 5429309 42 141M = 5429132 -318 TGATATGAATTTAAAGTTATTGAGTAATTAGATTTTATTTTTTTTTAATGAATTATGTATTTAGAAGTAGTTTTGAAAAAAATTTATAATGATGTAGATATTTTAAAGTGTTTTATATGGAAGTTATTATATTATATGTGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2133:23312:9295_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 AGAGTATATGTTTGAATTTTAGTTATAGTGGTAAATTTGGTGTGTTGTTTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*I**999*****9*9**99* YT:Z:UP LH00129:489:23JFWNLT4:8:2133:23312:9295_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 AAAACATCATATAAAAAAAAAATATATAATATAATATAAATCTCAATAATCACCATACCATTAAAAAA IIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIII**I*I9I*II9I99*II*9**I99I*II9** YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1349:2011:18445_1:N:0:AGCGGCAA+GTGATGAA/1 83 Chromosome_8B_GA_converted 34800324 12 141M = 34800333 150 AAAAAACTAATATTCACACATAAAATTACACAAATTTTTATTAAATACATATTTTCTATATCTTCAATATTTAAATAAAAATAAACTATTTACCTATATAATAATATTATTAAAAAATTAACAACAACACTTTCAAAAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-18 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:1C1C137 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1349:2011:18445_2:N:0:AGCGGCAA+GTGATGAA/2 163 Chromosome_8B_GA_converted 34800333 12 141M = 34800324 -150 ATATTCACACATAAAATTACACAAATTTTTATTAAATACATATTTTCTATATCTTCAATATTTAAATAAAAATAAACTATTTACCTATATAATAATATTATTAAAAAATTAACAACAACACTTTCAAAAATCCATAATCAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-12 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP >>> Writing bisulfite mapping results to Rio5_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:2392:6250:8160_1:N:0:AGCGGCAA+GTGATGTA/1 83 Chromosome_5B_GA_converted 67508812 42 141M = 67508723 -230 AACACATATTTAATCTCACACATATTTTCCTAATCTTTTTTCCTCAATACACAAACCACAATCCATAACATTCATATTCTTACTAAAAAATAAAAATAACAAACAATAATCAATCTCATAACTCCTATAAACAATACAAAA IIII9IIIIIII9IIIIIIIII*IIIIIII9II9IIIIIIIIIIIII9IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIII9I9IIIIIIIIIIIIIIIII*IIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:2392:6250:8160_2:N:0:AGCGGCAA+GTGATGTA/2 163 Chromosome_5B_GA_converted 67508723 42 141M = 67508812 230 AAAAAAAACACCTACTCTCTTAATATAAATTCAAAAATTTATTTAATCATACAATAAACATACACATTCATTAAAATAATTACAACACTAACACATATTTAATCTCACACATATTTTCCTAATCTTTTTTCCTCAATCCAC IIIIIIIIIIIIIIIII9IIIIIIIIII*III99I9III9IIIIIIIIIIII9IIII99IIIIIIIIIIIIIIIIII*I9IIIIIIIIIIII9*IIIIIII9II9I99II9II9I9I**I9999IIIIIIIIII*II*I9* AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:68T68A3 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1334:1898:15979_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 GGTTAGGTGTTTAGGAGGAGTAAGTATTTGTTTGAGTTTTAGTTTTTGATTAAATAAAAATATGTGTATATTAAAATAATTATAATAGTTTTAATTTAGTTTTTAGATATTATTGTAAATTTTATGTAATATTAATTTAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1334:1898:15979_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 ACACATATAATATAATAACTTCCATATAAAACACTTTAAAATATCTACATCATTATAAATTTTTTTCAAAACTACTTCTAAATACATAATTCATTAAAAAAAAATAAAATCTAATTACTCAATAACTTTAAATTCATATCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Rio5_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio5_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1273:50406:1070_1:N:0:AGCGGCAA+GTGATGTA/1 83 Chromosome_8B_GA_converted 68080696 0 14M3I1M3I120M = 68080461 -370 CAATAACATTATTCAAACAAAAAAAAAACAACTATCAAAAAATAACATCAAAATTAATAATACAATATTATAACATTATTTTCTCAATATCACCAACAAATAAATAATACATATTATATATAAATAAAACAAAACAATTAT IIII9IIII9IIIIIIIIIIIIIIIIIIIIII9II9IIIIIIIIII9IIIIIII9*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIII AS:i:-46 XN:i:0 XM:i:3 XO:i:2 XG:i:6 NM:i:9 MD:Z:26C24C76A6 YS:i:-78 YT:Z:CP LH00129:489:23JFWNLT4:8:1273:50406:1070_2:N:0:AGCGGCAA+GTGATGTA/2 163 Chromosome_8B_GA_converted 68080461 0 141M = 68080696 370 TCAACAATTTTTAACAAATACACACATTATTTTCCACACTCTAATTAACACAAATTTCTTCCACAAAATATCTATAACCACAATCAACTTACATATAAATAAATAATTTATTTTCCATAACATAACTATTTTTAATAATCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII9IIIIIIIIIIIIIIIIII AS:i:-78 XN:i:0 XM:i:13 XO:i:0 XG:i:0 NM:i:13 MD:Z:8A26T3A0A0C12A29A2A19A7A0T7C1A14 YS:i:-46 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1122:10757:5932_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 ATAAGTATTTTATTTTGTTAGAGTTAATAGAAGATATATAATGATAAGTATTTTATTTTGTTAGAGTTAATAGAAGAATATATAATGATAAGTATTTTATTTTGTTAGAGTTAATAGAAGAATATATAATGATAAGTATTT IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIII9IIIIII*IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1122:10757:5932_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 ACTTCTATTAACTCTAACAAAATAAAATACTTATCATTATATATCTTCTATTAACTCTAACAAAATAAAATACTTATCATTATATATCTTCTAATAACTCTAACAAAATAAAATACTTATCATTATATATTCTTCTATTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9I9II YT:Z:UP >>> Writing bisulfite mapping results to Rio5_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio5_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1261:6388:3999_1:N:0:AGCGGCAA+GTGATGTA/1 83 Chromosome_6B_GA_converted 79211177 42 141M = 79211007 -311 ATTCTAAAATTAATCACCATTTATTATCTTCACCTTTTCATAAAAAAAATAAATCTCTACCTTCAACTCAACATTTAAATACATAAAAAACATTCTATTTATTAACAATATTCACATTCCTTCATATTAATCAATTCAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1261:6388:3999_2:N:0:AGCGGCAA+GTGATGTA/2 163 Chromosome_6B_GA_converted 79211007 42 141M = 79211177 311 AAATATTCCATACCAATTATTAAACCATTCTTTACACACTAATTTTAACTAATAATTCTCCATTTACCTAACCAAAATATAAAACTCACAACAAATATAACCAATCAACAAAAATAATATATCCAAAAATCCATATTTACC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:2T138 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Rio5_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio5_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1402:4956:24415_1:N:0:AGCGGCAA+GTGATGTG/1 83 Chromosome_4A_GA_converted 6538592 42 141M = 6538475 -258 TATATAACTCATTCCTTATATAAAATAAATCATTAATTAAATACAATTCAAAAAATATCCATCAAATTCACTAATATTCTTATTTTTTCTCATACATATATACATTATATTTCACAATCATAACTACTCAACTATTTCTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1402:4956:24415_2:N:0:AGCGGCAA+GTGATGTG/2 163 Chromosome_4A_GA_converted 6538475 42 141M = 6538592 258 AACACATAAATAAATAATAAACAAATAACTTTTTAACAAAAATCATTTTATAAAAAAAAACATTACTCAACATATATAACTTTATATAAAAAAAATTCATTTCAACAATTAATAATCTATATAACTCATTCCTTATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:1T139 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Rio5_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.1 and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.4 and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.2 and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.7 and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.6 and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.3 and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.5 and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.8 and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.8 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2128:6752:23322_1:N:0:AGCGGCAA+GTGATGTA Chromosome_6A 76092827 Processed 4000000 sequence pairs so far 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1347854 (32.90%) aligned concordantly 0 times 963938 (23.53%) aligned concordantly exactly 1 time 1784858 (43.57%) aligned concordantly >1 times 67.10% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1346293 (32.86%) aligned concordantly 0 times 963815 (23.53%) aligned concordantly exactly 1 time 1786542 (43.61%) aligned concordantly >1 times 67.14% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2361072 Mapping efficiency: 57.6% Sequence pairs with no alignments under any condition: 405254 Sequence pairs did not map uniquely: 1330324 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1182672 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1178400 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101530962 Total methylated C's in CpG context: 2642111 Total methylated C's in CHG context: 132307 Total methylated C's in CHH context: 589176 Total methylated C's in Unknown context: 13823 Total unmethylated C's in CpG context: 9865850 Total unmethylated C's in CHG context: 17332604 Total unmethylated C's in CHH context: 70968914 Total unmethylated C's in Unknown context: 92144 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.0% Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1347705 (32.90%) aligned concordantly 0 times 962426 (23.49%) aligned concordantly exactly 1 time 1786518 (43.61%) aligned concordantly >1 times 67.10% overall alignment rate 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1345162 (32.84%) aligned concordantly 0 times 963900 (23.53%) aligned concordantly exactly 1 time 1787587 (43.64%) aligned concordantly >1 times 67.16% overall alignment rate Processed 4096649 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096649 Number of paired-end alignments with a unique best hit: 2361816 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 405136 Sequence pairs did not map uniquely: 1329697 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1182569 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1179247 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101551531 Total methylated C's in CpG context: 2646135 Total methylated C's in CHG context: 132555 Total methylated C's in CHH context: 591118 Total methylated C's in Unknown context: 13861 Total unmethylated C's in CpG context: 9866010 Total unmethylated C's in CHG context: 17347482 Total unmethylated C's in CHH context: 70968231 Total unmethylated C's in Unknown context: 91255 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.2% Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1348734 (32.92%) aligned concordantly 0 times 960347 (23.44%) aligned concordantly exactly 1 time 1787569 (43.63%) aligned concordantly >1 times 67.08% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1343559 (32.80%) aligned concordantly 0 times 964565 (23.55%) aligned concordantly exactly 1 time 1788526 (43.66%) aligned concordantly >1 times 67.20% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2362072 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 405195 Sequence pairs did not map uniquely: 1329383 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1184447 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1177625 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101535327 Total methylated C's in CpG context: 2641795 Total methylated C's in CHG context: 132313 Total methylated C's in CHH context: 590416 Total methylated C's in Unknown context: 14034 Total unmethylated C's in CpG context: 9866168 Total unmethylated C's in CHG context: 17345258 Total unmethylated C's in CHH context: 70959377 Total unmethylated C's in Unknown context: 92421 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.2% Processed 4000000 sequence pairs so far 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1349037 (32.93%) aligned concordantly 0 times 964163 (23.54%) aligned concordantly exactly 1 time 1783450 (43.53%) aligned concordantly >1 times 67.07% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1345521 (32.84%) aligned concordantly 0 times 965410 (23.57%) aligned concordantly exactly 1 time 1785719 (43.59%) aligned concordantly >1 times 67.16% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2363376 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 405118 Sequence pairs did not map uniquely: 1328156 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1184169 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1179207 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101620793 Total methylated C's in CpG context: 2640175 Total methylated C's in CHG context: 132327 Total methylated C's in CHH context: 590748 Total methylated C's in Unknown context: 13777 Total unmethylated C's in CpG context: 9876511 Total unmethylated C's in CHG context: 17359537 Total unmethylated C's in CHH context: 71021495 Total unmethylated C's in Unknown context: 91974 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.0% Processed 4000000 sequence pairs so far 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1345855 (32.85%) aligned concordantly 0 times 965235 (23.56%) aligned concordantly exactly 1 time 1785559 (43.59%) aligned concordantly >1 times 67.15% overall alignment rate 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1346599 (32.87%) aligned concordantly 0 times 964770 (23.55%) aligned concordantly exactly 1 time 1785280 (43.58%) aligned concordantly >1 times 67.13% overall alignment rate 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1345423 (32.84%) aligned concordantly 0 times 965289 (23.56%) aligned concordantly exactly 1 time 1785937 (43.60%) aligned concordantly >1 times 67.16% overall alignment rate Processed 4096649 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096649 Number of paired-end alignments with a unique best hit: 2362557 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 402990 Sequence pairs did not map uniquely: 1331102 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1182554 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1180003 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101535880 Total methylated C's in CpG context: 2640724 Total methylated C's in CHG context: 132497 Total methylated C's in CHH context: 590462 Total methylated C's in Unknown context: 13666 Total unmethylated C's in CpG context: 9862255 Total unmethylated C's in CHG context: 17345883 Total unmethylated C's in CHH context: 70964059 Total unmethylated C's in Unknown context: 91975 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% Now waiting for all child processes to complete 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1347051 (32.88%) aligned concordantly 0 times 963962 (23.53%) aligned concordantly exactly 1 time 1785636 (43.59%) aligned concordantly >1 times 67.12% overall alignment rate Processed 4096649 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096649 Number of paired-end alignments with a unique best hit: 2363289 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 404232 Sequence pairs did not map uniquely: 1329128 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1182546 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1180743 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101623536 Total methylated C's in CpG context: 2645006 Total methylated C's in CHG context: 132746 Total methylated C's in CHH context: 592112 Total methylated C's in Unknown context: 13849 Total unmethylated C's in CpG context: 9874417 Total unmethylated C's in CHG context: 17356792 Total unmethylated C's in CHH context: 71022463 Total unmethylated C's in Unknown context: 91636 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1347891 (32.90%) aligned concordantly 0 times 963893 (23.53%) aligned concordantly exactly 1 time 1784866 (43.57%) aligned concordantly >1 times 67.10% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1346060 (32.86%) aligned concordantly 0 times 966471 (23.59%) aligned concordantly exactly 1 time 1784119 (43.55%) aligned concordantly >1 times 67.14% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2362731 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 404704 Sequence pairs did not map uniquely: 1329215 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1183534 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1179196 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101554054 Total methylated C's in CpG context: 2638944 Total methylated C's in CHG context: 132614 Total methylated C's in CHH context: 590329 Total methylated C's in Unknown context: 13780 Total unmethylated C's in CpG context: 9863614 Total unmethylated C's in CHG context: 17348587 Total unmethylated C's in CHH context: 70979966 Total unmethylated C's in Unknown context: 91654 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1346857 (32.88%) aligned concordantly 0 times 963876 (23.53%) aligned concordantly exactly 1 time 1785917 (43.59%) aligned concordantly >1 times 67.12% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1345031 (32.83%) aligned concordantly 0 times 965915 (23.58%) aligned concordantly exactly 1 time 1785704 (43.59%) aligned concordantly >1 times 67.17% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2363046 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 403940 Sequence pairs did not map uniquely: 1329664 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1183674 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1179372 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101594614 Total methylated C's in CpG context: 2645754 Total methylated C's in CHG context: 132760 Total methylated C's in CHH context: 591561 Total methylated C's in Unknown context: 13497 Total unmethylated C's in CpG context: 9868793 Total unmethylated C's in CHG context: 17357249 Total unmethylated C's in CHH context: 70998497 Total unmethylated C's in Unknown context: 91739 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.8% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 16386596. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.1 /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.1 /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.2 /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.2 /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.3 /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.3 /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.4 /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.4 /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.5 /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.5 /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.6 /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.6 /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.7 /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.7 /tmp/13-wgbs-Rio5-1211844/Rio5_R1.fq.gz.temp.8 /tmp/13-wgbs-Rio5-1211844/Rio5_R2.fq.gz.temp.8 Now merging BAM files Rio5_R1.fq.gz.temp.1_bismark_bt2_pe.bam Rio5_R1.fq.gz.temp.2_bismark_bt2_pe.bam Rio5_R1.fq.gz.temp.3_bismark_bt2_pe.bam Rio5_R1.fq.gz.temp.4_bismark_bt2_pe.bam Rio5_R1.fq.gz.temp.5_bismark_bt2_pe.bam Rio5_R1.fq.gz.temp.6_bismark_bt2_pe.bam Rio5_R1.fq.gz.temp.7_bismark_bt2_pe.bam Rio5_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Rio5_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Rio5_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Rio5_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Rio5_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Rio5_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Rio5_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Rio5_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Rio5_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Rio5_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1_bismark_bt2_PE_report.txt Now merging temporary reports Rio5_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Rio5_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Rio5_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Rio5_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Rio5_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Rio5_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Rio5_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Rio5_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Rio5_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 32773197 Number of paired-end alignments with a unique best hit: 18899959 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 3236569 Sequence pairs did not map uniquely: 10636669 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 9466165 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 9433793 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 812546697 Total methylated C's in CpG context: 21140644 Total methylated C's in CHG context: 1060119 Total methylated C's in CHH context: 4725922 Total methylated C's in Unknown context: 110287 Total unmethylated C's in CpG context: 78943618 Total unmethylated C's in CHG context: 138793392 Total unmethylated C's in CHH context: 567883002 Total unmethylated C's in Unknown context: 734798 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% Deleting temporary report files... Rio5_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio5_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 45m 12s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Rio5_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Rio5_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Rio5_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Rio5_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Rio5_pe.bam: 18899958 Total number duplicated alignments removed: 911279 (4.82%) Duplicated alignments were found at: 868882 different position(s) Total count of deduplicated leftover sequences: 17988679 (95.18% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Rio5_R1.fq.gz -2 output/13-wgbs/trimmed/Rio5_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio5-1211844 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Rio5_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Rio5_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Rio5_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio5_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio5_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Rio5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio5_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Rio5_R1.fq.gz -2 output/13-wgbs/trimmed/Rio5_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio5-1211844 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio5_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Rio5_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Rio5_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.8 Processed 17988679 lines in total Total number of methylation call strings processed: 35977358 Final Cytosine Methylation Report ================================= Total number of C's analysed: 574283124 Total methylated C's in CpG context: 14921086 Total methylated C's in CHG context: 702564 Total methylated C's in CHH context: 3153715 Total C to T conversions in CpG context: 55813203 Total C to T conversions in CHG context: 98062065 Total C to T conversions in CHH context: 401630491 C methylated in CpG context: 21.1% C methylated in non-CpG context: 0.8% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio5_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio5_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio5_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio5_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio5_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Rio5_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio5_pe.deduplicated.txt.gz Writing bedGraph to file: Rio5_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Rio5_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Rio5_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Rio5_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio5_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Rio5_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Rio5.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Rio5.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1289470 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1547789 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 2913418 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2760416 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2701034 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2445603 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2678914 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1362623 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2636482 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2506949 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Rio5.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Rio5.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Rio5_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Rio5_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1552788143 34.87 378413849 32.06 4.103 C 692332038 15.55 211781786 17.94 3.269 G 790609655 17.76 211810957 17.95 3.733 T 1417098796 31.82 378309330 32.05 3.746 AA 574680965 13.00 128492079 10.89 4.473 AC 239458907 5.42 68264877 5.78 3.508 AG 249568967 5.65 62424886 5.29 3.998 AT 478477411 10.82 119230832 10.10 4.013 CA 288053959 6.52 80836853 6.85 3.563 CC 117486675 2.66 42358709 3.59 2.774 CG 84731420 1.92 26104181 2.21 3.246 CT 196691835 4.45 62481783 5.29 3.148 GA 274325706 6.21 67679435 5.73 4.053 GC 112431794 2.54 33452245 2.83 3.361 GG 142879841 3.23 42378301 3.59 3.372 GT 255081938 5.77 68300800 5.79 3.735 TA 404302661 9.15 101400983 8.59 3.987 TC 217929283 4.93 67705770 5.74 3.219 TG 307732204 6.96 80903356 6.85 3.804 TT 477000662 10.79 128294772 10.87 3.718 [Fri Oct 9 17:04:01 PDT 2026] Rio5 done