[Fri Oct 9 15:13:16 PDT 2026] Rio4 (Rio/Rio_Pudeto) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 40588321 total bases: 6128836471 Q20 bases: 6060903168(98.8916%) Q30 bases: 5863763364(95.675%) Q40 bases: 5863763364(95.675%) Read2 before filtering: total reads: 40588321 total bases: 6128836471 Q20 bases: 6052169790(98.7491%) Q30 bases: 5857598775(95.5744%) Q40 bases: 5857598775(95.5744%) Read1 after filtering: total reads: 39972937 total bases: 5538094657 Q20 bases: 5491797339(99.164%) Q30 bases: 5336371017(96.3575%) Q40 bases: 5336371017(96.3575%) Read2 after filtering: total reads: 39972937 total bases: 5539339191 Q20 bases: 5490851160(99.1247%) Q30 bases: 5335548271(96.321%) Q40 bases: 5335548271(96.321%) Filtering result: reads passed filter: 79945874 reads failed due to low quality: 614450 reads failed due to too many N: 1462 reads failed due to too short: 614856 reads with adapter trimmed: 9233789 bases trimmed due to adapters: 183382934 Duplication rate: 4.3348% Insert size peak (evaluated by paired-end reads): 195 JSON report: output/13-wgbs/fastp/Rio4.fastp.json HTML report: output/13-wgbs/fastp/Rio4.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP4 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP4 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Rio4_R1.fq.gz -O output/13-wgbs/trimmed/Rio4_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Rio4.fastp.json --html output/13-wgbs/fastp/Rio4.fastp.html fastp v1.0.1, time used: 76 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Rio4_R1.fq.gz output/13-wgbs/trimmed/Rio4_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Rio4-1208184 Temporary files will be written into the directory: /tmp/13-wgbs-Rio4-1208184/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio4_R1.fq.gz and output/13-wgbs/trimmed/Rio4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio4_R1.fq.gz and output/13-wgbs/trimmed/Rio4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio4_R1.fq.gz and output/13-wgbs/trimmed/Rio4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio4_R1.fq.gz and output/13-wgbs/trimmed/Rio4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio4_R1.fq.gz and output/13-wgbs/trimmed/Rio4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio4_R1.fq.gz and output/13-wgbs/trimmed/Rio4_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio4_R1.fq.gz and output/13-wgbs/trimmed/Rio4_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio4_R1.fq.gz and output/13-wgbs/trimmed/Rio4_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Rio4_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio4_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio4_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio4_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio4_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4996618) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio4_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio4_R1.fq.gz for PID: 1209107 and offset 8 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio4_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio4_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio4_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio4_R1.fq.gz.temp.4 to /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio4_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio4_R1.fq.gz.temp.2 to /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio4_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio4_R1.fq.gz.temp.6 to /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio4_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio4_R1.fq.gz.temp.5 to /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio4_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4996618) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio4_R1.fq.gz.temp.1 to /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio4_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio4_R1.fq.gz.temp.7 to /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio4_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio4_R1.fq.gz.temp.3 to /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio4_R2.fq.gz for PID: 1209107 and offset 8 (sequences written out: 4996617) Using the subset file >/tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio4_R1.fq.gz.temp.8 to /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.8_C_to_T.fastq Created C -> T converted version of the FastQ file Rio4_R1.fq.gz.temp.2 (4996617 sequences in total) Writing a G -> A converted version of the input file Rio4_R2.fq.gz.temp.2 to /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Rio4_R1.fq.gz.temp.6 (4996617 sequences in total) Writing a G -> A converted version of the input file Rio4_R2.fq.gz.temp.6 to /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Rio4_R1.fq.gz.temp.4 (4996617 sequences in total) Writing a G -> A converted version of the input file Rio4_R2.fq.gz.temp.4 to /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Rio4_R1.fq.gz.temp.5 (4996617 sequences in total) Writing a G -> A converted version of the input file Rio4_R2.fq.gz.temp.5 to /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Rio4_R1.fq.gz.temp.7 (4996617 sequences in total) Writing a G -> A converted version of the input file Rio4_R2.fq.gz.temp.7 to /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Rio4_R1.fq.gz.temp.1 (4996618 sequences in total) Writing a G -> A converted version of the input file Rio4_R2.fq.gz.temp.1 to /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Rio4_R1.fq.gz.temp.3 (4996617 sequences in total) Writing a G -> A converted version of the input file Rio4_R2.fq.gz.temp.3 to /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Rio4_R1.fq.gz.temp.8 (4996617 sequences in total) Writing a G -> A converted version of the input file Rio4_R2.fq.gz.temp.8 to /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.8_G_to_A.fastq Created G -> A converted version of the FastQ file Rio4_R2.fq.gz.temp.2 (4996617 sequences in total) Input files are Rio4_R1.fq.gz.temp.2_C_to_T.fastq and Rio4_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio4_R2.fq.gz.temp.6 (4996617 sequences in total) Input files are Rio4_R1.fq.gz.temp.6_C_to_T.fastq and Rio4_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio4_R2.fq.gz.temp.5 (4996617 sequences in total) Input files are Rio4_R1.fq.gz.temp.5_C_to_T.fastq and Rio4_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio4_R2.fq.gz.temp.4 (4996617 sequences in total) Input files are Rio4_R1.fq.gz.temp.4_C_to_T.fastq and Rio4_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio4_R2.fq.gz.temp.7 (4996617 sequences in total) Input files are Rio4_R1.fq.gz.temp.7_C_to_T.fastq and Rio4_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio4_R2.fq.gz.temp.3 (4996617 sequences in total) Input files are Rio4_R1.fq.gz.temp.3_C_to_T.fastq and Rio4_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio4_R2.fq.gz.temp.1 (4996618 sequences in total) Input files are Rio4_R1.fq.gz.temp.1_C_to_T.fastq and Rio4_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio4_R2.fq.gz.temp.8 (4996617 sequences in total) Input files are Rio4_R1.fq.gz.temp.8_C_to_T.fastq and Rio4_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:46603:1042_1:N:0:ATCGAGCG+GGTAGATT/1 99 Chromosome_8B_CT_converted 70382541 24 141M = 70382668 259 GGGGGTTGTGAATGGTTTGTATAAAATGTTTTTTTTGGTATTATTTGGTTTATTTTAGGGTTAGTTTAAATAAAAAATTGTTTTAATATAATGGTAATATTTTTGATATTAAAAAGGTTGAGAAGGAAATGATAATGATAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-56 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:46603:1042_2:N:0:ATCGAGCG+GGTAGATT/2 147 Chromosome_8B_CT_converted 70382668 24 128M9I4M = 70382541 -259 AATGATAATGATAATTTTAAATGAGTATAGATGTATAATGTGGTAAATTTAATTTTTATTTATTAGTTTAAATGATGAATGTGTTGGAATAAAAATAAATATTGTTTTTATTTTGGAAATGAAAGATATTTTTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-56 XN:i:0 XM:i:4 XO:i:1 XG:i:9 NM:i:13 MD:Z:128A0A0G0A0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:45293:1042_1:N:0:ATCGAGCG+GGTAGATT/1 99 Chromosome_8B_CT_converted 51328013 0 141M = 51328057 183 GTATATTTAAGTGATGTAAATAAAAAATTATATGAGTTTTGTTTATATTATAAAGAAATTAGAATTGTGATTTATGAATTTTTTTGTAATTTGAAGTGAGGAATATATGTATTATAGTTAAGTATTTTAAATATTAAAAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII9IIIIIIIIIII AS:i:-36 XS:i:-36 XN:i:0 XM:i:6 XO:i:0 XG:i:0 NM:i:6 MD:Z:12T22A37T21A1T28G14 YS:i:-58 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:45293:1042_2:N:0:ATCGAGCG+GGTAGATT/2 147 Chromosome_8B_CT_converted 51328057 0 111M3I5M1D22M = 51328013 -183 ATATTATAAAGAAATTAGAATTGTGATTTATGAATTTTTTTGTAATTTGAAGTGAGGAATATATGTATTATAGTTAAGTATTTTAAATATTAAAAATGTAAAATGAAATTTGTGGAAAATTTTAGTTTAAATTTTGATTTT IIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-58 XS:i:-58 XN:i:0 XM:i:6 XO:i:2 XG:i:4 NM:i:10 MD:Z:29T21A1T28G33^T16T3A1 YS:i:-36 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:37316:1042_1:N:0:ATCGAGCG+GGTAGATT/1 99 Chromosome_1B_CT_converted 105375734 1 141M = 105375907 314 AGAATTATATTTTTGTGTATTGAGAAATTTATAAATGAATATTGTTTTTTAAAATTTAATTTATTTAAATATTGATTTGTATTTATTTGAAGGAAAAAGTGATATTAAATGATATTTTTTATTTGAAATATGTAATAAAAT 9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99II AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:44G96 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:37316:1042_2:N:0:ATCGAGCG+GGTAGATT/2 147 Chromosome_1B_CT_converted 105375907 1 141M = 105375734 -314 TTTTATAAAATGGGTATTATGAAGTGAATTTATATAAGATATTTTATAAGATGTGTATTAGTATGAAGAGATGGGAGTTGGTTTTTTTTATTATTTGAGTTATTATGGTTTAATGTGAAGGTTTTTATTTTATGTTTTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:30148:1042_1:N:0:ATCGAGCG+GNTAGATT/1 99 Chromosome_1B_CT_converted 183395887 1 4M3I134M = 183395974 228 ATGTTTATATTTTATTTTTTTTTAATATTTAAAGATGGAAATGTAGTTATGGATATTGTTTATATAAAAAATTAAGTATAAATGATGTTATGTTTGATTTATTTTTGTTTTATGTTAATAGATAATTAGGTTTATATTATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-44 XS:i:-44 XN:i:0 XM:i:5 XO:i:1 XG:i:3 NM:i:8 MD:Z:4G2G0G0G56G71 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:30148:1042_2:N:0:ATCGAGCG+GNTAGATT/2 147 Chromosome_1B_CT_converted 183395974 1 141M = 183395887 -228 TGTTTGATTTATTTTTGTTTTATGTTAATAGATAATTAGGTTTATATTATATTTGTATAAAATTTTATTTTGTTTTTTTGAGAGTTTTATATATGTTATTTGAAAAAGTTATGGTTAGTTTATATTTGGAATTTTTAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:139A1 YS:i:-44 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:41134:1042_1:N:0:ATCGAGCG+GGTAGATT/1 99 Chromosome_1B_CT_converted 216224012 34 141M = 216224063 192 AATGTAAATATTGATATTTGTAATGTTATTGTATGTTAGTTATAGTAGAATTTTGATTAAATGTAAATATTGATATTTGTAATGTTATTGTATGTTAGTTATAGTAGAATTTTGATTAAATGTAAATATTGATATTTGTAA IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIII9IIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:41134:1042_2:N:0:ATCGAGCG+GGTAGATT/2 147 Chromosome_1B_CT_converted 216224063 34 141M = 216224012 -192 TTTGATTAAATGTAAATATTGATATTTGTAATGTTATTGTATGTTAGTTATAGTAGAATTTTGATTAAATGTAAATATTGATATTTGTAATGTTATTGTATGTTAGTTATATTTTAGATTAAGGGTTGTATTTATAGTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-77 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:36005:1042_1:N:0:ATCGAGCG+GGTAGATT/1 99 Chromosome_4A_CT_converted 26953767 42 141M = 26953855 229 TGTTGTGAATGTTTATATGTTATTTTGGTGATAAATAGATTAAAATATTTAGAGTTTGGTTATTAATATAATTGAAAAGATTATTATTTTATGTATTTTATAATATTATAGTAATTGTGATATAAATAGATTAAAGTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:36005:1042_2:N:0:ATCGAGCG+GGTAGATT/2 147 Chromosome_4A_CT_converted 26953855 42 141M = 26953767 -229 TTATGTATTTTATAATATTATAGTAATTGTGATATAAATAGATTAAAGTTTATATATATATATTTTTTGTTTAATAATGATAGTAAGATGTGATTTTAAAATAATGGTTATTTTAGGTAGGATTTTGTAGAGAATATTGTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:49160:1042_1:N:0:ATCGAGCG+GGTAGATT/1 77 * 0 0 * * 0 0 TTAGGGGTTTGTGTTTGTTTAATTATTTATTTTGTATTGTTTATAGTAGTTATGAGATTGATTATAGAAGTTGATATAAAATTAATGGAAAAAAGAATATTTATATAGGGGGTTTTTTTTTTAAAAAGGGGAGAGTTTTTG IIIII9IIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIII********99**** YT:Z:UP LH00129:489:23JFWNLT4:8:1101:49160:1042_2:N:0:ATCGAGCG+GGTAGATT/2 141 * 0 0 * * 0 0 AACTTATTTTTCAAAAAAAACTTAATAACTATTAAATTTCATCCAAATTATCCCTTTAATAAAAAAATATATACCCATCCAACAAAAAAAATAAAATTTATACTATATATTAAAAAAAAATAAAAAATAAATTCAAATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9III YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:38222:1042_1:N:0:ATCGAGCG+GGTAGATT/1 77 * 0 0 * * 0 0 TGTATGTATAGATTATAGATTTAGTGTATGTATGTGTAGATTATTGATTTAGTGTATGTATAGATTATAGATTTAGTGTATGTATGTGTAGATTATTGATTTAGTGTATGTATGTTGTAGGATATTGATTTAGTGTATGTA 9IIIIII9IIIIIIIIIIIIII9IIII9IIIIIIIIIIIIIIIIIII9IIIIIIIIIII9III9IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:38222:1042_2:N:0:ATCGAGCG+GGTAGATT/2 141 * 0 0 * * 0 0 AATAATCTATACATACACTAAATCAATAATCTATACATACATACACTAAATCAATATCCTACAACATACATACACTAAATCAATAATCTACACATACATACACTAAATCTATAATCTATACATACACTAAATCAATAATCT IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:37316:1042_1:N:0:ATCGAGCG+GGTAGATT/1 83 Chromosome_6A_GA_converted 29320071 12 141M = 29319899 -313 ATTTTATTACATATTTCAAATAAAAAATATCATTTAATATCACTTTTTCCTTCAAATAAATACAAATCAATATTTAAATAAATTAAATTTTAAAAAACAATATTCATTTATAAATTTCTCAATACACAAAAATATAATTCT II99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9 AS:i:-6 XS:i:-24 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:96C44 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:37316:1042_2:N:0:ATCGAGCG+GGTAGATT/2 163 Chromosome_6A_GA_converted 29319899 12 141M = 29320071 313 TAAAAAACATAAAATAAAAACCTTCACATTAAACCATAATAACTCAAATAATAAAAAAAACCAACTCCCATCTCTTCATACTAATACACATCTTATAAAATATCTTATATAAATTCACTTCATAATACCCATTTTATAAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:19C121 YS:i:-6 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:45293:1042_1:N:0:ATCGAGCG+GGTAGATT/1 83 Chromosome_6A_GA_converted 67000846 7 141M = 67000802 -185 ATTTTTAATATTTAAAATACTTAACTATAATACATATATTCCTCACTTCAAATTACAAAAAAATTCATAAATCACAATTCTAATTTCTTTATAATATAAACAAAACTCATATAATTTTTTATTTACATCACTTAAATATAC IIIIIIIIIII9IIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-26 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:45T82A12 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:45293:1042_2:N:0:ATCGAGCG+GGTAGATT/2 163 Chromosome_6A_GA_converted 67000802 7 141M = 67000846 185 AAAATCAAAATTTAAACTAAAATTTTCCACAAATTTCATTTTACATTTTTAATATTTAAAATACTTAACTATAATACATATATTCCTCACTTCAAATTACAAAAAAATTCATAAATCACAATTCTAATTTCTTTATAATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIII AS:i:-12 XS:i:-20 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:1T87T51 YS:i:-12 YT:Z:CP >>> Writing bisulfite mapping results to Rio4_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:30148:1042_1:N:0:ATCGAGCG+GNTAGATT/1 83 Chromosome_8B_GA_converted 94432539 17 141M = 94432449 -231 TATAATATAAACCTAATTATCTATTAACATAAAACAAAAATAAATCAAACATAACATCATTTATACTTAATTTTTTATATAAACAATATCCATAACTACATTTCCATCTTTAAATATTAAAAAAAAATAAAATATAAACAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-50 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:30148:1042_2:N:0:ATCGAGCG+GNTAGATT/2 163 Chromosome_8B_GA_converted 94432449 17 141M = 94432539 231 AAATTAAAAATTCCAAATATAAACTAACCATAACTTTTTCAAATAACATATATAAAACTCTCAAAAAAACAAAATAAAATTTTATACAAATATAATATAAACCTAATTATCTATTAACATAAAACAAAAATAAATCAAACA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:1T139 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:49160:1042_1:N:0:ATCGAGCG+GGTAGATT/1 77 * 0 0 * * 0 0 TTAGGGGTTTGTGTTTGTTTAATTATTTATTTTGTATTGTTTATAGTAGTTATGAGATTGATTATAGAAGTTGATATAAAATTAATGGAAAAAAGAATATTTATATAGGGGGTTTTTTTTTTAAAAAGGGGAGAGTTTTTG IIIII9IIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIII********99**** YT:Z:UP LH00129:489:23JFWNLT4:8:1101:49160:1042_2:N:0:ATCGAGCG+GGTAGATT/2 141 * 0 0 * * 0 0 AACTTATTTTTCAAAAAAAACTTAATAACTATTAAATTTCATCCAAATTATCCCTTTAATAAAAAAATATATACCCATCCAACAAAAAAAATAAAATTTATACTATATATTAAAAAAAAATAAAAAATAAATTCAAATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9III YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:46603:1042_1:N:0:ATCGAGCG+GGTAGATT/1 83 Chromosome_8B_GA_converted 70909750 0 141M = 70909632 -259 TTATCATTATCATTTCCTTCTCAACCTTTTTAATATCAAAAATATTACCATTATATTAAAACAATTTTTTATTTAAACTAACCCTAAAATAAACCAAATAATACCAAAAAAAACATTTTATACAAACCATTCACAACCCCC IIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-12 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-56 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:46603:1042_2:N:0:ATCGAGCG+GGTAGATT/2 163 Chromosome_8B_GA_converted 70909632 0 4M9I128M = 70909750 259 AAAAAAAAAAAAATATCTTTCATTTCCAAAATAAAAACAATATTTATTTTTATTCCAACACATTCATCATTTAAACTAATAAATAAAAATTAAATTTACCACATTATACATCTATACTCATTTAAAATTATCATTATCATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-56 XS:i:-77 XN:i:0 XM:i:4 XO:i:1 XG:i:9 NM:i:13 MD:Z:0T0C0T0T128 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:36005:1042_1:N:0:ATCGAGCG+GGTAGATT/1 77 * 0 0 * * 0 0 TGTTGTGAATGTTTATATGTTATTTTGGTGATAAATAGATTAAAATATTTAGAGTTTGGTTATTAATATAATTGAAAAGATTATTATTTTATGTATTTTATAATATTATAGTAATTGTGATATAAATAGATTAAAGTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:36005:1042_2:N:0:ATCGAGCG+GGTAGATT/2 141 * 0 0 * * 0 0 TACAATATTCTCTACAAAATCCTACCTAAAATAACCATTATTTTAAAATCACATCTTACTATCATTATTAAACAAAAAATATATATATATAAACTTTAATCTATTTATATCACAATTACTATAATATTATAAAATACATAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Rio4_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:41134:1042_1:N:0:ATCGAGCG+GGTAGATT/1 83 Chromosome_1B_GA_converted 21301670 21 141M = 21301619 -192 TTACAAATATCAATATTTACATTTAATCAAAATTCTACTATAACTAACATACAATAACATTACAAATATCAATATTTACATTTAATCAAAATTCTACTATAACTAACATACAATAACATTACAAATATCAATATTTACATT IIIIIIIIIIIIIIII9IIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:41134:1042_2:N:0:ATCGAGCG+GGTAGATT/2 163 Chromosome_1B_GA_converted 21301619 21 141M = 21301670 192 TAAACTATAAATACAACCCTTAATCTAAAATATAACTAACATACAATAACATTACAAATATCAATATTTACATTTAATCAAAATTCTACTATAACTAACATACAATAACATTACAAATATCAATATTTACATTTAATCAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-77 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:24T116 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Rio4_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio4_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio4_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio4_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio4_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:38222:1042_1:N:0:ATCGAGCG+GGTAGATT/1 83 Chromosome_5B_GA_converted 30408901 6 141M = 30408864 -178 TACATACACTAAATCAATATCCTACAACATACATACACTAAATCAATAATCTACACATACATACACTAAATCTATAATCTATACATACACTAAATCAATAATCTACACATACATACACTAAATCTATAATCTATACATACA IIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIII9III9IIIIIIIIIII9IIIIIIIIIIIIIIIIIII9IIII9IIIIIIIIIIIIII9IIIIII9 AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:38222:1042_2:N:0:ATCGAGCG+GGTAGATT/2 163 Chromosome_5B_GA_converted 30408864 6 141M = 30408901 178 AATAATCTATACATACACTAAATCAATAATCTATACATACATACACTAAATCAATATCCTACAACATACATACACTAAATCAATAATCTACACATACATACACTAAATCTATAATCTATACATACACTAAATCAATAATCT IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Rio4_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.6 and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.1 and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.7 and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.8 and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.3 and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.2 and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.5 and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.4 and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.4 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1126:27406:15881_1:N:0:ATCGAGCG+GGTAGATT Chromosome_10A 2 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1679319 (33.61%) aligned concordantly 0 times 1198098 (23.98%) aligned concordantly exactly 1 time 2119200 (42.41%) aligned concordantly >1 times 66.39% overall alignment rate 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1678353 (33.59%) aligned concordantly 0 times 1199076 (24.00%) aligned concordantly exactly 1 time 2119188 (42.41%) aligned concordantly >1 times 66.41% overall alignment rate Processed 4996617 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4996617 Number of paired-end alignments with a unique best hit: 2897067 Mapping efficiency: 58.0% Sequence pairs with no alignments under any condition: 516128 Sequence pairs did not map uniquely: 1583422 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1448940 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1448127 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127612982 Total methylated C's in CpG context: 3244189 Total methylated C's in CHG context: 160121 Total methylated C's in CHH context: 709798 Total methylated C's in Unknown context: 16117 Total unmethylated C's in CpG context: 12519786 Total unmethylated C's in CHG context: 21637134 Total unmethylated C's in CHH context: 89341954 Total unmethylated C's in Unknown context: 112762 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.5% 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1681001 (33.64%) aligned concordantly 0 times 1199581 (24.01%) aligned concordantly exactly 1 time 2116035 (42.35%) aligned concordantly >1 times 66.36% overall alignment rate 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1679666 (33.62%) aligned concordantly 0 times 1200477 (24.03%) aligned concordantly exactly 1 time 2116474 (42.36%) aligned concordantly >1 times 66.38% overall alignment rate Processed 4996617 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4996617 Number of paired-end alignments with a unique best hit: 2897914 Mapping efficiency: 58.0% Sequence pairs with no alignments under any condition: 516052 Sequence pairs did not map uniquely: 1582651 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1450624 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1447290 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127683537 Total methylated C's in CpG context: 3257881 Total methylated C's in CHG context: 160012 Total methylated C's in CHH context: 712188 Total methylated C's in Unknown context: 15850 Total unmethylated C's in CpG context: 12521631 Total unmethylated C's in CHG context: 21660605 Total unmethylated C's in CHH context: 89371220 Total unmethylated C's in Unknown context: 113145 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.3% 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1679767 (33.62%) aligned concordantly 0 times 1200688 (24.03%) aligned concordantly exactly 1 time 2116162 (42.35%) aligned concordantly >1 times 66.38% overall alignment rate 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1679926 (33.62%) aligned concordantly 0 times 1200032 (24.02%) aligned concordantly exactly 1 time 2116659 (42.36%) aligned concordantly >1 times 66.38% overall alignment rate Processed 4996617 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4996617 Number of paired-end alignments with a unique best hit: 2897436 Mapping efficiency: 58.0% Sequence pairs with no alignments under any condition: 516658 Sequence pairs did not map uniquely: 1582523 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1449950 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1447486 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127619130 Total methylated C's in CpG context: 3249769 Total methylated C's in CHG context: 160403 Total methylated C's in CHH context: 711530 Total methylated C's in Unknown context: 15964 Total unmethylated C's in CpG context: 12523276 Total unmethylated C's in CHG context: 21650596 Total unmethylated C's in CHH context: 89323556 Total unmethylated C's in Unknown context: 113668 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.3% 4996618 reads; of these: 4996618 (100.00%) were paired; of these: 1678214 (33.59%) aligned concordantly 0 times 1199065 (24.00%) aligned concordantly exactly 1 time 2119339 (42.42%) aligned concordantly >1 times 66.41% overall alignment rate 4996618 reads; of these: 4996618 (100.00%) were paired; of these: 1679237 (33.61%) aligned concordantly 0 times 1199531 (24.01%) aligned concordantly exactly 1 time 2117850 (42.39%) aligned concordantly >1 times 66.39% overall alignment rate Processed 4996618 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4996618 Number of paired-end alignments with a unique best hit: 2896294 Mapping efficiency: 58.0% Sequence pairs with no alignments under any condition: 516221 Sequence pairs did not map uniquely: 1584103 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1449113 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1447181 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127612672 Total methylated C's in CpG context: 3248858 Total methylated C's in CHG context: 160334 Total methylated C's in CHH context: 710928 Total methylated C's in Unknown context: 15874 Total unmethylated C's in CpG context: 12522230 Total unmethylated C's in CHG context: 21637814 Total unmethylated C's in CHH context: 89332508 Total unmethylated C's in Unknown context: 113583 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.3% 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1680074 (33.62%) aligned concordantly 0 times 1198319 (23.98%) aligned concordantly exactly 1 time 2118224 (42.39%) aligned concordantly >1 times 66.38% overall alignment rate 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1678259 (33.59%) aligned concordantly 0 times 1199741 (24.01%) aligned concordantly exactly 1 time 2118617 (42.40%) aligned concordantly >1 times 66.41% overall alignment rate Processed 4996617 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4996617 Number of paired-end alignments with a unique best hit: 2897522 Mapping efficiency: 58.0% Sequence pairs with no alignments under any condition: 515780 Sequence pairs did not map uniquely: 1583315 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1451121 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1446400 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127655616 Total methylated C's in CpG context: 3253870 Total methylated C's in CHG context: 159713 Total methylated C's in CHH context: 711113 Total methylated C's in Unknown context: 16193 Total unmethylated C's in CpG context: 12524032 Total unmethylated C's in CHG context: 21656816 Total unmethylated C's in CHH context: 89350072 Total unmethylated C's in Unknown context: 113691 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.5% 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1679360 (33.61%) aligned concordantly 0 times 1198261 (23.98%) aligned concordantly exactly 1 time 2118996 (42.41%) aligned concordantly >1 times 66.39% overall alignment rate 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1678882 (33.60%) aligned concordantly 0 times 1197764 (23.97%) aligned concordantly exactly 1 time 2119971 (42.43%) aligned concordantly >1 times 66.40% overall alignment rate Processed 4996617 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4996617 Number of paired-end alignments with a unique best hit: 2895848 Mapping efficiency: 58.0% Sequence pairs with no alignments under any condition: 516478 Sequence pairs did not map uniquely: 1584291 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1448848 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1447000 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127520997 Total methylated C's in CpG context: 3245435 Total methylated C's in CHG context: 159990 Total methylated C's in CHH context: 711187 Total methylated C's in Unknown context: 15997 Total unmethylated C's in CpG context: 12519336 Total unmethylated C's in CHG context: 21632175 Total unmethylated C's in CHH context: 89252874 Total unmethylated C's in Unknown context: 113069 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.4% Now waiting for all child processes to complete 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1680182 (33.63%) aligned concordantly 0 times 1198529 (23.99%) aligned concordantly exactly 1 time 2117906 (42.39%) aligned concordantly >1 times 66.37% overall alignment rate 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1680813 (33.64%) aligned concordantly 0 times 1198218 (23.98%) aligned concordantly exactly 1 time 2117586 (42.38%) aligned concordantly >1 times 66.36% overall alignment rate Processed 4996617 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4996617 Number of paired-end alignments with a unique best hit: 2896773 Mapping efficiency: 58.0% Sequence pairs with no alignments under any condition: 516816 Sequence pairs did not map uniquely: 1583028 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1449594 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1447179 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127588827 Total methylated C's in CpG context: 3241841 Total methylated C's in CHG context: 160055 Total methylated C's in CHH context: 709475 Total methylated C's in Unknown context: 16096 Total unmethylated C's in CpG context: 12528761 Total unmethylated C's in CHG context: 21639021 Total unmethylated C's in CHH context: 89309674 Total unmethylated C's in Unknown context: 113762 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.4% 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1678513 (33.59%) aligned concordantly 0 times 1199503 (24.01%) aligned concordantly exactly 1 time 2118601 (42.40%) aligned concordantly >1 times 66.41% overall alignment rate 4996617 reads; of these: 4996617 (100.00%) were paired; of these: 1681745 (33.66%) aligned concordantly 0 times 1198270 (23.98%) aligned concordantly exactly 1 time 2116602 (42.36%) aligned concordantly >1 times 66.34% overall alignment rate Processed 4996617 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4996617 Number of paired-end alignments with a unique best hit: 2899003 Mapping efficiency: 58.0% Sequence pairs with no alignments under any condition: 515808 Sequence pairs did not map uniquely: 1581806 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1449873 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1449130 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127733035 Total methylated C's in CpG context: 3252165 Total methylated C's in CHG context: 159457 Total methylated C's in CHH context: 712567 Total methylated C's in Unknown context: 16111 Total unmethylated C's in CpG context: 12545641 Total unmethylated C's in CHG context: 21663811 Total unmethylated C's in CHH context: 89399394 Total unmethylated C's in Unknown context: 114206 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.4% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 19986468. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.1 /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.1 /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.2 /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.2 /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.3 /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.3 /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.4 /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.4 /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.5 /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.5 /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.6 /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.6 /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.7 /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.7 /tmp/13-wgbs-Rio4-1208184/Rio4_R1.fq.gz.temp.8 /tmp/13-wgbs-Rio4-1208184/Rio4_R2.fq.gz.temp.8 Now merging BAM files Rio4_R1.fq.gz.temp.1_bismark_bt2_pe.bam Rio4_R1.fq.gz.temp.2_bismark_bt2_pe.bam Rio4_R1.fq.gz.temp.3_bismark_bt2_pe.bam Rio4_R1.fq.gz.temp.4_bismark_bt2_pe.bam Rio4_R1.fq.gz.temp.5_bismark_bt2_pe.bam Rio4_R1.fq.gz.temp.6_bismark_bt2_pe.bam Rio4_R1.fq.gz.temp.7_bismark_bt2_pe.bam Rio4_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Rio4_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Rio4_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Rio4_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Rio4_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Rio4_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Rio4_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Rio4_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Rio4_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Rio4_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1_bismark_bt2_PE_report.txt Now merging temporary reports Rio4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Rio4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Rio4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Rio4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Rio4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Rio4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Rio4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Rio4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Rio4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 39972937 Number of paired-end alignments with a unique best hit: 23177857 Mapping efficiency: 58.0% Sequence pairs with no alignments under any condition: 4129941 Sequence pairs did not map uniquely: 12665139 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 11598063 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 11579793 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1021026796 Total methylated C's in CpG context: 25994008 Total methylated C's in CHG context: 1280085 Total methylated C's in CHH context: 5688786 Total methylated C's in Unknown context: 128202 Total unmethylated C's in CpG context: 100204693 Total unmethylated C's in CHG context: 173177972 Total unmethylated C's in CHH context: 714681252 Total unmethylated C's in Unknown context: 907886 C methylated in CpG context: 20.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.4% Deleting temporary report files... Rio4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 55m 40s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Rio4_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Rio4_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Rio4_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Rio4_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Rio4_pe.bam: 23177856 Total number duplicated alignments removed: 1160519 (5.01%) Duplicated alignments were found at: 1107100 different position(s) Total count of deduplicated leftover sequences: 22017337 (94.99% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Rio4_R1.fq.gz -2 output/13-wgbs/trimmed/Rio4_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio4-1208184 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Rio4_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Rio4_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Rio4_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio4_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio4_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Rio4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio4_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Rio4_R1.fq.gz -2 output/13-wgbs/trimmed/Rio4_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio4-1208184 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio4_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Rio4_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Rio4_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 22000000 Finished processing child process. Exiting.. Processed lines: 22000000 Finished processing child process. Exiting.. Processed lines: 22000000 Processed lines: 22000000 Now waiting for all child processes to complete Finished processing child process. Exiting.. Processed lines: 22000000 Finished processing child process. Exiting.. Processed lines: 22000000 Finished processing child process. Exiting.. Processed lines: 22000000 Finished processing child process. Exiting.. Processed lines: 22000000 Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.8 Processed 22017337 lines in total Total number of methylation call strings processed: 44034674 Final Cytosine Methylation Report ================================= Total number of C's analysed: 743967875 Total methylated C's in CpG context: 18882208 Total methylated C's in CHG context: 826268 Total methylated C's in CHH context: 3697250 Total C to T conversions in CpG context: 73142403 Total C to T conversions in CHG context: 126206915 Total C to T conversions in CHH context: 521212831 C methylated in CpG context: 20.5% C methylated in non-CpG context: 0.7% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio4_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio4_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio4_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio4_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio4_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Rio4_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio4_pe.deduplicated.txt.gz Writing bedGraph to file: Rio4_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Rio4_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Rio4_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Rio4_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio4_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Rio4_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Rio4.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Rio4.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1440092 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1821813 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3179343 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 3070923 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 3040436 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2686645 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2941479 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1448087 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2845603 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2786265 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Rio4.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Rio4.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Rio4_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Processed 41500000 lines Processed 42000000 lines Processed 42500000 lines Processed 43000000 lines Processed 43500000 lines Processed 44000000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Rio4_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1894884749 34.56 378413849 32.06 5.007 C 870237807 15.87 211781786 17.94 4.109 G 970874593 17.71 211810957 17.95 4.584 T 1746351566 31.85 378309330 32.05 4.616 AA 696224118 12.79 128492079 10.89 5.418 AC 297607021 5.47 68264877 5.78 4.360 AG 302771058 5.56 62424886 5.29 4.850 AT 585281802 10.75 119230832 10.10 4.909 CA 358695361 6.59 80836853 6.85 4.437 CC 150583552 2.77 42358709 3.59 3.555 CG 106898193 1.96 26104181 2.21 4.095 CT 247326285 4.54 62481783 5.29 3.958 GA 333377059 6.12 67679435 5.73 4.926 GC 141428676 2.60 33452245 2.83 4.228 GG 177487989 3.26 42378301 3.59 4.188 GT 311461332 5.72 68300800 5.79 4.560 TA 492767413 9.05 101400983 8.59 4.860 TC 274310503 5.04 67705770 5.74 4.052 TG 376743857 6.92 80903356 6.85 4.657 TT 590107171 10.84 128294772 10.87 4.600 [Fri Oct 9 17:17:30 PDT 2026] Rio4 done