[Fri Oct 9 15:00:43 PDT 2026] Rio3 (Rio/Rio_Pudeto) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 33380360 total bases: 5040434360 Q20 bases: 4978714428(98.7755%) Q30 bases: 4810722503(95.4426%) Q40 bases: 4810722503(95.4426%) Read2 before filtering: total reads: 33380360 total bases: 5040434360 Q20 bases: 4968891911(98.5806%) Q30 bases: 4800151010(95.2329%) Q40 bases: 4800151010(95.2329%) Read1 after filtering: total reads: 32773197 total bases: 4516123672 Q20 bases: 4476837799(99.1301%) Q30 bases: 4349633152(96.3134%) Q40 bases: 4349633152(96.3134%) Read2 after filtering: total reads: 32773197 total bases: 4518031814 Q20 bases: 4475741533(99.064%) Q30 bases: 4347639525(96.2286%) Q40 bases: 4347639525(96.2286%) Filtering result: reads passed filter: 65546394 reads failed due to low quality: 506754 reads failed due to too many N: 1136 reads failed due to too short: 706436 reads with adapter trimmed: 9542459 bases trimmed due to adapters: 196520334 Duplication rate: 3.91718% Insert size peak (evaluated by paired-end reads): 184 JSON report: output/13-wgbs/fastp/Rio3.fastp.json HTML report: output/13-wgbs/fastp/Rio3.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP3 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP3 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Rio3_R1.fq.gz -O output/13-wgbs/trimmed/Rio3_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Rio3.fastp.json --html output/13-wgbs/fastp/Rio3.fastp.html fastp v1.0.1, time used: 64 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Rio3_R1.fq.gz output/13-wgbs/trimmed/Rio3_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Rio3-1197284 Temporary files will be written into the directory: /tmp/13-wgbs-Rio3-1197284/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio3_R1.fq.gz and output/13-wgbs/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio3_R1.fq.gz and output/13-wgbs/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio3_R1.fq.gz and output/13-wgbs/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio3_R1.fq.gz and output/13-wgbs/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio3_R1.fq.gz and output/13-wgbs/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio3_R1.fq.gz and output/13-wgbs/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio3_R1.fq.gz and output/13-wgbs/trimmed/Rio3_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio3_R1.fq.gz and output/13-wgbs/trimmed/Rio3_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4096650) Finished subdividing output/13-wgbs/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio3_R1.fq.gz<) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio3_R1.fq.gz for PID: 1198191 and offset 8 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.6 to /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.4 to /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio3_R2.fq.gz for PID: 1198191 and offset 8 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.8 to /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.7 to /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.1 to /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.2 to /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.3 to /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.3_C_to_T.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.6 (4096649 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.6 to /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.4 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.4 to /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.8 (4096649 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.8 to /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.7 (4096649 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.7 to /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.1 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.1 to /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.2 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.2 to /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.3 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.3 to /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.3_G_to_A.fastq Finished subdividing output/13-wgbs/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.5 to /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.5_C_to_T.fastq Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.6 (4096649 sequences in total) Input files are Rio3_R1.fq.gz.temp.6_C_to_T.fastq and Rio3_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.8 (4096649 sequences in total) Input files are Rio3_R1.fq.gz.temp.8_C_to_T.fastq and Rio3_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.7 (4096649 sequences in total) Input files are Rio3_R1.fq.gz.temp.7_C_to_T.fastq and Rio3_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.4 (4096650 sequences in total) Input files are Rio3_R1.fq.gz.temp.4_C_to_T.fastq and Rio3_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.1 (4096650 sequences in total) Input files are Rio3_R1.fq.gz.temp.1_C_to_T.fastq and Rio3_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.2 (4096650 sequences in total) Input files are Rio3_R1.fq.gz.temp.2_C_to_T.fastq and Rio3_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.3 (4096650 sequences in total) Input files are Rio3_R1.fq.gz.temp.3_C_to_T.fastq and Rio3_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:50260:1042_1:N:0:AGCGGCAA+GTGATGTA/1 99 Chromosome_4A_CT_converted 22313857 42 141M = 22313885 169 TTTAAATTTTAATTGTTATATTTTATTGATAAAAAAATAGATAATATTAGATTATATGAAATATTTTTAGATTAAATAATTTAAAATATATTTAAATAATTGTTAAGAAATGTTTGTTTATTTGGAATTAGAAAAATTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:50260:1042_2:N:0:AGCGGCAA+GTGATGTA/2 147 Chromosome_4A_CT_converted 22313885 42 141M = 22313857 -169 ATAAAAAAATAGATAATATTAGATTATATGAAATATTTTTAGATTAAATAATTTAAAATATATTTAAATAATTGTTAAGAAATGTTTGTTTATTTGGAATTAGAAAAATTTTAGAAAAAAAGTATTTTAGATAATTTATTA IIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:32494:1042_1:N:0:AGCGGCAA+GNGATGTA/1 99 Chromosome_10A_CT_converted 3321452 6 141M = 3321325 -268 ATGATGAAGTTTGGATATATGATGAAGTTTGGTTATATAATGAAGTTTGGATATATGATGAAGTTTGATTATATGATGAAGTTTGATTATATAATGAAGTTTGATTATAGGATGAAGTTTGATTATATGATGAAGTTTGGA I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIII9IIIIII AS:i:-18 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:2A99A6T31 YS:i:-35 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:32494:1042_2:N:0:AGCGGCAA+GNGATGTA/2 147 Chromosome_10A_CT_converted 3321325 6 32M2D109M = 3321452 268 TAATGAAGTTTGGTTATATAATGAAGTTTGGTTATATGATGAAGTTTGATTATATGATGAAGTTTGATTATATGATGAAGTTTGGTTATATAATGAAGTTTGATTATGTAATGAAGTTTGGTTATATAATGAAGTTTGGAT IIIIIIII99IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-35 XS:i:-48 XN:i:0 XM:i:4 XO:i:1 XG:i:2 NM:i:6 MD:Z:19G12^TA16G35A22A33 YS:i:-18 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:25424:1042_1:N:0:AGCGGCAA+GNGATGTA/1 77 * 0 0 * * 0 0 AGGTGGAAAATAAATTATGTTTTTTTTTATGTGTATGAATGTTTTTGATATAAAAAATAAATATTTAAAGTGATATTATTGTGAAGAGAAAATTTTTTAAAAATTTGATTTAGGGGTTATAAATTTTATAATTGGTAGTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:25424:1042_2:N:0:AGCGGCAA+GNGATGTA/2 141 * 0 0 * * 0 0 AAAAAAAAACTACCAATTATAAAATTTATAACCCCTAAATCAAATTTTTAAAAAATTTTCTCTTCACAATAATATCACTTTAAATATTTATTTTTTATATCAAAAACATTCATACACATAAAAAAAAACATAATTTATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:30763:1042_1:N:0:AGCGGCAA+GNGATGTA/1 99 Chromosome_9B_CT_converted 33170282 42 141M = 33170340 199 TTATTTGGTTATTTTTTTTGATAAAATGAATTGTTTTGTGTAAATAATTTTTAAAATTTATGTGGTTAAGGTATTATGGGTTAGGAAAATGATTGTGTATTATATTATGTATGTTTATTGATGATGGTGTATATAAAGGAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:30763:1042_2:N:0:AGCGGCAA+GNGATGTA/2 147 Chromosome_9B_CT_converted 33170340 42 141M = 33170282 -199 TATGTGGTTAAGGTATTATGGGTTAGGAAAATGATTGTGTATTATATTATGTATGTTTATTGATGATGGTGTATATAAAGGAGGGAGGGGGGGGGAGGTTTAGTGTGTTATTAAAAGATTTATTTATTTATGTTTTAAGGA IIIIIIIIIIIIIIIIIIIIIII*IIIIII9IIIIIIIII9I99I9I**9II99II9I9**I99I999I9IIIII99I9I99I9*99**9I*9**9**IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:48383:1042_1:N:0:AGCGGCAA+GTGATGTA/1 99 Chromosome_5B_CT_converted 29788806 0 103M8I6M = 29788796 -119 ATTTTTTAATATAAAGAAATTTAAATTTGGTGTTAATGTAAATGATTGGTGTGATTTTGTAAAATTGATTTTTGATATTATTGTTGTGAATTATGTGGTATAATTTTTTTTTTTTTT II9IIII9III99IIIII9IIIIIII9IIIIIII9I9IIII9III*99IIIII9I*II*I9IIIIIIII99III*I9I9I**99*I9*999I9999I9I9I9*I99I**III*9I99 AS:i:-53 XS:i:-70 XN:i:0 XM:i:4 XO:i:1 XG:i:8 NM:i:12 MD:Z:80A22A1A1A1 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:48383:1042_2:N:0:AGCGGCAA+GTGATGTA/2 147 Chromosome_5B_CT_converted 29788796 0 117M = 29788806 119 AAGATAAGGAATTTTTTAATATAAAGAAATTTAAATTTGGTGTTAATGTAAATGATTGGTGTGATTTTGTAAAATTGATTTTTGATATTAATGTTGTGAATTATGTGGTATAATTTT II99IIIIIIIIII9IIIIII999IIIIIIIIII*99IIIIII99*IIIIIIIIIIIII999I9II9I9I99*99III9I9II9II*9II*II**III9IIII9*9II9**II9*** AS:i:-12 XS:i:-29 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:113A1A1 YS:i:-53 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:32559:1042_1:N:0:AGCGGCAA+GNGATGTA/1 77 * 0 0 * * 0 0 TGTTTTTTTTTTTATTTATGTGGATTTAGTTGTAGGATAGTTGAAAAATTGTTTAAGTGGTTATAAATAATAGATAATTAATTAATTTTTTTTTTGTTGTTTTAAAATATATTTGTGTGTTGTAGTTTAAAAGATTGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIII9IIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:32559:1042_2:N:0:AGCGGCAA+GNGATGTA/2 141 * 0 0 * * 0 0 TAATAAATATATCATAAATATTAATAAATTCATACAAAACATAAATTTATTAAAAATACTCATATCTTAAAAAAATTAAAAACAATCTTTTAAACTACAACACACAAATATATTTTAAAACAACAAAAAAAAAATTAATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:42736:1042_1:N:0:AGCGGCAA+GTGATGTA/1 99 Chromosome_6B_CT_converted 115243095 1 141M = 115243211 257 TTATTTTGTAGAATATTGAATATATTTTTTTGTATGTAGAATGTGTATTGATATAGTAGTTTATATTTTTTAAAATTATTTTGATTATTTTTTTTTTTTAATTTTTTTAAAATTTTTGTTTTAAATTTAGTTATTGTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIII9I AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:42736:1042_2:N:0:AGCGGCAA+GTGATGTA/2 147 Chromosome_6B_CT_converted 115243211 1 141M = 115243095 -257 TGTTTTAAATTTAGTTATTGTTTATTATGTTAAGAAATTTTTAGTAAAATTGATAGTATAGAAAAATTGTTATAAATTAGTGATTGTAATTAAGAGATAAGTGATGGTTGTTATTAATTAGTATGTAAGGAGGTTTTATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:140G0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.5 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.5 to /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.5_G_to_A.fastq Found first alignment: LH00129:489:23JFWNLT4:8:1101:50260:1042_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 TTTAAATTTTAATTGTTATATTTTATTGATAAAAAAATAGATAATATTAGATTATATGAAATATTTTTAGATTAAATAATTTAAAATATATTTAAATAATTGTTAAGAAATGTTTGTTTATTTGGAATTAGAAAAATTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:50260:1042_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 TAATAAATTATCTAAAATACTTTTTTTCTAAAATTTTTCTAATTCCAAATAAACAAACATTTCTTAACAATTATTTAAATATATTTTAAATTATTTAATCTAAAAATATTTCATATAATCTAATATTATCTATTTTTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:25424:1042_1:N:0:AGCGGCAA+GNGATGTA/1 83 Chromosome_2A_GA_converted 73601428 40 3M3D138M = 73601425 -147 AAACTACCAATTATAAAATTTATAACCCCTAAATCAAATTTTTAAAAAATTTTCTCTTCACAATAATATCACTTTAAATATTTATTTTTTATATCAAAAACATTCATACACATAAAAAAAAACATAATTTATTTTCCACCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-14 XN:i:0 XM:i:0 XO:i:1 XG:i:3 NM:i:3 MD:Z:3^CTT138 YS:i:-24 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:25424:1042_2:N:0:AGCGGCAA+GNGATGTA/2 163 Chromosome_2A_GA_converted 73601425 40 141M = 73601428 147 AAAAAAAAACTACCAATTATAAAATTTATAACCCCTAAATCAAATTTTTAAAAAATTTTCTCTTCACAATAATATCACTTTAAATATTTATTTTTTATATCAAAAACATTCATACACATAAAAAAAAACATAATTTATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII AS:i:-24 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:0T5C0T0T132 YS:i:-14 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:32494:1042_1:N:0:AGCGGCAA+GNGATGTA/1 83 Chromosome_8B_GA_converted 95825713 0 141M = 95825712 -142 TCCAAACTTCATCATATAATCAAACTTCATCCTATAATCAAACTTCATTATATAATCAAACTTCATCATATAATCAAACTTCATCATATATCCAAACTTCATTATATAACCAAACTTCATCATATATCCAAACTTCATCAT IIIIII9IIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I AS:i:-48 XS:i:-60 XN:i:0 XM:i:8 XO:i:0 XG:i:0 NM:i:8 MD:Z:19C11A5C8T5A37A35A11T2 YS:i:-60 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:32494:1042_2:N:0:AGCGGCAA+GNGATGTA/2 163 Chromosome_8B_GA_converted 95825712 0 141M = 95825713 142 ATCCAAACTTCATTATATAACCAAACTTCATTACATAATCAAACTTCATTATATAACCAAACTTCATCATATAATCAAACTTCATCATATAATCAAACTTCATCATATAACCAAACTTCATTATATAACCAAACTTCATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII99IIIIIIII AS:i:-60 XS:i:-60 XN:i:0 XM:i:10 XO:i:0 XG:i:0 NM:i:10 MD:Z:13C17C1T4C8T5A2T35C10T17C19 YS:i:-48 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:48383:1042_1:N:0:AGCGGCAA+GTGATGTA/1 83 Chromosome_7B_GA_converted 160344014 0 4M8I92M2I11M = 160344016 117 AAAAAAAAAAAAAATTATACCACATAATTCACAACAATAATATCAAAAATCAATTTTACAAAATCACACCAATCATTTACATTAACACCAAATTTAAATTTCTTTATATTAAAAAAT 99I9*III**I99I*9I9I9I9999I999*9I*99**I9I9I*III99IIIIIIII9I*II*I9IIIII99*III9IIII9I9IIIIIII9IIIIIII9IIIII99III9IIII9II AS:i:-70 XS:i:-70 XN:i:0 XM:i:5 XO:i:2 XG:i:10 NM:i:15 MD:Z:1T1T1T22T70C7 YS:i:-29 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:48383:1042_2:N:0:AGCGGCAA+GTGATGTA/2 163 Chromosome_7B_GA_converted 160344016 0 94M2I21M = 160344014 -117 AAAATTATACCACATAATTCACAACATTAATATCAAAAATCAATTTTACAAAATCACACCAATCATTTACATTAACACCAAATTTAAATTTCTTTATATTAAAAAATTCCTTATCTT ***9II**9II9*9IIII9III**II*II9*II9II9I9III99*99I9I9II9I999IIIIIIIIIIIII*99IIIIII99*IIIIIIIIII999IIIIII9IIIIIIIIII99II AS:i:-29 XS:i:-29 XN:i:0 XM:i:3 XO:i:1 XG:i:2 NM:i:5 MD:Z:1T1T93C17 YS:i:-70 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:30763:1042_1:N:0:AGCGGCAA+GNGATGTA/1 77 * 0 0 * * 0 0 TTATTTGGTTATTTTTTTTGATAAAATGAATTGTTTTGTGTAAATAATTTTTAAAATTTATGTGGTTAAGGTATTATGGGTTAGGAAAATGATTGTGTATTATATTATGTATGTTTATTGATGATGGTGTATATAAAGGAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:30763:1042_2:N:0:AGCGGCAA+GNGATGTA/2 141 * 0 0 * * 0 0 TCCTTAAAACATAAATAAATAAATCTTTTAATAACACACTAAACCTCCCCCCCCCTCCCTCCTTTATATACACCATCATCAATAAACATACATAATATAATACACAATCATTTTCCTAACCCATAATACCTTAACCACATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII**9**9*I9**99*9I99I9I99IIIII9I999I99I**9I9II99II9**I9I99I9IIIIIIIII9IIIIII*IIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:42736:1042_1:N:0:AGCGGCAA+GTGATGTA/1 83 Chromosome_6B_GA_converted 115331608 1 141M = 115331492 -257 ATAAACAATAACTAAATTTAAAACAAAAATTTTAAAAAAATTAAAAAAAAAAAATAATCAAAATAATTTTAAAAAATATAAACTACTATATCAATACACATTCTACATACAAAAAAATATATTCAATATTCTACAAAATAA I9IIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:42736:1042_2:N:0:AGCGGCAA+GTGATGTA/2 163 Chromosome_6B_GA_converted 115331492 1 141M = 115331608 257 AAATAAAACCTCCTTACATACTAATTAATAACAACCATCACTTATCTCTTAATTACAATCACTAATTTATAACAATTTTTCTATACTATCAATTTTACTAAAAATTTCTTAACATAATAAACAATAACTAAATTTAAAACA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:0C140 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:32559:1042_1:N:0:AGCGGCAA+GNGATGTA/1 83 Chromosome_1B_GA_converted 138367707 42 128M1I12M = 138367629 -218 AAAACAATCTTTTAAACTACAACACACAAATATATTTTAAAACAACAAAAAAAAAATTAATTAATTATCTATTATTTATAACCACTTAAACAATTTTTCAACTATCCTACAACTAAATCCACATAAATAAAAAAAAAAACA IIIIIIIIIIIIIIIIIII9IIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-8 XN:i:0 XM:i:0 XO:i:1 XG:i:1 NM:i:1 MD:Z:140 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:32559:1042_2:N:0:AGCGGCAA+GNGATGTA/2 163 Chromosome_1B_GA_converted 138367629 42 141M = 138367707 218 TAATAAATATATCATAAATATTAATAAATTCATACAAAACATAAATTTATTAAAAATACTCATATCTTAAAAAAATTAAAAACAATCTTTTAAACTACAACACACAAATATATTTTAAAACAACAAAAAAAAAATTAATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-8 YT:Z:CP >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.2 and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.3 and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.7 and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.8 and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.1 and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.6 and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.4 and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.4 Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.5 (4096650 sequences in total) Input files are Rio3_R1.fq.gz.temp.5_C_to_T.fastq and Rio3_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:34485:1042_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 GAGGTTAAGGAAGGGGATAAAGAAGAGTTTAATATTTTGTAGTAAGTTAAATAAAGATGGTATATTAGTGATAGAAAATGATATTATATTGGTGATGAGTGATTTTAATGGTAAGGTTGGTGTAGATAATAGAGATAGAGA 999IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I9III9IIIIIIIII999IIIIII9IIIIIII9IIIIIIIIII9IIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:34485:1042_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 TTATCATTCACCTCACCTATTCCATACATTCCCAATATCATATACTCTCTATCTCTATTATCTACACCAACCTTACCATTAAAATCACTCATCACCAATATAATATCATTTTCTATCACTAATATACCATCTTTATTTAAC II9*I9I9IIII9I9IIIIII99I9II*I99III9*I9*99*I9*II99I9*9999*99*9I9*999II9I9*IIIIIII*I9III*9IIIIII99I9III99I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:34485:1042_1:N:0:AGCGGCAA+GTGATGTA/1 83 Chromosome_1B_GA_converted 53464484 42 141M = 53464439 -186 TCTCTATCTCTATTATCTACACCAACCTTACCATTAAAATCACTCATCACCAATATAATATCATTTTCTATCACTAATATACCATCTTTATTTAACTTACTACAAAATATTAAACTCTTCTTTATCCCCTTCCTTAACCTC IIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII9IIIIIIIIII9IIIIIII9IIIIII999IIIIIIIII9III9I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII999 AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:19T49T71 YS:i:-18 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:34485:1042_2:N:0:AGCGGCAA+GTGATGTA/2 163 Chromosome_1B_GA_converted 53464439 42 141M = 53464484 186 TTATCATTCACCTCACCTATTCCATACATTCCCAATATCATATACTCTCTATCTCTATTATCTACACCAACCTTACCATTAAAATCACTCATCACCAATATAATATCATTTTCTATCACTAATATACCATCTTTATTTAAC II9*I9I9IIII9I9IIIIII99I9II*I99III9*I9*99*I9*II99I9*9999*99*9I9*999II9I9*IIIIIII*I9III*9IIIIII99I9III99I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-18 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:27C36T49T26 YS:i:-12 YT:Z:CP >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.5 and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.5 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2128:6752:23322_1:N:0:AGCGGCAA+GTGATGTA Chromosome_6A 76092827 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1346557 (32.87%) aligned concordantly 0 times 964397 (23.54%) aligned concordantly exactly 1 time 1785695 (43.59%) aligned concordantly >1 times 67.13% overall alignment rate 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1344845 (32.83%) aligned concordantly 0 times 964914 (23.55%) aligned concordantly exactly 1 time 1786890 (43.62%) aligned concordantly >1 times 67.17% overall alignment rate Processed 4096649 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096649 Number of paired-end alignments with a unique best hit: 2365151 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 404108 Sequence pairs did not map uniquely: 1327390 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1184659 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1180492 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101655586 Total methylated C's in CpG context: 2647084 Total methylated C's in CHG context: 132875 Total methylated C's in CHH context: 592712 Total methylated C's in Unknown context: 13790 Total unmethylated C's in CpG context: 9869988 Total unmethylated C's in CHG context: 17360973 Total unmethylated C's in CHH context: 71051954 Total unmethylated C's in Unknown context: 92360 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.0% Processed 4000000 sequence pairs so far 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1347623 (32.90%) aligned concordantly 0 times 963330 (23.52%) aligned concordantly exactly 1 time 1785696 (43.59%) aligned concordantly >1 times 67.10% overall alignment rate 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1346322 (32.86%) aligned concordantly 0 times 965357 (23.56%) aligned concordantly exactly 1 time 1784970 (43.57%) aligned concordantly >1 times 67.14% overall alignment rate Processed 4096649 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096649 Number of paired-end alignments with a unique best hit: 2363553 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 404437 Sequence pairs did not map uniquely: 1328659 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1184093 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1179460 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101577677 Total methylated C's in CpG context: 2642878 Total methylated C's in CHG context: 132550 Total methylated C's in CHH context: 590030 Total methylated C's in Unknown context: 13709 Total unmethylated C's in CpG context: 9873991 Total unmethylated C's in CHG context: 17345045 Total unmethylated C's in CHH context: 70993183 Total unmethylated C's in Unknown context: 91507 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.0% Now waiting for all child processes to complete Processed 4000000 sequence pairs so far 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1347873 (32.90%) aligned concordantly 0 times 963139 (23.51%) aligned concordantly exactly 1 time 1785638 (43.59%) aligned concordantly >1 times 67.10% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1346746 (32.87%) aligned concordantly 0 times 963614 (23.52%) aligned concordantly exactly 1 time 1786290 (43.60%) aligned concordantly >1 times 67.13% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2361062 Mapping efficiency: 57.6% Sequence pairs with no alignments under any condition: 405358 Sequence pairs did not map uniquely: 1330230 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1182478 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1178584 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101544068 Total methylated C's in CpG context: 2643470 Total methylated C's in CHG context: 132370 Total methylated C's in CHH context: 590981 Total methylated C's in Unknown context: 13859 Total unmethylated C's in CpG context: 9862095 Total unmethylated C's in CHG context: 17344288 Total unmethylated C's in CHH context: 70970864 Total unmethylated C's in Unknown context: 92155 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1349065 (32.93%) aligned concordantly 0 times 963401 (23.52%) aligned concordantly exactly 1 time 1784183 (43.55%) aligned concordantly >1 times 67.07% overall alignment rate 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1344129 (32.81%) aligned concordantly 0 times 967336 (23.61%) aligned concordantly exactly 1 time 1785184 (43.58%) aligned concordantly >1 times 67.19% overall alignment rate Processed 4096649 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096649 Number of paired-end alignments with a unique best hit: 2362351 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 404197 Sequence pairs did not map uniquely: 1330101 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1185191 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1177159 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101592971 Total methylated C's in CpG context: 2638179 Total methylated C's in CHG context: 132502 Total methylated C's in CHH context: 590526 Total methylated C's in Unknown context: 13660 Total unmethylated C's in CpG context: 9877162 Total unmethylated C's in CHG context: 17351866 Total unmethylated C's in CHH context: 71002736 Total unmethylated C's in Unknown context: 92039 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1347693 (32.90%) aligned concordantly 0 times 964262 (23.54%) aligned concordantly exactly 1 time 1784695 (43.56%) aligned concordantly >1 times 67.10% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1345247 (32.84%) aligned concordantly 0 times 965575 (23.57%) aligned concordantly exactly 1 time 1785828 (43.59%) aligned concordantly >1 times 67.16% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2361446 Mapping efficiency: 57.6% Sequence pairs with no alignments under any condition: 404990 Sequence pairs did not map uniquely: 1330214 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1182186 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1179260 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101499625 Total methylated C's in CpG context: 2640214 Total methylated C's in CHG context: 132478 Total methylated C's in CHH context: 590286 Total methylated C's in Unknown context: 14021 Total unmethylated C's in CpG context: 9865252 Total unmethylated C's in CHG context: 17342472 Total unmethylated C's in CHH context: 70928923 Total unmethylated C's in Unknown context: 92140 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.2% 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1345807 (32.85%) aligned concordantly 0 times 964246 (23.54%) aligned concordantly exactly 1 time 1786597 (43.61%) aligned concordantly >1 times 67.15% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1345494 (32.84%) aligned concordantly 0 times 963737 (23.53%) aligned concordantly exactly 1 time 1787419 (43.63%) aligned concordantly >1 times 67.16% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2362612 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 403475 Sequence pairs did not map uniquely: 1330563 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1181747 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1180865 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101587055 Total methylated C's in CpG context: 2647566 Total methylated C's in CHG context: 132703 Total methylated C's in CHH context: 590858 Total methylated C's in Unknown context: 13592 Total unmethylated C's in CpG context: 9865506 Total unmethylated C's in CHG context: 17356327 Total unmethylated C's in CHH context: 70994095 Total unmethylated C's in Unknown context: 90948 C methylated in CpG context: 21.2% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.0% Processed 4000000 sequence pairs so far 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1348559 (32.92%) aligned concordantly 0 times 962708 (23.50%) aligned concordantly exactly 1 time 1785383 (43.58%) aligned concordantly >1 times 67.08% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1345974 (32.86%) aligned concordantly 0 times 964500 (23.54%) aligned concordantly exactly 1 time 1786176 (43.60%) aligned concordantly >1 times 67.14% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2362220 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 405494 Sequence pairs did not map uniquely: 1328936 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1183476 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1178744 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101575953 Total methylated C's in CpG context: 2645694 Total methylated C's in CHG context: 131822 Total methylated C's in CHH context: 590652 Total methylated C's in Unknown context: 13859 Total unmethylated C's in CpG context: 9864608 Total unmethylated C's in CHG context: 17346883 Total unmethylated C's in CHH context: 70996294 Total unmethylated C's in Unknown context: 91996 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% Processed 4000000 sequence pairs so far 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1347355 (32.89%) aligned concordantly 0 times 963165 (23.51%) aligned concordantly exactly 1 time 1786130 (43.60%) aligned concordantly >1 times 67.11% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1345343 (32.84%) aligned concordantly 0 times 964294 (23.54%) aligned concordantly exactly 1 time 1787013 (43.62%) aligned concordantly >1 times 67.16% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2361564 Mapping efficiency: 57.6% Sequence pairs with no alignments under any condition: 404510 Sequence pairs did not map uniquely: 1330576 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1182335 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1179229 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101513762 Total methylated C's in CpG context: 2635559 Total methylated C's in CHG context: 132819 Total methylated C's in CHH context: 589877 Total methylated C's in Unknown context: 13797 Total unmethylated C's in CpG context: 9865016 Total unmethylated C's in CHG context: 17345538 Total unmethylated C's in CHH context: 70944953 Total unmethylated C's in Unknown context: 91653 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 16386596. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.1 /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.1 /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.2 /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.2 /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.3 /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.3 /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.4 /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.4 /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.5 /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.5 /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.6 /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.6 /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.7 /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.7 /tmp/13-wgbs-Rio3-1197284/Rio3_R1.fq.gz.temp.8 /tmp/13-wgbs-Rio3-1197284/Rio3_R2.fq.gz.temp.8 Now merging BAM files Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.2_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.3_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.4_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.5_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.6_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.7_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Rio3_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1_bismark_bt2_PE_report.txt Now merging temporary reports Rio3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Rio3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 32773197 Number of paired-end alignments with a unique best hit: 18899959 Mapping efficiency: 57.7% Sequence pairs with no alignments under any condition: 3236569 Sequence pairs did not map uniquely: 10636669 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 9466165 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 9433793 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 812546697 Total methylated C's in CpG context: 21140644 Total methylated C's in CHG context: 1060119 Total methylated C's in CHH context: 4725922 Total methylated C's in Unknown context: 110287 Total unmethylated C's in CpG context: 78943618 Total unmethylated C's in CHG context: 138793392 Total unmethylated C's in CHH context: 567883002 Total unmethylated C's in Unknown context: 734798 C methylated in CpG context: 21.1% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.1% Deleting temporary report files... Rio3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 46m 2s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Rio3_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Rio3_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Rio3_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Rio3_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Rio3_pe.bam: 18899958 Total number duplicated alignments removed: 911279 (4.82%) Duplicated alignments were found at: 868882 different position(s) Total count of deduplicated leftover sequences: 17988679 (95.18% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Rio3_R1.fq.gz -2 output/13-wgbs/trimmed/Rio3_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio3-1197284 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Rio3_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Rio3_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Rio3_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio3_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio3_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio3_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Rio3_R1.fq.gz -2 output/13-wgbs/trimmed/Rio3_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio3-1197284 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Rio3_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Rio3_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Processed lines: 17500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.8 Processed 17988679 lines in total Total number of methylation call strings processed: 35977358 Final Cytosine Methylation Report ================================= Total number of C's analysed: 574283093 Total methylated C's in CpG context: 14921059 Total methylated C's in CHG context: 702581 Total methylated C's in CHH context: 3153569 Total C to T conversions in CpG context: 55813274 Total C to T conversions in CHG context: 98062004 Total C to T conversions in CHH context: 401630606 C methylated in CpG context: 21.1% C methylated in non-CpG context: 0.8% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio3_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio3_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio3_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio3_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio3_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Rio3_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio3_pe.deduplicated.txt.gz Writing bedGraph to file: Rio3_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Rio3_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Rio3_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Rio3_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Rio3_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Rio3.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Rio3.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1289469 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1547781 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 2913420 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2760429 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2701036 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2445604 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2678917 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1362603 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2636500 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2506958 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Rio3.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Rio3.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Rio3_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Rio3_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1552793255 34.87 378413849 32.06 4.103 C 692334333 15.55 211781786 17.94 3.269 G 790613100 17.76 211810957 17.95 3.733 T 1417104824 31.82 378309330 32.05 3.746 AA 574682254 13.00 128492079 10.89 4.473 AC 239460017 5.42 68264877 5.78 3.508 AG 249570050 5.65 62424886 5.29 3.998 AT 478479024 10.82 119230832 10.10 4.013 CA 288054842 6.52 80836853 6.85 3.563 CC 117487083 2.66 42358709 3.59 2.774 CG 84731804 1.92 26104181 2.21 3.246 CT 196692415 4.45 62481783 5.29 3.148 GA 274326602 6.21 67679435 5.73 4.053 GC 112432341 2.54 33452245 2.83 3.361 GG 142880245 3.23 42378301 3.59 3.372 GT 255083532 5.77 68300800 5.79 3.735 TA 404304667 9.15 101400983 8.59 3.987 TC 217929537 4.93 67705770 5.74 3.219 TG 307733769 6.96 80903356 6.85 3.804 TT 477002813 10.79 128294772 10.87 3.718 [Fri Oct 9 16:46:15 PDT 2026] Rio3 done