[Fri Oct 9 14:53:31 PDT 2026] Rio2 (Rio/Rio_Pudeto) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 36433770 total bases: 5501499270 Q20 bases: 5436463482(98.8179%) Q30 bases: 5258670935(95.5861%) Q40 bases: 5258670935(95.5861%) Read2 before filtering: total reads: 36433770 total bases: 5501499270 Q20 bases: 5427245772(98.6503%) Q30 bases: 5246298777(95.3613%) Q40 bases: 5246298777(95.3613%) Read1 after filtering: total reads: 35781535 total bases: 4947942645 Q20 bases: 4905852886(99.1493%) Q30 bases: 4771250759(96.429%) Q40 bases: 4771250759(96.429%) Read2 after filtering: total reads: 35781535 total bases: 4949716719 Q20 bases: 4903581030(99.0679%) Q30 bases: 4761300392(96.1934%) Q40 bases: 4761300392(96.1934%) Filtering result: reads passed filter: 71563070 reads failed due to low quality: 577296 reads failed due to too many N: 1314 reads failed due to too short: 725860 reads with adapter trimmed: 8016937 bases trimmed due to adapters: 177551387 Duplication rate: 5.11724% Insert size peak (evaluated by paired-end reads): 188 JSON report: output/13-wgbs/fastp/Rio2.fastp.json HTML report: output/13-wgbs/fastp/Rio2.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP2 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP2 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Rio2_R1.fq.gz -O output/13-wgbs/trimmed/Rio2_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Rio2.fastp.json --html output/13-wgbs/fastp/Rio2.fastp.html fastp v1.0.1, time used: 69 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Rio2_R1.fq.gz output/13-wgbs/trimmed/Rio2_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Rio2-1991069 Temporary files will be written into the directory: /tmp/13-wgbs-Rio2-1991069/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio2_R1.fq.gz and output/13-wgbs/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio2_R1.fq.gz and output/13-wgbs/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio2_R1.fq.gz and output/13-wgbs/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio2_R1.fq.gz and output/13-wgbs/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio2_R1.fq.gz and output/13-wgbs/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio2_R1.fq.gz and output/13-wgbs/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio2_R1.fq.gz and output/13-wgbs/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio2_R1.fq.gz and output/13-wgbs/trimmed/Rio2_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio2_R1.fq.gz for PID: 1992031 and offset 8 (sequences written out: 4472691) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.4 to /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.7 to /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.3 to /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Finished subdividing output/13-wgbs/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.6 to /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.6_C_to_T.fastq Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.5 to /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio2_R2.fq.gz for PID: 1992031 and offset 8 (sequences written out: 4472691) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.8 to /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.2 to /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.1 to /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.1_C_to_T.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.4 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.4 to /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.7 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.7 to /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.6 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.6 to /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.3 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.3 to /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.5 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.5 to /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.8 (4472691 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.8 to /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.2 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.2 to /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.1 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.1 to /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.1_G_to_A.fastq Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.4 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.4_C_to_T.fastq and Rio2_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.7 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.7_C_to_T.fastq and Rio2_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.3 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.3_C_to_T.fastq and Rio2_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.6 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.6_C_to_T.fastq and Rio2_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.5 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.5_C_to_T.fastq and Rio2_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.8 (4472691 sequences in total) Input files are Rio2_R1.fq.gz.temp.8_C_to_T.fastq and Rio2_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.2 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.2_C_to_T.fastq and Rio2_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.1 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.1_C_to_T.fastq and Rio2_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:29614:1042_1:N:0:GGCTATCG+TNTTAGTA/1 99 Chromosome_7B_CT_converted 12581618 12 141M = 12581738 261 GTTTTTTGAGTATGTTGAAATTGATGTTATTTGATGTTATTATTAATGGATTATGAAATGTTGTAATTAATATAGTTGTTAATATAGTTTTTTTTTTTTGTTTGTATATATAGTTTGTAAATAAAATTTTGTTATTGAAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9II**I*9*9*9*9III*I*I9**I9III9**I*I*9*99I* AS:i:-18 XS:i:-18 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:102A26A2A8 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29614:1042_2:N:0:GGCTATCG+TNTTAGTA/2 147 Chromosome_7B_CT_converted 12581738 12 141M = 12581618 -261 ATAAAATTTAGTAATTGAAATAGTAAATATATTTAATGATAGAAGTTAAGGAATATAAAATTTGAATAGTATTTTATTATTAGAGTTTTTGGTTATGATATATTGATTATGATATTGGAGGTTTGTATTTTGTTTATTAAG IIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-18 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-18 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:38530:1042_1:N:0:GGCTATCG+TCTTAGTA/1 99 Chromosome_5B_CT_converted 108555578 1 141M = 108555911 474 GAATGAGAATTTTTGATATAGTGTGATAGAATGAGAATTTTTGATATAGTGTGAATTTGGAATGATATTTATGTATATGTATATTTTATTTATGTTATGGTATAAAATAGAAAATAATTATGTTGTTGATTAGTTAATGAT 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:38530:1042_2:N:0:GGCTATCG+TCTTAGTA/2 147 Chromosome_5B_CT_converted 108555911 1 141M = 108555578 -474 AAAAAGTTGTTATGATTGATTTAATTGAATTTTATGTATGGTGTTTAAAGGGAGATAATTTTAGTTTTTATAGTGTGTGGGAAGAAGATGGAATTAGTATATATGTTGTTTGAGAGTTTGAGAGGGGTGAATTTGTTTTTT IIIIIIIII9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIII9IIIIIIIIIIII9IIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:138G2 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:44435:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 ATAAATTGTTTTGAATTTTAGATGAGTTGTAAATGATTTTTGTTTATAATTATTGTAATTAATAGTTTTTATGATTTTTGTTTGGTTTAGATAATTTTATAATTTAAGGATAGAGTAGGATAATAGTTAATGTAATAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:44435:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 AATACACTAAAATTAAAATATTCACTAATAAATATATTTATTACATTAACTATTATCCTACTCTATCCTTAAATTATAAAATTATCTAAACCAAACAAAAATCATAAAAACTATTAATTACAATAATTATAAACAAAAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:35423:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 GGTTTAAGAGATATATTGAAGGATATTGGTTATAAAAAGGAGATTTATTTTTGATTGGGTTTTTTTGTGATTATAGATTTTTATAATTTATTTTAGATTTATTTGAGTATGTGGTTATAAATTTATAATATGATTGTTATA IIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:35423:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 CCTACATTTCAATTTATATCCCCTTATACTTAACATTAATTTCCTCTAAAAAAATTATCCATCTTACCATATAACAATCATATTATAAATTTATAACCACATACTCAAATAAATCTAAAATAAATTATAAAAATCTATAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:26637:1042_1:N:0:GGCTATCG+TNTTAGTA/1 99 Chromosome_2A_CT_converted 9419729 12 141M = 9419829 241 GGAGATTTTTTAAAATTTTATATTTTTATGTTGTATTATATGTTTTTTTTAAATTGATAAAAATGGATATAGTATGTTTATTATTAATAAAAGTATTATGAATAAATGATTTAAGTTGGATAAGATGGTTTAATGTGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-12 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:136A4 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:26637:1042_2:N:0:GGCTATCG+TNTTAGTA/2 147 Chromosome_2A_CT_converted 9419829 12 141M = 9419729 -241 AATAAATGATTTAAGTTGGATAAGATGGTTTAATGTGTTTTTTTGGTTTTTGAAGTTATATTGTATATTTGTAAGTAGATTTTTTGATTTTAGAAATTAGATAAATTTGTTATTAATTATTTTTTTTATGGTTTTATATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-18 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:36A104 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:27835:1042_1:N:0:GGCTATCG+TNTTAGTA/1 99 Chromosome_6B_CT_converted 14120 1 141M = 14290 311 GAATTTGATTTTTGGTTGTTATTTTTTTTAATGGTGGTTATTTTGAAATATTTAAAAATAGATTGGGAGGAAATATTGATGTTAGAAATGAATTTTGGATTTTTTATTTATTTTAGAATTTAAATGTTGTAGAGATTTTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIII9IIIIIIIIIIIIII9IIIIIIIII*IIII9IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-30 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:27835:1042_2:N:0:GGCTATCG+TNTTAGTA/2 147 Chromosome_6B_CT_converted 14290 1 141M = 14120 -311 TATTTTGAAAAGGGTTGTTTAAAAGAAAATTTTTATGGTGGAAATGGATTTGGGGTTATTAAATTATTTTATAAATAGAATTTGGTTGAAATTTGATAATTTTGATTTTTTGATGTTTTTTGGTGGTTATTTTGAAATGGT I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-30 XS:i:-30 XN:i:0 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:11T12A4A5G41A63 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:25343:1042_1:N:0:GGCTATCG+TNTTAGTA/1 77 * 0 0 * * 0 0 ATGAGAGAGGAGAGGGAGAATTAATGAGAGAGGAGAGAAAATTAATGAGAGAGGAGAGAAAATGAATGAGAGGAGAGGGAGAATTAATGAGAGAGGAGAGAAAATTAATGAGAGAGGAGAGAAAATGAATGAGAGGAGAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:25343:1042_2:N:0:GGCTATCG+TNTTAGTA/2 141 * 0 0 * * 0 0 CATTAATTTTCTCTCCTCTCTCATTAATTCTCCCTCTCCTCTCATTCATTTTCTCTCCTCTCTCATTAATTTTCTCTCCTCTCTCATTAATTCTCCCTCTCCTCTCACTCATTTTCTCTCCTCTCTCATTAATTTTCTCTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I99IIII9IIII9IIIIIIIIIIIIIIIII*IIIIIIIIIIIIIII9IIIII9IIII9III***III*I99II9II9IIIIII*9II*II9II9I9 YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:37429:1042_1:N:0:GGCTATCG+TCTTAGTA/1 99 Chromosome_7B_CT_converted 42543261 42 141M = 42543278 158 ATGATATGAGGGGTGAAATATATGATAAAGAATTTTTATTTGTATGATTTTTTGGTATGGTTGGATGTGTTGTATTATGGTTGTTAGATTATGATTATGTATGAAGTAATAGATATTTTATTAAATTATTAATAAAATTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9III9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:37429:1042_2:N:0:GGCTATCG+TCTTAGTA/2 147 Chromosome_7B_CT_converted 42543278 42 141M = 42543261 -158 ATATATGATAAAGAATTTTTATTTGTATGATTTTTTGGTATGGTTGGATGTGTTGTATTATGGTTGTTAGATTATGATTATGTATGAAGTAATAGATATTTTATTAAATTATTAATAAAATTTATATTTTGTAGAAATTGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9III AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:25343:1042_1:N:0:GGCTATCG+TNTTAGTA/1 83 Chromosome_9B_GA_converted 77404032 1 132M2I7M = 77404000 -171 CCTCTCCTCTCATTCATTTTCTCTCCTCTCTCATTAATTTTCTCTCCTCTCTCATTAATTCTCCCTCTCCTCTCATTCATTTTCTCTCCTCTCTCATTAATTTTCTCTCCTCTCTCATTAATTCTCCCTCTCCTCTCTCAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-11 XS:i:-12 XN:i:0 XM:i:0 XO:i:1 XG:i:2 NM:i:2 MD:Z:139 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:25343:1042_2:N:0:GGCTATCG+TNTTAGTA/2 163 Chromosome_9B_GA_converted 77404000 1 141M = 77404032 171 CATTAATTTTCTCTCCTCTCTCATTAATTCTCCCTCTCCTCTCATTCATTTTCTCTCCTCTCTCATTAATTTTCTCTCCTCTCTCATTAATTCTCCCTCTCCTCTCACTCATTTTCTCTCCTCTCTCATTAATTTTCTCTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I99IIII9IIII9IIIIIIIIIIIIIIIII*IIIIIIIIIIIIIII9IIIII9IIII9III***III*I99II9II9IIIIII*9II*II9II9I9 AS:i:-12 XS:i:-6 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:29A77T33 YS:i:-11 YT:Z:CP >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:26637:1042_1:N:0:GGCTATCG+TNTTAGTA/1 83 Chromosome_2A_GA_converted 9401796 6 141M = 9401696 -241 AAAACACATTAAACCATCTTATCCAACTTAAATCATTTATTCATAATACTTTTATTAATAATAAACATACTATATCCATTTTTATCAATTTAAAAAAAACATATAATACAACATAAAAATATAAAATTTTAAAAAATCTCC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-12 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:4T136 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:26637:1042_2:N:0:GGCTATCG+TNTTAGTA/2 163 Chromosome_2A_GA_converted 9401696 6 141M = 9401796 241 ATATATAAAACCATAAAAAAAATAATTAATAACAAATTTATCTAATTTCTAAAATCAAAAAATCTACTTACAAATATACAATATAACTTCAAAAACCAAAAAAACACATTAAACCATCTTATCCAACTTAAATCATTTATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-12 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:104T36 YS:i:-6 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:37429:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 ATGATATGAGGGGTGAAATATATGATAAAGAATTTTTATTTGTATGATTTTTTGGTATGGTTGGATGTGTTGTATTATGGTTGTTAGATTATGATTATGTATGAAGTAATAGATATTTTATTAAATTATTAATAAAATTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9III9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:37429:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 TCAATTTCTACAAAATATAAATTTTATTAATAATTTAATAAAATATCTATTACTTCATACATAATCATAATCTAACAACCATAATACAACACATCCAACCATACCAAAAAATCATACAAATAAAAATTCTTTATCATATAT III9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:44435:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 ATAAATTGTTTTGAATTTTAGATGAGTTGTAAATGATTTTTGTTTATAATTATTGTAATTAATAGTTTTTATGATTTTTGTTTGGTTTAGATAATTTTATAATTTAAGGATAGAGTAGGATAATAGTTAATGTAATAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:44435:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 AATACACTAAAATTAAAATATTCACTAATAAATATATTTATTACATTAACTATTATCCTACTCTATCCTTAAATTATAAAATTATCTAAACCAAACAAAAATCATAAAAACTATTAATTACAATAATTATAAACAAAAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:29614:1042_1:N:0:GGCTATCG+TNTTAGTA/1 83 Chromosome_7B_GA_converted 176310047 6 141M = 176309927 -261 ATTTCAATAACAAAATTTTATTTACAAACTATATATACAAACAAAAAAAAAAAACTATATTAACAACTATATTAATTACAACATTTCATAATCCATTAATAATAACATCAAATAACATCAATTTCAACATACTCAAAAAAC *I99*9*I*I**9III9I**9I*I*III9*9*9*9*I**II9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-18 XS:i:-18 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:8T2T26T102 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29614:1042_2:N:0:GGCTATCG+TNTTAGTA/2 163 Chromosome_7B_GA_converted 176309927 6 141M = 176310047 261 CTTAATAAACAAAATACAAACCTCCAATATCATAATCAATATATCATAACCAAAAACTCTAATAATAAAATACTATTCAAATTTTATATTCCTTAACTTCTATCATTAAATATATTTACTATTTCAATTACTAAATTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIII AS:i:0 XS:i:-12 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-18 YT:Z:CP >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:35423:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 GGTTTAAGAGATATATTGAAGGATATTGGTTATAAAAAGGAGATTTATTTTTGATTGGGTTTTTTTGTGATTATAGATTTTTATAATTTATTTTAGATTTATTTGAGTATGTGGTTATAAATTTATAATATGATTGTTATA IIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:35423:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 CCTACATTTCAATTTATATCCCCTTATACTTAACATTAATTTCCTCTAAAAAAATTATCCATCTTACCATATAACAATCATATTATAAATTTATAACCACATACTCAAATAAATCTAAAATAAATTATAAAAATCTATAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:27835:1042_1:N:0:GGCTATCG+TNTTAGTA/1 83 Chromosome_1B_GA_converted 69152311 1 141M = 69152141 -311 TTAAAATCTCTACAACATTTAAATTCTAAAATAAATAAAAAATCCAAAATTCATTTCTAACATCAATATTTCCTCCCAATCTATTTTTAAATATTTCAAAATAACCACCATTAAAAAAAATAACAACCAAAAATCAAATTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII9IIII*IIIIIIIII9IIIIIIIIIIIIII9IIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:27835:1042_2:N:0:GGCTATCG+TNTTAGTA/2 163 Chromosome_1B_GA_converted 69152141 1 141M = 69152311 311 ACCATTTCAAAATAACCACCAAAAAACATCAAAAAATCAAAATTATCAAATTTCAACCAAATTCTATTTATAAAATAATTTAATAACCCCAAATCCATTTCCACCATAAAAATTTTCTTTTAAACAACCCTTTTCAAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:38530:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 GAATGAGAATTTTTGATATAGTGTGATAGAATGAGAATTTTTGATATAGTGTGAATTTGGAATGATATTTATGTATATGTATATTTTATTTATGTTATGGTATAAAATAGAAAATAATTATGTTGTTGATTAGTTAATGAT 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:38530:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 AAAAAACAAATTCACCCCTCTCAAACTCTCAAACAACATATATACTAATTCCATCTTCTTCCCACACACTATAAAAACTAAAATTATCTCCCTTTAAACACCATACATAAAATTCAATTAAATCAATCATAACAACTTTTT IIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIII9IIIIIIIIIIII9IIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.1 and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.2 and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.6 and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.4 and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.8 and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.5 and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.7 and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.3 and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.3 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2434:5846:19622_1:N:0:GGCTATCG+TCTTAGTA Chromosome_6A 76092822 Processed 4000000 sequence pairs so far 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1500707 (33.55%) aligned concordantly 0 times 1052908 (23.54%) aligned concordantly exactly 1 time 1919077 (42.91%) aligned concordantly >1 times 66.45% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1497742 (33.49%) aligned concordantly 0 times 1055693 (23.60%) aligned concordantly exactly 1 time 1919257 (42.91%) aligned concordantly >1 times 66.51% overall alignment rate Processed 4472692 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 2566374 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 473000 Sequence pairs did not map uniquely: 1433318 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1285279 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1281095 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 112986973 Total methylated C's in CpG context: 2796158 Total methylated C's in CHG context: 125507 Total methylated C's in CHH context: 553309 Total methylated C's in Unknown context: 13394 Total unmethylated C's in CpG context: 11078817 Total unmethylated C's in CHG context: 19246681 Total unmethylated C's in CHH context: 79186501 Total unmethylated C's in Unknown context: 100008 C methylated in CpG context: 20.2% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.8% 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1500754 (33.55%) aligned concordantly 0 times 1054266 (23.57%) aligned concordantly exactly 1 time 1917672 (42.88%) aligned concordantly >1 times 66.45% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1500339 (33.54%) aligned concordantly 0 times 1055078 (23.59%) aligned concordantly exactly 1 time 1917275 (42.87%) aligned concordantly >1 times 66.46% overall alignment rate Processed 4472692 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 2568787 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 473565 Sequence pairs did not map uniquely: 1430340 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1285587 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1283199 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113103725 Total methylated C's in CpG context: 2793365 Total methylated C's in CHG context: 125425 Total methylated C's in CHH context: 554558 Total methylated C's in Unknown context: 13421 Total unmethylated C's in CpG context: 11096322 Total unmethylated C's in CHG context: 19260874 Total unmethylated C's in CHH context: 79273181 Total unmethylated C's in Unknown context: 100203 C methylated in CpG context: 20.1% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.8% 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1502257 (33.59%) aligned concordantly 0 times 1053798 (23.56%) aligned concordantly exactly 1 time 1916637 (42.85%) aligned concordantly >1 times 66.41% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1499272 (33.52%) aligned concordantly 0 times 1055770 (23.60%) aligned concordantly exactly 1 time 1917650 (42.87%) aligned concordantly >1 times 66.48% overall alignment rate Processed 4472692 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 2568287 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 474221 Sequence pairs did not map uniquely: 1430184 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1286290 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1281997 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113080403 Total methylated C's in CpG context: 2789288 Total methylated C's in CHG context: 124203 Total methylated C's in CHH context: 554783 Total methylated C's in Unknown context: 13413 Total unmethylated C's in CpG context: 11072814 Total unmethylated C's in CHG context: 19255804 Total unmethylated C's in CHH context: 79283511 Total unmethylated C's in Unknown context: 100530 C methylated in CpG context: 20.1% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.8% 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1502188 (33.59%) aligned concordantly 0 times 1052937 (23.54%) aligned concordantly exactly 1 time 1917567 (42.87%) aligned concordantly >1 times 66.41% overall alignment rate 4472691 reads; of these: 4472691 (100.00%) were paired; of these: 1501358 (33.57%) aligned concordantly 0 times 1054707 (23.58%) aligned concordantly exactly 1 time 1916626 (42.85%) aligned concordantly >1 times 66.43% overall alignment rate 4472691 reads; of these: 4472691 (100.00%) were paired; of these: 1500926 (33.56%) aligned concordantly 0 times 1054035 (23.57%) aligned concordantly exactly 1 time 1917730 (42.88%) aligned concordantly >1 times 66.44% overall alignment rate Processed 4472691 sequences in total 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1498159 (33.50%) aligned concordantly 0 times 1056851 (23.63%) aligned concordantly exactly 1 time 1917682 (42.88%) aligned concordantly >1 times 66.50% overall alignment rate Successfully deleted the temporary files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472691 Number of paired-end alignments with a unique best hit: 2568457 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 474717 Sequence pairs did not map uniquely: 1429517 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1285322 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1283135 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113088069 Total methylated C's in CpG context: 2788011 Total methylated C's in CHG context: 125291 Total methylated C's in CHH context: 557612 Total methylated C's in Unknown context: 13312 Total unmethylated C's in CpG context: 11082756 Total unmethylated C's in CHG context: 19266055 Total unmethylated C's in CHH context: 79268344 Total unmethylated C's in Unknown context: 100097 C methylated in CpG context: 20.1% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.7% Now waiting for all child processes to complete Processed 4472692 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 2566931 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 474029 Sequence pairs did not map uniquely: 1431732 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1286424 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1280507 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113005232 Total methylated C's in CpG context: 2790779 Total methylated C's in CHG context: 124792 Total methylated C's in CHH context: 553737 Total methylated C's in Unknown context: 13739 Total unmethylated C's in CpG context: 11082536 Total unmethylated C's in CHG context: 19255281 Total unmethylated C's in CHH context: 79198107 Total unmethylated C's in Unknown context: 100193 C methylated in CpG context: 20.1% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 12.1% 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1499178 (33.52%) aligned concordantly 0 times 1054573 (23.58%) aligned concordantly exactly 1 time 1918941 (42.90%) aligned concordantly >1 times 66.48% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1501520 (33.57%) aligned concordantly 0 times 1055610 (23.60%) aligned concordantly exactly 1 time 1915562 (42.83%) aligned concordantly >1 times 66.43% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1502334 (33.59%) aligned concordantly 0 times 1054179 (23.57%) aligned concordantly exactly 1 time 1916179 (42.84%) aligned concordantly >1 times 66.41% overall alignment rate Processed 4472692 sequences in total 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1499556 (33.53%) aligned concordantly 0 times 1053695 (23.56%) aligned concordantly exactly 1 time 1919441 (42.91%) aligned concordantly >1 times 66.47% overall alignment rate Successfully deleted the temporary files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 2567198 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 475047 Sequence pairs did not map uniquely: 1430447 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1283703 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1283495 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113006656 Total methylated C's in CpG context: 2791044 Total methylated C's in CHG context: 124687 Total methylated C's in CHH context: 554575 Total methylated C's in Unknown context: 13392 Total unmethylated C's in CpG context: 11076457 Total unmethylated C's in CHG context: 19255856 Total unmethylated C's in CHH context: 79204037 Total unmethylated C's in Unknown context: 100433 C methylated in CpG context: 20.1% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.8% Processed 4472692 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 2569033 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 473339 Sequence pairs did not map uniquely: 1430320 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1284369 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1284664 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 113071353 Total methylated C's in CpG context: 2789481 Total methylated C's in CHG context: 124652 Total methylated C's in CHH context: 554604 Total methylated C's in Unknown context: 13343 Total unmethylated C's in CpG context: 11075155 Total unmethylated C's in CHG context: 19257237 Total unmethylated C's in CHH context: 79270224 Total unmethylated C's in Unknown context: 99825 C methylated in CpG context: 20.1% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.8% 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1501108 (33.56%) aligned concordantly 0 times 1054240 (23.57%) aligned concordantly exactly 1 time 1917344 (42.87%) aligned concordantly >1 times 66.44% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1500262 (33.54%) aligned concordantly 0 times 1055138 (23.59%) aligned concordantly exactly 1 time 1917292 (42.87%) aligned concordantly >1 times 66.46% overall alignment rate Processed 4472692 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 2564751 Mapping efficiency: 57.3% Sequence pairs with no alignments under any condition: 474954 Sequence pairs did not map uniquely: 1432987 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1284470 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1280281 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 112888811 Total methylated C's in CpG context: 2785304 Total methylated C's in CHG context: 125709 Total methylated C's in CHH context: 555772 Total methylated C's in Unknown context: 13230 Total unmethylated C's in CpG context: 11064136 Total unmethylated C's in CHG context: 19222587 Total unmethylated C's in CHH context: 79135303 Total unmethylated C's in Unknown context: 99186 C methylated in CpG context: 20.1% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.8% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 17890764. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.1 /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.1 /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.2 /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.2 /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.3 /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.3 /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.4 /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.4 /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.5 /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.5 /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.6 /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.6 /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.7 /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.7 /tmp/13-wgbs-Rio2-1991069/Rio2_R1.fq.gz.temp.8 /tmp/13-wgbs-Rio2-1991069/Rio2_R2.fq.gz.temp.8 Now merging BAM files Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.2_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.3_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.4_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.5_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.6_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.7_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Rio2_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1_bismark_bt2_PE_report.txt Now merging temporary reports Rio2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Rio2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 35781535 Number of paired-end alignments with a unique best hit: 20539818 Mapping efficiency: 57.4% Sequence pairs with no alignments under any condition: 3792872 Sequence pairs did not map uniquely: 11448845 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 10281444 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 10258373 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 904231222 Total methylated C's in CpG context: 22323430 Total methylated C's in CHG context: 1000266 Total methylated C's in CHH context: 4438950 Total methylated C's in Unknown context: 107244 Total unmethylated C's in CpG context: 88628993 Total unmethylated C's in CHG context: 154020375 Total unmethylated C's in CHH context: 633819208 Total unmethylated C's in Unknown context: 800475 C methylated in CpG context: 20.1% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.8% Deleting temporary report files... Rio2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 50m 0s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Rio2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Rio2_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Rio2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Rio2_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Rio2_pe.bam: 20539817 Total number duplicated alignments removed: 1270844 (6.19%) Duplicated alignments were found at: 1190263 different position(s) Total count of deduplicated leftover sequences: 19268973 (93.81% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Rio2_R1.fq.gz -2 output/13-wgbs/trimmed/Rio2_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio2-1991069 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Rio2_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Rio2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Rio2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio2_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio2_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio2_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Rio2_R1.fq.gz -2 output/13-wgbs/trimmed/Rio2_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio2-1991069 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Rio2_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Rio2_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.8 Processed 19268973 lines in total Total number of methylation call strings processed: 38537946 Final Cytosine Methylation Report ================================= Total number of C's analysed: 662136143 Total methylated C's in CpG context: 16330862 Total methylated C's in CHG context: 631489 Total methylated C's in CHH context: 2832146 Total C to T conversions in CpG context: 65024234 Total C to T conversions in CHG context: 112875718 Total C to T conversions in CHH context: 464441694 C methylated in CpG context: 20.1% C methylated in non-CpG context: 0.6% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio2_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio2_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio2_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio2_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio2_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Rio2_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio2_pe.deduplicated.txt.gz Writing bedGraph to file: Rio2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Rio2_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Rio2_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Rio2_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Rio2_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Rio2.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Rio2.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1404568 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1703597 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3068553 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2921607 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2905066 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2612147 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2835809 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1454137 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2844301 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2680821 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Rio2.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Rio2.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Rio2_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Rio2_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1653352934 34.47 378413849 32.06 4.369 C 761122448 15.87 211781786 17.94 3.594 G 850526912 17.73 211810957 17.95 4.016 T 1531878113 31.93 378309330 32.05 4.049 AA 603329008 12.67 128492079 10.89 4.695 AC 260655564 5.47 68264877 5.78 3.818 AG 265337076 5.57 62424886 5.29 4.251 AT 512628658 10.76 119230832 10.10 4.299 CA 313825087 6.59 80836853 6.85 3.882 CC 131484125 2.76 42358709 3.59 3.104 CG 92897514 1.95 26104181 2.21 3.559 CT 217075710 4.56 62481783 5.29 3.474 GA 291379030 6.12 67679435 5.73 4.305 GC 123568235 2.59 33452245 2.83 3.694 GG 154728375 3.25 42378301 3.59 3.651 GT 274778878 5.77 68300800 5.79 4.023 TA 432702413 9.09 101400983 8.59 4.267 TC 239929340 5.04 67705770 5.74 3.544 TG 331471971 6.96 80903356 6.85 4.097 TT 516711949 10.85 128294772 10.87 4.028 [Fri Oct 9 16:47:42 PDT 2026] Rio2 done