[Fri Oct 9 13:36:53 PDT 2026] Rio1 (Rio/Rio_Pudeto) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 42167694 total bases: 6367321794 Q20 bases: 6297277342(98.8999%) Q30 bases: 6100166447(95.8043%) Q40 bases: 6100166447(95.8043%) Read2 before filtering: total reads: 42167694 total bases: 6367321794 Q20 bases: 6288213018(98.7576%) Q30 bases: 6088052572(95.614%) Q40 bases: 6088052572(95.614%) Read1 after filtering: total reads: 41519830 total bases: 5764187360 Q20 bases: 5715852374(99.1615%) Q30 bases: 5558383834(96.4296%) Q40 bases: 5558383834(96.4296%) Read2 after filtering: total reads: 41519830 total bases: 5764308050 Q20 bases: 5713048128(99.1107%) Q30 bases: 5550154721(96.2848%) Q40 bases: 5550154721(96.2848%) Filtering result: reads passed filter: 83039660 reads failed due to low quality: 633754 reads failed due to too many N: 1626 reads failed due to too short: 660348 reads with adapter trimmed: 8154118 bases trimmed due to adapters: 177103969 Duplication rate: 5.31965% Insert size peak (evaluated by paired-end reads): 197 JSON report: output/13-wgbs/fastp/Rio1.fastp.json HTML report: output/13-wgbs/fastp/Rio1.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP1 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP1 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Rio1_R1.fq.gz -O output/13-wgbs/trimmed/Rio1_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Rio1.fastp.json --html output/13-wgbs/fastp/Rio1.fastp.html fastp v1.0.1, time used: 81 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Rio1_R1.fq.gz output/13-wgbs/trimmed/Rio1_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Rio1-3004645 Temporary files will be written into the directory: /tmp/13-wgbs-Rio1-3004645/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio1_R1.fq.gz and output/13-wgbs/trimmed/Rio1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio1_R1.fq.gz and output/13-wgbs/trimmed/Rio1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio1_R1.fq.gz and output/13-wgbs/trimmed/Rio1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio1_R1.fq.gz and output/13-wgbs/trimmed/Rio1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio1_R1.fq.gz and output/13-wgbs/trimmed/Rio1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio1_R1.fq.gz and output/13-wgbs/trimmed/Rio1_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio1_R1.fq.gz and output/13-wgbs/trimmed/Rio1_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Rio1_R1.fq.gz and output/13-wgbs/trimmed/Rio1_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Rio1_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio1_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio1_R1.fq.gz for PID: 3005620 and offset 8 (sequences written out: 5189978) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio1_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio1_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio1_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 5189978) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio1_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio1_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Rio1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Rio1_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio1_R1.fq.gz.temp.4 to /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio1_R2.fq.gz for PID: 3005620 and offset 8 (sequences written out: 5189978) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio1_R1.fq.gz.temp.8 to /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio1_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio1_R1.fq.gz.temp.6 to /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio1_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 5189978) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio1_R1.fq.gz.temp.7 to /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio1_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio1_R1.fq.gz.temp.3 to /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio1_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio1_R1.fq.gz.temp.2 to /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio1_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio1_R1.fq.gz.temp.5 to /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Rio1_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 5189979) Using the subset file >/tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Rio1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio1_R1.fq.gz.temp.1 to /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.1_C_to_T.fastq Created C -> T converted version of the FastQ file Rio1_R1.fq.gz.temp.4 (5189979 sequences in total) Writing a G -> A converted version of the input file Rio1_R2.fq.gz.temp.4 to /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Rio1_R1.fq.gz.temp.6 (5189979 sequences in total) Writing a G -> A converted version of the input file Rio1_R2.fq.gz.temp.6 to /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Rio1_R1.fq.gz.temp.7 (5189978 sequences in total) Writing a G -> A converted version of the input file Rio1_R2.fq.gz.temp.7 to /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Rio1_R1.fq.gz.temp.8 (5189978 sequences in total) Writing a G -> A converted version of the input file Rio1_R2.fq.gz.temp.8 to /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Rio1_R1.fq.gz.temp.2 (5189979 sequences in total) Writing a G -> A converted version of the input file Rio1_R2.fq.gz.temp.2 to /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Rio1_R1.fq.gz.temp.3 (5189979 sequences in total) Writing a G -> A converted version of the input file Rio1_R2.fq.gz.temp.3 to /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Rio1_R1.fq.gz.temp.5 (5189979 sequences in total) Writing a G -> A converted version of the input file Rio1_R2.fq.gz.temp.5 to /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Rio1_R1.fq.gz.temp.1 (5189979 sequences in total) Writing a G -> A converted version of the input file Rio1_R2.fq.gz.temp.1 to /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.1_G_to_A.fastq Created G -> A converted version of the FastQ file Rio1_R2.fq.gz.temp.4 (5189979 sequences in total) Input files are Rio1_R1.fq.gz.temp.4_C_to_T.fastq and Rio1_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio1_R2.fq.gz.temp.7 (5189978 sequences in total) Input files are Rio1_R1.fq.gz.temp.7_C_to_T.fastq and Rio1_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio1_R2.fq.gz.temp.6 (5189979 sequences in total) Input files are Rio1_R1.fq.gz.temp.6_C_to_T.fastq and Rio1_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio1_R2.fq.gz.temp.2 (5189979 sequences in total) Input files are Rio1_R1.fq.gz.temp.2_C_to_T.fastq and Rio1_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio1_R2.fq.gz.temp.8 (5189978 sequences in total) Input files are Rio1_R1.fq.gz.temp.8_C_to_T.fastq and Rio1_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio1_R2.fq.gz.temp.5 (5189979 sequences in total) Input files are Rio1_R1.fq.gz.temp.5_C_to_T.fastq and Rio1_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio1_R2.fq.gz.temp.1 (5189979 sequences in total) Input files are Rio1_R1.fq.gz.temp.1_C_to_T.fastq and Rio1_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio1_R2.fq.gz.temp.3 (5189979 sequences in total) Input files are Rio1_R1.fq.gz.temp.3_C_to_T.fastq and Rio1_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:25731:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 77 * 0 0 * * 0 0 AAATATTGTAGTTTAATATTGAAATTTGGATGATTATAAAATTATAGGAAATTATTTGTTTTTATTTTTATTAGTTTTTTTTAAAATATTTAAAGTTAAGAGTTGGTAGTATAGGAAGTTTAATTAATTTTTGTAAATTTT II999I9*9IIII99I*II9I*9999*99I99III9II*9I*IIII9*I*9I**I9**99I*II9I***III99*I9I**9*9III*II99**9I9****9999II**9*99********9*9***9*9*9*9*9*9*999 YT:Z:UP LH00129:489:23JFWNLT4:8:1101:25731:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 141 * 0 0 * * 0 0 ATTCAAATTATAAATTTTTAATATTATTCTTATTTCATTTCTTATTTTAAATATTTACCAACAATCTTTCTTAATTTAATCAAAACCTTTTTTCAACCAAATCTTTACTATCAATTTCCCAAAATATATACCACCCACTAA IIIII9IIIIII9II9IIII9II999I9IIII9*I99II9I99I*99II9II99I99II*99I9IIIII9*99999999I9I999IIIIII99I99I99I9I99II9II99**9999II99**9II99*9*9II99*9I99 YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:30909:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 99 Chromosome_8B_CT_converted 66354728 1 141M = 66354890 303 GAAGTTAGTAAAATGGGAGTATGTATATTATAAGATTATGTAGATAGTATGTAATTTTTAAGTATTATTATGTAATTGTGGTTAAGGGGTATTTGTGATGAGATTAAAATTTTTTGTATTTTTGATAATGAGAAGAATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:30909:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 147 Chromosome_8B_CT_converted 66354890 1 141M = 66354728 -303 TGAAGGGTATGAGTGATTTTTTTTTATTATAGTGTAGTTTGAGGATAAGTAATGAATATTTTTATAGTAAGTAGAAAAAAAAATAGTGTTGAGTGAAATTTGATTTATTTTGATTTAATTTTTAAAAAGATAATTTGGATT IIIIIIIIIIIIII*I9IIIIIIIIIIIIII9IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:140A0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:36232:1042_1:N:0:TGTCGTGA+CTTGGAAC/1 77 * 0 0 * * 0 0 AGAATATTTTTTGTTTGTTGTAAGAGGTGGTTAAATTAGGTAGTTTTTTGGATGAGATTGTAAAAATTAAGGTTTTGTGTTATAGTAGGTGTGATATAATAAGGATTTTTATTTATTTAAAGGTTTTAGGTGTTGAGTATA 9IIII9IIIIIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIII9III YT:Z:UP LH00129:489:23JFWNLT4:8:1101:36232:1042_2:N:0:TGTCGTGA+CTTGGAAC/2 141 * 0 0 * * 0 0 TACAAAATTTAAACCTATACTCAACACCTAAAACCTTTAAATAAATAAAAATCCTTATTATATCACACCTACTATAACACAAAACCTTAATTTTTACAATCTCATCCAAAAAACTACCTAATTTAACCACCTCTTACAACA IIII9IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIII9IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII9IIIIIII9IIII9III YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:31782:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 99 Chromosome_6B_CT_converted 41262891 6 141M = 41262948 198 TTTGGTGGTAATGATTAATTATTTGTATAAAAGTTATAGAGAGGTAGGGAGATTTTGGTAGTAATGATTAATTATTTGTATAAAAGTTATAGAGAGGTAGGGAGATTTTGGTGGTAATGATTAATTATTTGTATAAAAGTT III9IIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:31782:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 147 Chromosome_6B_CT_converted 41262948 6 141M = 41262891 -198 GTAGTAATGATTAATTATTTGTATAAAAGTTATAGAGAGGTAGGGAGATTTTGGTGGTAATGATTAATTATTTGTATAAAAGTTATAGAGAGGTAGGGAGATTTTGGTGGTAATGATTAATTATTTGTATAAAAGTTATAG IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9III9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:28692:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 99 Chromosome_5B_CT_converted 42691102 0 141M = 42691193 246 TTATTTAGAGAGATATATTTTATAGTTTAAGAGATATTTTTTTTATTTAAAGAGATATTTTTTTATGAATTTTTAGAAAGATATTTTTTAAAGTATAAGATATATTTTTTTAATTGTTGAAAAAGAGATATTTTTTAAAGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-18 XS:i:-60 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:13A10T40A75 YS:i:-59 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:28692:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 147 Chromosome_5B_CT_converted 42691193 0 118M14D23M = 42691102 -246 AGTATAAGATATATTTTTTTAATTGTTGAAAAAGAGATATTTTTTAAAGAGAAAGAGATATTTTTTTTTTATATTTTAATTAGTTTGAATATTTAAGTAATTTTTTTTAAAATGGAAGTTTTATTATGATGGTTTGGGTGT IIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-59 XS:i:-36 XN:i:0 XM:i:2 XO:i:1 XG:i:14 NM:i:16 MD:Z:69A7T40^TTTGTTAAATTAAA23 YS:i:-18 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:26459:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 99 Chromosome_1B_CT_converted 70621405 1 141M = 70621444 178 TTTAAAAATAATGTATATGGTTTTTGAAAGTATATATGTGAAAGATTTTAAAGGTTTATTATGATATTTGTTGTTAGTTTGGAAATGGGTTGAGATATATTTAGGTATTTGTTATTTTGGAAGTAAAAAATTAATAAAAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-11 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:26459:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 147 Chromosome_1B_CT_converted 70621444 1 135M2I4M = 70621405 -178 GAAAGATTTTAAAGGTTTATTATGATATTTGTTGTTAGTTTGGAAATGGGTTGAGATATATTTAGGTATTTGTTATTTTGGAAGTAAAAAATTAATAAAAATGAGGAAAATATATTTATTTTTAATTTTTTTTAATTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-11 XS:i:-11 XN:i:0 XM:i:0 XO:i:1 XG:i:2 NM:i:2 MD:Z:139 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:26039:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 99 Chromosome_1B_CT_converted 76992706 1 141M = 76992762 197 GTTATATGAGTTGATTTAATTATTTTTGTTGTTGTTGAAAATATTTTTAATATATGTTAATAATGTTGTGTATATTTTTAAAGTTTAAAATAATTTATAATAAGTTGTTTTAGAATAAATATTTTTATTGGTTATTATAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:26039:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 147 Chromosome_1B_CT_converted 76992762 1 141M = 76992706 -197 TTAATAATGTTGTGTATATTTTTAAAGTTTAAAATAATTTATAATAAGTTGTTTTAGAATAAATATTTTTATTGGTTATTATAATAGAATTAGTGAGGGTATTTTTTTAAAAGGTTTTTTTTTGAATTATTTTGGATTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:114G6A19 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:41539:1042_1:N:0:TGTCGTGA+CTTGGAAC/1 77 * 0 0 * * 0 0 TAATTGTTAGTATTAGTTGAAGTTAATTGATTTTTTAGATATGAAGGTTTGGTGGTAGTTAGTTTAAAGAATTTTGGTTGAGATTAGTTAAATGGTATTATGGAGTTTTGTGTTGTTTATTAGATTTTGTAAATGTTATTA I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9 YT:Z:UP LH00129:489:23JFWNLT4:8:1101:41539:1042_2:N:0:TGTCGTGA+CTTGGAAC/2 141 * 0 0 * * 0 0 AAATATAATCTTATTATAATAATAACATTTACAAAATCTAATAAACAACACAAAACTCCATAATACCATTTAACTAATCTCAACCAAAATTCTTTAAACTAACTACCACCAAACCTTCATATCTAAAAAATCAATTAACTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:41539:1042_1:N:0:TGTCGTGA+CTTGGAAC/1 83 Chromosome_4A_GA_converted 84731477 42 141M = 84731458 -160 TAATAACATTTACAAAATCTAATAAACAACACAAAACTCCATAATACCATTTAACTAATCTCAACCAAAATTCTTTAAACTAACTACCACCAAACCTTCATATCTAAAAAATCAATTAACTTCAACTAATACTAACAATTA 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:41539:1042_2:N:0:TGTCGTGA+CTTGGAAC/2 163 Chromosome_4A_GA_converted 84731458 42 141M = 84731477 160 AAATATAATCTTATTATAATAATAACATTTACAAAATCTAATAAACAACACAAAACTCCATAATACCATTTAACTAATCTCAACCAAAATTCTTTAAACTAACTACCACCAAACCTTCATATCTAAAAAATCAATTAACTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:31782:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 77 * 0 0 * * 0 0 TTTGGTGGTAATGATTAATTATTTGTATAAAAGTTATAGAGAGGTAGGGAGATTTTGGTAGTAATGATTAATTATTTGTATAAAAGTTATAGAGAGGTAGGGAGATTTTGGTGGTAATGATTAATTATTTGTATAAAAGTT III9IIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:31782:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 141 * 0 0 * * 0 0 CTATAACTTTTATACAAATAATTAATCATTACCACCAAAATCTCCCTACCTCTCTATAACTTTTATACAAATAATTAATCATTACCACCAAAATCTCCCTACCTCTCTATAACTTTTATACAAATAATTAATCATTACTAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9III9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:28692:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 83 Chromosome_5B_GA_converted 42966274 35 141M = 42966183 -232 TCTTTAAAAAATATCTCTTTTTCAACAATTAAAAAAATATATCTTATACTTTAAAAAATATCTTTCTAAAAATTCATAAAAAAATATCTCTTTAAATAAAAAAAATATCTCTTAAACTATAAAATATATCTCTCTAAATAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-60 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:28692:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 163 Chromosome_5B_GA_converted 42966183 35 141M = 42966274 232 ACACCCAAACCATCATAATAAAACTTCCATTTTAAAAAAAATTACTTAAATATTCAAACTAATTAAAATATAAAAAAAAAATATCTCTTTCTCTTTAAAAAATATCTCTTTTTCAACAATTAAAAAAATATATCTTATACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIII AS:i:0 XS:i:-36 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:25731:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 83 Chromosome_8B_GA_converted 45436809 8 105M1D36M = 45436654 -297 AAAATTTACAAAAATTAATTAAACTTCCTATACTACCAACTCTTAACTTTAAATATTTTAAAAAAAACTAATAAAAATAAAAACAAATAATTTCCTATAATTTTATAATCATCCAAATTTCAATATTAAACTACAATATTT 999*9*9*9*9*9*9***9*9********99*9**II9999****9I9**99II*III9*9**I9I*99III***I9II*I99**9I**I9*I*9IIII*I9*II9III99I99*9999*I9II*I99IIII9*9I999II AS:i:-80 XN:i:0 XM:i:12 XO:i:1 XG:i:1 NM:i:13 MD:Z:13C9T8A1T2C10C11T1T3T6T14T10T5^T36 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:25731:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 163 Chromosome_8B_GA_converted 45436654 8 141M = 45436809 297 ATTCAAATTATAAATTTTTAATATTATTCTTATTTCATTTCTTATTTTAAATATTTACCAACAATCTTTCTTAATTTAATCAAAACCTTTTTTCAACCAAATCTTTACTATCAATTTCCCAAAATATATACCACCCACTAA IIIII9IIIIII9II9IIII9II999I9IIII9*I99II9I99I*99II9II99I99II*99I9IIIII9*99999999I9I999IIIIII99I99I99I9I99II9II99**9999II99**9II99*9*9II99*9I99 AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:37C63C39 YS:i:-80 YT:Z:CP >>> Writing bisulfite mapping results to Rio1_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio1_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:26039:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 83 Chromosome_6A_GA_converted 26882204 31 141M = 26882148 -197 ATTATAATAACCAATAAAAATATTTATTCTAAAACAACTTATTATAAATTATTTTAAACTTTAAAAATATACACAACATTATTAACATATATTAAAAATATTTTCAACAACAACAAAAATAATTAAATCAACTCATATAAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-8 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:26039:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 163 Chromosome_6A_GA_converted 26882148 31 141M = 26882204 197 TAAAATCCAAAATAATTCAAAAAAAAACCTTTTAAAAAAATACCCTCACTAATTCTATTATAATAACCAATAAAAATATTTATTCTAAAACAACTTATTATAAATTATTTTAAACTTTAAAAATATACACAACATTATTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-32 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Rio1_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio1_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio1_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:26459:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 83 Chromosome_6B_GA_converted 115325764 1 141M = 115325727 -178 ATTTTTATTAATTTTTTACTTCCAAAATAACAAATACCTAAATATATCTCAACCCATTTCCAAACTAACAACAAATATCATAATAAACCTTTAAAATCTTTCACATATATACTTTCAAAAACCATATACATTATTTTTAAA IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-17 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:26459:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 163 Chromosome_6B_GA_converted 115325727 1 1M2I138M = 115325764 178 AAAAAATTAAAAAAAATTAAAAATAAATATATTTTCCTCATTTTTATTAATTTTTTACTTCCAAAATAACAAATACCTAAATATATCTCAACCCATTTCCAAACTAACAACAAATATCATAATAAACCTTTAAAATCTTTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-17 XS:i:-17 XN:i:0 XM:i:1 XO:i:1 XG:i:2 NM:i:3 MD:Z:0T138 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:30909:1042_1:N:0:TGTCGTGA+CNTGGAAC/1 83 Chromosome_5B_GA_converted 60265241 1 141M = 60265079 -303 TATATTCTTCTCATTATCAAAAATACAAAAAATTTTAATCTCATCACAAATACCCCTTAACCACAATTACATAATAATACTTAAAAATTACATACTATCTACATAATCTTATAATATACATACTCCCATTTTACTAACTTC IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:30909:1042_2:N:0:TGTCGTGA+CNTGGAAC/2 163 Chromosome_5B_GA_converted 60265079 1 141M = 60265241 303 AATCCAAATTATCTTTTTAAAAATTAAATCAAAATAAATCAAATTTCACTCAACACTATTTTTTTTTCTACTTACTATAAAAATATTCATTACTTATCCTCAAACTACACTATAATAAAAAAAAATCACTCATACCCTTCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII9IIIIIIIIIIIIII9I*IIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:0T140 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:36232:1042_1:N:0:TGTCGTGA+CTTGGAAC/1 83 Chromosome_7B_GA_converted 16712160 42 141M = 16712145 -156 TATACTCAACACCTAAAACCTTTAAATAAATAAAAATCCTTATTATATCACACCTACTATAACACAAAACCTTAATTTTTACAATCTCATCCAAAAAACTACCTAATTTAACCACCTCTTACAACAAACAAAAAATATTCT III9IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIII9IIII9 AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:36232:1042_2:N:0:TGTCGTGA+CTTGGAAC/2 163 Chromosome_7B_GA_converted 16712145 42 141M = 16712160 156 TACAAAATTTAAACCTATACTCAACACCTAAAACCTTTAAATAAATAAAAATCCTTATTATATCACACCTACTATAACACAAAACCTTAATTTTTACAATCTCATCCAAAAAACTACCTAATTTAACCACCTCTTACAACA IIII9IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIII9IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII9IIIIIII9IIII9III AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Rio1_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio1_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio1_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.6 and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.1 and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.4 and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.8 and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.2 and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.3 and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.7 and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.5 and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.5 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1130:24332:19636_1:N:0:TGTCGTGA+CTTGGAAC Chromosome_2A 98156043 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2159:7723:11747_1:N:0:TGTCGTGA+CTTGGAAC Chromosome_6A 76092825 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2397:25505:3312_1:N:0:TGTCGTGA+CTTGGAAC Chromosome_10A 1 Processed 5000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2466:2125:17324_1:N:0:TGTCGTGA+CTTGGAAC Chromosome_6A 76092827 Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far 5189978 reads; of these: 5189978 (100.00%) were paired; of these: 1741312 (33.55%) aligned concordantly 0 times 1246840 (24.02%) aligned concordantly exactly 1 time 2201826 (42.42%) aligned concordantly >1 times 66.45% overall alignment rate 5189978 reads; of these: 5189978 (100.00%) were paired; of these: 1743859 (33.60%) aligned concordantly 0 times 1245416 (24.00%) aligned concordantly exactly 1 time 2200703 (42.40%) aligned concordantly >1 times 66.40% overall alignment rate Processed 5189978 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5189978 Number of paired-end alignments with a unique best hit: 3033445 Mapping efficiency: 58.4% Sequence pairs with no alignments under any condition: 533144 Sequence pairs did not map uniquely: 1623389 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1518678 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1514767 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133562495 Total methylated C's in CpG context: 3357388 Total methylated C's in CHG context: 145142 Total methylated C's in CHH context: 647881 Total methylated C's in Unknown context: 15282 Total unmethylated C's in CpG context: 13122058 Total unmethylated C's in CHG context: 22664236 Total unmethylated C's in CHH context: 93625790 Total unmethylated C's in Unknown context: 115599 C methylated in CpG context: 20.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.7% Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1739040 (33.51%) aligned concordantly 0 times 1246725 (24.02%) aligned concordantly exactly 1 time 2204214 (42.47%) aligned concordantly >1 times 66.49% overall alignment rate 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1743062 (33.59%) aligned concordantly 0 times 1246174 (24.01%) aligned concordantly exactly 1 time 2200743 (42.40%) aligned concordantly >1 times 66.41% overall alignment rate 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1738073 (33.49%) aligned concordantly 0 times 1247714 (24.04%) aligned concordantly exactly 1 time 2204192 (42.47%) aligned concordantly >1 times 66.51% overall alignment rate 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1742683 (33.58%) aligned concordantly 0 times 1245542 (24.00%) aligned concordantly exactly 1 time 2201754 (42.42%) aligned concordantly >1 times 66.42% overall alignment rate Processed 5189979 sequences in total Processed 5189979 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5189979 Number of paired-end alignments with a unique best hit: 3034400 Mapping efficiency: 58.5% Sequence pairs with no alignments under any condition: 531210 Sequence pairs did not map uniquely: 1624369 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1519788 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1514612 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133627971 Total methylated C's in CpG context: 3365871 Total methylated C's in CHG context: 145309 Total methylated C's in CHH context: 650946 Total methylated C's in Unknown context: 15094 Total unmethylated C's in CpG context: 13140503 Total unmethylated C's in CHG context: 22680447 Total unmethylated C's in CHH context: 93644895 Total unmethylated C's in Unknown context: 116397 C methylated in CpG context: 20.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.5% Successfully deleted the temporary files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5189979 Number of paired-end alignments with a unique best hit: 3034349 Mapping efficiency: 58.5% Sequence pairs with no alignments under any condition: 531403 Sequence pairs did not map uniquely: 1624227 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1519398 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1514950 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133596285 Total methylated C's in CpG context: 3351057 Total methylated C's in CHG context: 145546 Total methylated C's in CHH context: 648164 Total methylated C's in Unknown context: 15285 Total unmethylated C's in CpG context: 13139385 Total unmethylated C's in CHG context: 22665514 Total unmethylated C's in CHH context: 93646619 Total unmethylated C's in Unknown context: 115928 C methylated in CpG context: 20.3% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.6% 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1742595 (33.58%) aligned concordantly 0 times 1246805 (24.02%) aligned concordantly exactly 1 time 2200579 (42.40%) aligned concordantly >1 times 66.42% overall alignment rate 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1744182 (33.61%) aligned concordantly 0 times 1246612 (24.02%) aligned concordantly exactly 1 time 2199185 (42.37%) aligned concordantly >1 times 66.39% overall alignment rate Processed 5189979 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5189979 Number of paired-end alignments with a unique best hit: 3033861 Mapping efficiency: 58.5% Sequence pairs with no alignments under any condition: 533655 Sequence pairs did not map uniquely: 1622463 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1517521 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1516339 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133565752 Total methylated C's in CpG context: 3362473 Total methylated C's in CHG context: 145327 Total methylated C's in CHH context: 649846 Total methylated C's in Unknown context: 15165 Total unmethylated C's in CpG context: 13121958 Total unmethylated C's in CHG context: 22678440 Total unmethylated C's in CHH context: 93607708 Total unmethylated C's in Unknown context: 115852 C methylated in CpG context: 20.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.6% 5189978 reads; of these: 5189978 (100.00%) were paired; of these: 1740261 (33.53%) aligned concordantly 0 times 1245136 (23.99%) aligned concordantly exactly 1 time 2204581 (42.48%) aligned concordantly >1 times 66.47% overall alignment rate 5189978 reads; of these: 5189978 (100.00%) were paired; of these: 1741975 (33.56%) aligned concordantly 0 times 1244525 (23.98%) aligned concordantly exactly 1 time 2203478 (42.46%) aligned concordantly >1 times 66.44% overall alignment rate Processed 5189978 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5189978 Number of paired-end alignments with a unique best hit: 3034953 Mapping efficiency: 58.5% Sequence pairs with no alignments under any condition: 530769 Sequence pairs did not map uniquely: 1624256 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1518607 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1516346 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133632733 Total methylated C's in CpG context: 3357942 Total methylated C's in CHG context: 144423 Total methylated C's in CHH context: 648812 Total methylated C's in Unknown context: 15571 Total unmethylated C's in CpG context: 13129698 Total unmethylated C's in CHG context: 22680195 Total unmethylated C's in CHH context: 93671663 Total unmethylated C's in Unknown context: 115642 C methylated in CpG context: 20.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.9% Now waiting for all child processes to complete 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1739481 (33.52%) aligned concordantly 0 times 1247014 (24.03%) aligned concordantly exactly 1 time 2203484 (42.46%) aligned concordantly >1 times 66.48% overall alignment rate 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1745037 (33.62%) aligned concordantly 0 times 1243262 (23.96%) aligned concordantly exactly 1 time 2201680 (42.42%) aligned concordantly >1 times 66.38% overall alignment rate Processed 5189979 sequences in total 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1739799 (33.52%) aligned concordantly 0 times 1247225 (24.03%) aligned concordantly exactly 1 time 2202955 (42.45%) aligned concordantly >1 times 66.48% overall alignment rate Successfully deleted the temporary files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5189979 Number of paired-end alignments with a unique best hit: 3032166 Mapping efficiency: 58.4% Sequence pairs with no alignments under any condition: 532981 Sequence pairs did not map uniquely: 1624832 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1518627 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1513538 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133505271 Total methylated C's in CpG context: 3357132 Total methylated C's in CHG context: 144983 Total methylated C's in CHH context: 647479 Total methylated C's in Unknown context: 15306 Total unmethylated C's in CpG context: 13135376 Total unmethylated C's in CHG context: 22656636 Total unmethylated C's in CHH context: 93563665 Total unmethylated C's in Unknown context: 115276 C methylated in CpG context: 20.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.7% 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1746221 (33.65%) aligned concordantly 0 times 1243828 (23.97%) aligned concordantly exactly 1 time 2199930 (42.39%) aligned concordantly >1 times 66.35% overall alignment rate Processed 5189979 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5189979 Number of paired-end alignments with a unique best hit: 3033348 Mapping efficiency: 58.4% Sequence pairs with no alignments under any condition: 532977 Sequence pairs did not map uniquely: 1623654 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1519976 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1513372 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133561787 Total methylated C's in CpG context: 3357586 Total methylated C's in CHG context: 145382 Total methylated C's in CHH context: 648763 Total methylated C's in Unknown context: 15395 Total unmethylated C's in CpG context: 13120489 Total unmethylated C's in CHG context: 22668628 Total unmethylated C's in CHH context: 93620939 Total unmethylated C's in Unknown context: 115792 C methylated in CpG context: 20.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.7% 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1737996 (33.49%) aligned concordantly 0 times 1248373 (24.05%) aligned concordantly exactly 1 time 2203610 (42.46%) aligned concordantly >1 times 66.51% overall alignment rate 5189979 reads; of these: 5189979 (100.00%) were paired; of these: 1745290 (33.63%) aligned concordantly 0 times 1244348 (23.98%) aligned concordantly exactly 1 time 2200341 (42.40%) aligned concordantly >1 times 66.37% overall alignment rate Processed 5189979 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5189979 Number of paired-end alignments with a unique best hit: 3033466 Mapping efficiency: 58.4% Sequence pairs with no alignments under any condition: 532255 Sequence pairs did not map uniquely: 1624258 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1519322 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1514143 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133515762 Total methylated C's in CpG context: 3349417 Total methylated C's in CHG context: 144720 Total methylated C's in CHH context: 646934 Total methylated C's in Unknown context: 15227 Total unmethylated C's in CpG context: 13126363 Total unmethylated C's in CHG context: 22673789 Total unmethylated C's in CHH context: 93574539 Total unmethylated C's in Unknown context: 115133 C methylated in CpG context: 20.3% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.7% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 20759912. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.1 /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.1 /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.2 /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.2 /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.3 /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.3 /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.4 /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.4 /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.5 /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.5 /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.6 /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.6 /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.7 /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.7 /tmp/13-wgbs-Rio1-3004645/Rio1_R1.fq.gz.temp.8 /tmp/13-wgbs-Rio1-3004645/Rio1_R2.fq.gz.temp.8 Now merging BAM files Rio1_R1.fq.gz.temp.1_bismark_bt2_pe.bam Rio1_R1.fq.gz.temp.2_bismark_bt2_pe.bam Rio1_R1.fq.gz.temp.3_bismark_bt2_pe.bam Rio1_R1.fq.gz.temp.4_bismark_bt2_pe.bam Rio1_R1.fq.gz.temp.5_bismark_bt2_pe.bam Rio1_R1.fq.gz.temp.6_bismark_bt2_pe.bam Rio1_R1.fq.gz.temp.7_bismark_bt2_pe.bam Rio1_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Rio1_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Rio1_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Rio1_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Rio1_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Rio1_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Rio1_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Rio1_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Rio1_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Rio1_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1_bismark_bt2_PE_report.txt Now merging temporary reports Rio1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Rio1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Rio1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Rio1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Rio1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Rio1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Rio1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Rio1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Rio1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 41519830 Number of paired-end alignments with a unique best hit: 24269988 Mapping efficiency: 58.5% Sequence pairs with no alignments under any condition: 4258394 Sequence pairs did not map uniquely: 12991448 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 12151917 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 12118067 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1068568056 Total methylated C's in CpG context: 26858866 Total methylated C's in CHG context: 1160832 Total methylated C's in CHH context: 5188825 Total methylated C's in Unknown context: 122325 Total unmethylated C's in CpG context: 105035830 Total unmethylated C's in CHG context: 181367885 Total unmethylated C's in CHH context: 748955818 Total unmethylated C's in Unknown context: 925619 C methylated in CpG context: 20.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 11.7% Deleting temporary report files... Rio1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 57m 58s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Rio1_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Rio1_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Rio1_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Rio1_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Rio1_pe.bam: 24269984 Total number duplicated alignments removed: 1557929 (6.42%) Duplicated alignments were found at: 1458773 different position(s) Total count of deduplicated leftover sequences: 22712055 (93.58% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Rio1_R1.fq.gz -2 output/13-wgbs/trimmed/Rio1_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio1-3004645 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Rio1_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Rio1_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Rio1_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio1_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio1_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Rio1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Rio1_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Rio1_R1.fq.gz -2 output/13-wgbs/trimmed/Rio1_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio1-3004645 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Rio1_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Rio1_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Rio1_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.8 Processed 22712055 lines in total Total number of methylation call strings processed: 45424110 Final Cytosine Methylation Report ================================= Total number of C's analysed: 788031280 Total methylated C's in CpG context: 19766719 Total methylated C's in CHG context: 717410 Total methylated C's in CHH context: 3239835 Total C to T conversions in CpG context: 77664625 Total C to T conversions in CHG context: 133828701 Total C to T conversions in CHH context: 552813990 C methylated in CpG context: 20.3% C methylated in non-CpG context: 0.6% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Rio1_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio1_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio1_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio1_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Rio1_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Rio1_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Rio1_pe.deduplicated.txt.gz Writing bedGraph to file: Rio1_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Rio1_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Rio1_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Rio1_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio1_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Rio1_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Rio1.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Rio1.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1450442 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1793822 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3213253 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 3070227 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 3064568 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2732429 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2956996 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1608664 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2855575 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2762048 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Rio1.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Rio1.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Rio1_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Processed 41500000 lines Processed 42000000 lines Processed 42500000 lines Processed 43000000 lines Processed 43500000 lines Processed 44000000 lines Processed 44500000 lines Processed 45000000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Rio1_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1964858940 34.61 378413849 32.06 5.192 C 899417779 15.84 211781786 17.94 4.247 G 1005823459 17.72 211810957 17.95 4.749 T 1807626457 31.84 378309330 32.05 4.778 AA 721114760 12.79 128492079 10.89 5.612 AC 308426380 5.47 68264877 5.78 4.518 AG 314656753 5.58 62424886 5.29 5.041 AT 607192019 10.77 119230832 10.10 5.093 CA 371588549 6.59 80836853 6.85 4.597 CC 155287244 2.75 42358709 3.59 3.666 CG 110372694 1.96 26104181 2.21 4.228 CT 255242345 4.53 62481783 5.29 4.085 GA 345968801 6.14 67679435 5.73 5.112 GC 146096135 2.59 33452245 2.83 4.367 GG 183321392 3.25 42378301 3.59 4.326 GT 323048980 5.73 68300800 5.79 4.730 TA 511879054 9.08 101400983 8.59 5.048 TC 283113855 5.02 67705770 5.74 4.182 TG 390265390 6.92 80903356 6.85 4.824 TT 609518353 10.81 128294772 10.87 4.751 [Fri Oct 9 15:48:19 PDT 2026] Rio1 done