[Fri Oct 9 13:25:30 PDT 2026] Qui5 (Qui/Quilhua) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 33666512 total bases: 5083643312 Q20 bases: 5025877273(98.8637%) Q30 bases: 4876972544(95.9346%) Q40 bases: 4876972544(95.9346%) Read2 before filtering: total reads: 33666512 total bases: 5083643312 Q20 bases: 5019805472(98.7443%) Q30 bases: 4868518690(95.7683%) Q40 bases: 4868518690(95.7683%) Read1 after filtering: total reads: 33149345 total bases: 4570599719 Q20 bases: 4532233709(99.1606%) Q30 bases: 4418145983(96.6645%) Q40 bases: 4418145983(96.6645%) Read2 after filtering: total reads: 33149345 total bases: 4572105487 Q20 bases: 4532960273(99.1438%) Q30 bases: 4415731481(96.5798%) Q40 bases: 4415731481(96.5798%) Filtering result: reads passed filter: 66298690 reads failed due to low quality: 527506 reads failed due to too many N: 1374 reads failed due to too short: 505454 reads with adapter trimmed: 9589995 bases trimmed due to adapters: 179315816 Duplication rate: 5.12097% Insert size peak (evaluated by paired-end reads): 189 JSON report: output/13-wgbs/fastp/Qui5.fastp.json HTML report: output/13-wgbs/fastp/Qui5.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui5 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui5 (paired)_R2.fastq.gz -o output/13-wgbs/trimmed/Qui5_R1.fq.gz -O output/13-wgbs/trimmed/Qui5_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs/fastp/Qui5.fastp.json --html output/13-wgbs/fastp/Qui5.fastp.html fastp v1.0.1, time used: 67 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Qui5_R1.fq.gz output/13-wgbs/trimmed/Qui5_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Qui5-1134936 Temporary files will be written into the directory: /tmp/13-wgbs-Qui5-1134936/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui5_R1.fq.gz and output/13-wgbs/trimmed/Qui5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui5_R1.fq.gz and output/13-wgbs/trimmed/Qui5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui5_R1.fq.gz and output/13-wgbs/trimmed/Qui5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui5_R1.fq.gz and output/13-wgbs/trimmed/Qui5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui5_R1.fq.gz and output/13-wgbs/trimmed/Qui5_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui5_R1.fq.gz and output/13-wgbs/trimmed/Qui5_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui5_R1.fq.gz and output/13-wgbs/trimmed/Qui5_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Qui5_R1.fq.gz and output/13-wgbs/trimmed/Qui5_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Qui5_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4143669) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui5_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui5_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui5_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui5_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui5_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui5_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui5_R1.fq.gz for PID: 1138919 and offset 8 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Qui5_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Qui5_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4143668) Finished subdividing output/13-wgbs/trimmed/Qui5_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui5_R2.fq.gz<) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui5_R2.fq.gz<) Input files are in FastQ format Input files are in FastQ format Writing a C -> T converted version of the input file Qui5_R1.fq.gz.temp.3 to /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.3_C_to_T.fastq Writing a C -> T converted version of the input file Qui5_R1.fq.gz.temp.5 to /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui5_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui5_R1.fq.gz.temp.4 to /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui5_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui5_R1.fq.gz.temp.7 to /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui5_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4143669) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui5_R1.fq.gz.temp.1 to /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui5_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui5_R1.fq.gz.temp.6 to /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui5_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui5_R1.fq.gz.temp.2 to /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Qui5_R2.fq.gz for PID: 1138919 and offset 8 (sequences written out: 4143668) Using the subset file >/tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Qui5_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui5_R1.fq.gz.temp.8 to /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.8_C_to_T.fastq Created C -> T converted version of the FastQ file Qui5_R1.fq.gz.temp.3 (4143668 sequences in total) Writing a G -> A converted version of the input file Qui5_R2.fq.gz.temp.3 to /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Qui5_R1.fq.gz.temp.5 (4143668 sequences in total) Writing a G -> A converted version of the input file Qui5_R2.fq.gz.temp.5 to /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Qui5_R1.fq.gz.temp.4 (4143668 sequences in total) Writing a G -> A converted version of the input file Qui5_R2.fq.gz.temp.4 to /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Qui5_R1.fq.gz.temp.1 (4143669 sequences in total) Writing a G -> A converted version of the input file Qui5_R2.fq.gz.temp.1 to /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Qui5_R1.fq.gz.temp.7 (4143668 sequences in total) Writing a G -> A converted version of the input file Qui5_R2.fq.gz.temp.7 to /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Qui5_R1.fq.gz.temp.6 (4143668 sequences in total) Writing a G -> A converted version of the input file Qui5_R2.fq.gz.temp.6 to /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Qui5_R1.fq.gz.temp.2 (4143668 sequences in total) Writing a G -> A converted version of the input file Qui5_R2.fq.gz.temp.2 to /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Qui5_R1.fq.gz.temp.8 (4143668 sequences in total) Writing a G -> A converted version of the input file Qui5_R2.fq.gz.temp.8 to /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.8_G_to_A.fastq Created G -> A converted version of the FastQ file Qui5_R2.fq.gz.temp.3 (4143668 sequences in total) Input files are Qui5_R1.fq.gz.temp.3_C_to_T.fastq and Qui5_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui5_R2.fq.gz.temp.5 (4143668 sequences in total) Input files are Qui5_R1.fq.gz.temp.5_C_to_T.fastq and Qui5_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui5_R2.fq.gz.temp.4 (4143668 sequences in total) Input files are Qui5_R1.fq.gz.temp.4_C_to_T.fastq and Qui5_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui5_R2.fq.gz.temp.1 (4143669 sequences in total) Input files are Qui5_R1.fq.gz.temp.1_C_to_T.fastq and Qui5_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui5_R2.fq.gz.temp.7 (4143668 sequences in total) Input files are Qui5_R1.fq.gz.temp.7_C_to_T.fastq and Qui5_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui5_R2.fq.gz.temp.2 (4143668 sequences in total) Input files are Qui5_R1.fq.gz.temp.2_C_to_T.fastq and Qui5_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui5_R2.fq.gz.temp.6 (4143668 sequences in total) Input files are Qui5_R1.fq.gz.temp.6_C_to_T.fastq and Qui5_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui5_R2.fq.gz.temp.8 (4143668 sequences in total) Input files are Qui5_R1.fq.gz.temp.8_C_to_T.fastq and Qui5_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:2267:6558:24162_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 TGAAATTTATTTTTTATATTTAAGGTATATAAAGGATATAAATGTTTTTTTAAAGGAATATTTTTGTATTTTTATTGAGTTATTTATATTTTTTAAGATATGGTATAGAATTGGTGTAAATTTTGTGTGATTTTAATTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2267:6558:24162_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 TCACAACAATCCAATTTTCACTTTCTTTACAAACATTTTTAAATCACAAACAATTAAAATCACACAAAATTTACACCAATTCTATACCATATCTTAAAAAATATAAATAACTCAATAAAAATACAAAAATATTCCTTTAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2265:41717:28506_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_6B_CT_converted 95249570 2 141M = 95249745 311 GTGTTTTTTTTTTTTAAAATGAATTGAGTATAATTTATTTATTTTTTGTATTTTTATTTTTAATTTTTTTGTATTTTGATATATTGAATTTTATTGGTTGAAGTAATATAAATTAAAATAGATAATTAATAAATTATTTTT IIIIIIIIIIIIIIIIIII9I9*IIIIIIIIIIIII9III9IIIII9IIIIIIIIIIIIIII9IIIIIIIII*IIIIII9I9IIIIIIIIIII99IIIIII9IIIIIIIIIII9IIIIIIIIIIIIII99IIIIIIIIIII AS:i:-18 XS:i:-20 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:2T13G14G109 YS:i:-60 YT:Z:CP LH00129:489:23JFWNLT4:8:2265:41717:28506_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_6B_CT_converted 95249745 2 63M3D26M3I3M5I41M = 95249570 -311 TATATTTTAGTGTTTAAGTTTTGGAAGTTTAAGGATAGATATAGAATTGATAGAAAGTGAAGAAAAAAATTTAAATAATGAAAAAAAAATATAATAAAAAAATGAGAGATTGTTTTTAAATATTAATGTTGAGAAAAGTAA IIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-60 XS:i:-59 XN:i:0 XM:i:2 XO:i:3 XG:i:11 NM:i:13 MD:Z:29A33^GAG6A63 YS:i:-18 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1157:45382:27932_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_7B_CT_converted 55521144 21 141M = 55521218 215 AATATAATGATTTTTTTATATTATAAAATTTTTTATTAAATATATTTATATTTTGTTTTGATGAATATTTTTAAGGTTTTTTTATTAGATATTTAAATGTAATAGTATATGGGAATTATATTAGATGAGTGTTTATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-42 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:62A78 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1157:45382:27932_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_7B_CT_converted 55521218 21 141M = 55521144 -215 GGTTTTTTTATTAGATATTTAAATGTAATAGTATATGGGAATTATATTAGATGAGTGTTTATATAAATATAAAGTGTAGTATTTTTTTTTATGTTTTATTTTTATATTGTAAGTATAGTGTAGTTTGATTATTAATGTTTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-46 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2459:9155:16329_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 TGAGTAAAAAATATTAAATAGGGAAAAGTGAGGTTATGGTTAAATAAAATGTTATGGTTAAAAAATATTGATGTAGTTGAATAGATGTTATTAATGTGTATTAGTATTTAAGATTTGATTTTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2459:9155:16329_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 CAAATCTTAAATACTAATACACATTAATAACATCTATTCAACTACATCAATATTTTTTAACCATAACATTTTATTTAACCATAACCTCACTTTTCCCTATTTAATATTTTTTACTCAAATTCAAAAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:2227:36103:16652_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_1B_CT_converted 61218636 1 124M = 61218836 324 AGAGTGATATTTGTTAATTATTTGTATGGTAGTTGAGAGTGGTATTTGTTAATTATTTGTGTGGTAGTTGAGAGTGAAATGTATTAATTATTTGTATGGTAGTTTAGAGTGGTATTTGTTAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII*II9II9III99III9III9II9II9II*I*III99*I9*III*I*9 AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:124 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:2227:36103:16652_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_1B_CT_converted 61218836 1 124M = 61218636 -324 GTGGTAGGTGAGATTGATATTTGTTAATTATGTGTATGGTAGTTGAGAGTGATATTTGTTAATTATTTGTATGGTAGTTGAGAGTGGTATTTGTTAATTATTTGTATGGTAGTTGAGAGTGATA 999**9**I999I*I99*I99II*II9II99*IIIIIIIIII9IIIII9III9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:13G17T92 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2206:45163:11719_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_5B_CT_converted 82389677 42 141M = 82389786 250 AAATGAAGTTTATTGTGATGTTATAATAAGTTTAAGTTATTGTAATTTTATAGTTTGTAAGGTATAAAATATGTAGGTTTTTGATATATAGTTTAAAAATTGTTTGGTTTTGGTTGATAGAAAAAGTGAGTAAATTAGTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:127A13 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:2206:45163:11719_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_5B_CT_converted 82389786 42 141M = 82389677 -250 TTGGTTGATAGAAAAAGTGAGTAAATTAGTATTTATGGAGAATGGAAATATAATAAGAGGTTTATGGGTTATATTGTTTATTTGAGTTATTTTGGTTTATATTTGAAGATTTTTTATATATATTTATATGTAAAATTTTAG IIII*9IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIII9I9I9I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:18A122 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1307:16039:20883_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 TGATATTATATTTAATATTTAAAATAGTTTTTTGGTGTTTGGAATGGTTGATGTTTGTAAAGGAAATATTTTATGTTTGGTTTGTGTTATAAATATAAAGAATTATTATTAAAATGTATTAATGAGATTGAAAGAGATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1307:16039:20883_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 ACTTTAACTTTTTATATAAATCAAATTCAAACAAAATCTCTTTCAATCTCATTAATACATTTTAATAATAATTCTTTATATTTATAACACAAACCAAACATAAAATATTTCCTTTACAAACATCAACCATTCCAAACACCA 9*9*999*9999999*99999999*9**9**99999*9999*9**9999III99II9I*9II9I*I9II9*I9IIII9III9IIII9IIIIIIIIIIIII9III9IIIIIIIIII9IIIIIIIII9II*I9IIII9IIII9 YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1350:47550:15937_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_7B_CT_converted 101272857 32 141M = 101273033 317 GTTGGAGAAAAGGGGTATTTTAAAATTAGAAAATGTGTTTTAAAGTTGTATTGTAATTTTTGTTGTAAAAATATTGTATAAGTGTTATAGAAATATTTTATGTTTTATTATTATTGAAAATTGAATTAAAATTTGTTTAGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-62 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1350:47550:15937_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_7B_CT_converted 101273033 32 141M = 101272857 -317 AAGATGTTTTATATTAAAATGAATTAAAAATGTTTTTGTTATTATGGTAATTAAAAGTTTTTGTTTAATTTGGAGAATTTTTATTTTTAAGTAAGTTTTATATTATATGTTTGTTTAAATTATTTATAGGTAAGATGTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:2265:41717:28506_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_4A_GA_converted 50149693 14 141M = 50149525 -309 AAAAATAATTTATTAATTATCTATTTTAATTTATATTACTTCAACCAATAAAATTCAATATATCAAAATACAAAAAAATTAAAAATAAAAATACAAAAAATAAATAAATTATACTCAATTCATTTTAAAAAAAAAAAACAC IIIIIIIIIII99IIIIIIIIIIIIII9IIIIIIIIIII9IIIIII99IIIIIIIIIII9I9IIIIII*IIIIIIIII9IIIIIIIIIIIIIII9IIIII9III9IIIIIIIIIIIII*9I9IIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-36 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-31 YT:Z:CP LH00129:489:23JFWNLT4:8:2265:41717:28506_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_4A_GA_converted 50149525 14 39M1D11M2D91M = 50149693 309 TTACTTTTCTCAACATTAATATTTAAAAACAATCTCTCATTTTTTTATTATATTTTTTTTTCATTATTTAAATTTTTTTCTTCACTTTCTATCAATTCTATATCTATCCTTAAACTTCCAAAACTTAAACACTAAAATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIII AS:i:-31 XS:i:-66 XN:i:0 XM:i:2 XO:i:2 XG:i:3 NM:i:5 MD:Z:39^T11^TT1T20A68 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1350:47550:15937_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_1B_GA_converted 77378504 17 141M = 77378328 -317 ACTAAACAAATTTTAATTCAATTTTCAATAATAATAAAACATAAAATATTTCTATAACACTTATACAATATTTTTACAACAAAAATTACAATACAACTTTAAAACACATTTTCTAATTTTAAAATACCCCTTTTCTCCAAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-36 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1350:47550:15937_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_1B_GA_converted 77378328 17 141M = 77378504 317 ATAACATCTTACCTATAAATAATTTAAACAAACATATAATATAAAACTTACTTAAAAATAAAAATTCTCCAAATTAAACAAAAACTTTTAATTACCATAATAACAAAAACATTTTTAATTCATTTTAATATAAAACATCTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:73C67 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:2267:6558:24162_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_7B_GA_converted 77249513 1 141M = 77249465 -189 AACAATTAAAATCACACAAAATTTACACCAATTCTATACCATATCTTAAAAAATATAAATAACTCAATAAAAATACAAAAATATTCCTTTAAAAAAACATTTATATCCTTTATATACCTTAAATATAAAAAATAAATTTCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:55C85 YS:i:-18 YT:Z:CP LH00129:489:23JFWNLT4:8:2267:6558:24162_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_7B_GA_converted 77249465 1 141M = 77249513 189 TCACAACAATCCAATTTTCACTTTCTTTACAAACATTTTTAAATCACAAACAATTAAAATCACACAAAATTTACACCAATTCTATACCATATCTTAAAAAATATAAATAACTCAATAAAAATACAAAAATATTCCTTTAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-18 XS:i:-18 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:6T13A82C37 YS:i:-6 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:2459:9155:16329_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_6B_GA_converted 56501466 40 6M3D121M = 56501479 140 AAAAAAAAATCAAATCTTAAATACTAATACACATTAATAACATCTATTCAACTACATCAATATTTTTTAACCATAACATTTTATTTAACCATAACCTCACTTTTCCCTATTTAATATTTTTTACTCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-32 XN:i:0 XM:i:3 XO:i:1 XG:i:3 NM:i:6 MD:Z:4T1^TTT0T0T119 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:2459:9155:16329_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_6B_GA_converted 56501479 40 127M = 56501466 -140 CAAATCTTAAATACTAATACACATTAATAACATCTATTCAACTACATCAATATTTTTTAACCATAACATTTTATTTAACCATAACCTCACTTTTCCCTATTTAATATTTTTTACTCAAATTCAAAAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:127 YS:i:-32 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1307:16039:20883_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_4A_GA_converted 70120174 17 141M = 70120142 -173 AAAATCTCTTTCAATCTCATTAATACATTTTAATAATAATTCTTTATATTTATAACACAAACCAAACATAAAATATTTCCTTTACAAACATCAACCATTCCAAACACCAAAAAACTATTTTAAATATTAAATATAATATCA IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-18 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1307:16039:20883_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_4A_GA_converted 70120142 17 141M = 70120174 173 ACTTTAACTTTTTATATAAATCAAATTCAAACAAAATCTCTTTCAATCTCATTAATACATTTTAATAATAATTCTTTATATTTATAACACAAACCAAACATAAAATATTTCCTTTACAAACATCAACCATTCCAAACACCA 9*9*999*9999999*99999999*9**9**99999*9999*9**9999III99II9I*9II9I*I9II9*I9IIII9III9IIII9IIIIIIIIIIIII9III9IIIIIIIIII9IIIIIIIII9II*I9IIII9IIII9 AS:i:-6 XS:i:-24 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:7A133 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Qui5_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:2227:36103:16652_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 AGAGTGATATTTGTTAATTATTTGTATGGTAGTTGAGAGTGGTATTTGTTAATTATTTGTGTGGTAGTTGAGAGTGAAATGTATTAATTATTTGTATGGTAGTTTAGAGTGGTATTTGTTAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII*II9II9III99III9III9II9II9II*I*III99*I9*III*I*9 YT:Z:UP LH00129:489:23JFWNLT4:8:2227:36103:16652_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 TATCACTCTCAACTACCATACAAATAATTAACAAATACCACTCTCAACTACCATACAAATAATTAACAAATATCACTCTCAACTACCATACACATAATTAACAAATATCAATCTCACCTACCAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9III9IIIII9IIIIIIIIII*99II9II*II99I*99I*I999I**9**999 YT:Z:UP >>> Writing bisulfite mapping results to Qui5_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui5_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:2206:45163:11719_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 AAATGAAGTTTATTGTGATGTTATAATAAGTTTAAGTTATTGTAATTTTATAGTTTGTAAGGTATAAAATATGTAGGTTTTTGATATATAGTTTAAAAATTGTTTGGTTTTGGTTGATAGAAAAAGTGAGTAAATTAGTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:2206:45163:11719_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 CTAAAATTTTACATATAAATATATATAAAAAATCTTCAAATATAAACCAAAATAACTCAAATAAACAATATAACCCATAAACCTCTTATTATATTTCCATTCTCCATAAATACTAATTTACTCACTTTTTCTATCAACCAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I9I9I9IIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII9*IIII YT:Z:UP >>> Writing bisulfite mapping results to Qui5_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui5_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui5_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui5_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1157:45382:27932_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_7B_GA_converted 144106195 21 141M = 144106121 -215 TTTATATAAACACTCATCTAATATAATTCCCATATACTATTACATTTAAATATCTAATAAAAAAACCTTAAAAATATTCATCAAAACAAAATATAAATATATTTAATAAAAAATTTTATAATATAAAAAAATCATTATATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-42 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:78T62 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1157:45382:27932_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_7B_GA_converted 144106121 21 141M = 144106195 215 CAAACATTAATAATCAAACTACACTATACTTACAATATAAAAATAAAACATAAAAAAAAATACTACACTTTATATTTATATAAACACTCATCTAATATAATTCCCATATACTATTACATTTAAATATCTAATAAAAAAACC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-46 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP >>> Writing bisulfite mapping results to Qui5_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.1 and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.6 and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.3 and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.8 and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.5 and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.2 and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.7 and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.4 and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.4 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1374662 (33.18%) aligned concordantly 0 times 973295 (23.49%) aligned concordantly exactly 1 time 1795711 (43.34%) aligned concordantly >1 times 66.82% overall alignment rate Processed 4000000 sequence pairs so far 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1373202 (33.14%) aligned concordantly 0 times 974861 (23.53%) aligned concordantly exactly 1 time 1795605 (43.33%) aligned concordantly >1 times 66.86% overall alignment rate Processed 4143668 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4143668 Number of paired-end alignments with a unique best hit: 2367133 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 436224 Sequence pairs did not map uniquely: 1340311 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1184793 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1182340 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 106540962 Total methylated C's in CpG context: 2519794 Total methylated C's in CHG context: 137144 Total methylated C's in CHH context: 609960 Total methylated C's in Unknown context: 15041 Total unmethylated C's in CpG context: 10765897 Total unmethylated C's in CHG context: 18085263 Total unmethylated C's in CHH context: 74422904 Total unmethylated C's in Unknown context: 101835 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1372124 (33.11%) aligned concordantly 0 times 974818 (23.53%) aligned concordantly exactly 1 time 1796726 (43.36%) aligned concordantly >1 times 66.89% overall alignment rate 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1374554 (33.17%) aligned concordantly 0 times 971967 (23.46%) aligned concordantly exactly 1 time 1797147 (43.37%) aligned concordantly >1 times 66.83% overall alignment rate Processed 4143668 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4143668 Number of paired-end alignments with a unique best hit: 2364713 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 436537 Sequence pairs did not map uniquely: 1342418 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1183903 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1180810 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 106458225 Total methylated C's in CpG context: 2524088 Total methylated C's in CHG context: 137698 Total methylated C's in CHH context: 607967 Total methylated C's in Unknown context: 15116 Total unmethylated C's in CpG context: 10752390 Total unmethylated C's in CHG context: 18082912 Total unmethylated C's in CHH context: 74353170 Total unmethylated C's in Unknown context: 102583 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.8% 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1373740 (33.15%) aligned concordantly 0 times 976300 (23.56%) aligned concordantly exactly 1 time 1793628 (43.29%) aligned concordantly >1 times 66.85% overall alignment rate 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1375964 (33.21%) aligned concordantly 0 times 973613 (23.50%) aligned concordantly exactly 1 time 1794091 (43.30%) aligned concordantly >1 times 66.79% overall alignment rate Processed 4143668 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4143668 Number of paired-end alignments with a unique best hit: 2366031 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 436629 Sequence pairs did not map uniquely: 1341008 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1185091 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1180940 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 106490527 Total methylated C's in CpG context: 2518378 Total methylated C's in CHG context: 137790 Total methylated C's in CHH context: 610623 Total methylated C's in Unknown context: 15176 Total unmethylated C's in CpG context: 10755991 Total unmethylated C's in CHG context: 18083635 Total unmethylated C's in CHH context: 74384110 Total unmethylated C's in Unknown context: 101371 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 13.0% Processed 4000000 sequence pairs so far 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1375796 (33.20%) aligned concordantly 0 times 974969 (23.53%) aligned concordantly exactly 1 time 1792903 (43.27%) aligned concordantly >1 times 66.80% overall alignment rate 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1375288 (33.19%) aligned concordantly 0 times 973721 (23.50%) aligned concordantly exactly 1 time 1794659 (43.31%) aligned concordantly >1 times 66.81% overall alignment rate Processed 4143668 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4143668 Number of paired-end alignments with a unique best hit: 2366050 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 437642 Sequence pairs did not map uniquely: 1339976 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1184085 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1181965 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 106483386 Total methylated C's in CpG context: 2519550 Total methylated C's in CHG context: 137192 Total methylated C's in CHH context: 608857 Total methylated C's in Unknown context: 15026 Total unmethylated C's in CpG context: 10753843 Total unmethylated C's in CHG context: 18078954 Total unmethylated C's in CHH context: 74384990 Total unmethylated C's in Unknown context: 101176 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% Now waiting for all child processes to complete 4143669 reads; of these: 4143669 (100.00%) were paired; of these: 1373625 (33.15%) aligned concordantly 0 times 974778 (23.52%) aligned concordantly exactly 1 time 1795266 (43.33%) aligned concordantly >1 times 66.85% overall alignment rate 4143669 reads; of these: 4143669 (100.00%) were paired; of these: 1374163 (33.16%) aligned concordantly 0 times 974263 (23.51%) aligned concordantly exactly 1 time 1795243 (43.32%) aligned concordantly >1 times 66.84% overall alignment rate Processed 4143669 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4143669 Number of paired-end alignments with a unique best hit: 2365167 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 437197 Sequence pairs did not map uniquely: 1341305 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1182916 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1182251 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 106502705 Total methylated C's in CpG context: 2517860 Total methylated C's in CHG context: 137399 Total methylated C's in CHH context: 608708 Total methylated C's in Unknown context: 15297 Total unmethylated C's in CpG context: 10749908 Total unmethylated C's in CHG context: 18080616 Total unmethylated C's in CHH context: 74408214 Total unmethylated C's in Unknown context: 102827 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1375602 (33.20%) aligned concordantly 0 times 974672 (23.52%) aligned concordantly exactly 1 time 1793394 (43.28%) aligned concordantly >1 times 66.80% overall alignment rate 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1376338 (33.22%) aligned concordantly 0 times 973784 (23.50%) aligned concordantly exactly 1 time 1793546 (43.28%) aligned concordantly >1 times 66.78% overall alignment rate Processed 4143668 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4143668 Number of paired-end alignments with a unique best hit: 2364934 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 437949 Sequence pairs did not map uniquely: 1340785 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1183823 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1181111 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 106455452 Total methylated C's in CpG context: 2511578 Total methylated C's in CHG context: 137031 Total methylated C's in CHH context: 608532 Total methylated C's in Unknown context: 14958 Total unmethylated C's in CpG context: 10764008 Total unmethylated C's in CHG context: 18070001 Total unmethylated C's in CHH context: 74364302 Total unmethylated C's in Unknown context: 102306 C methylated in CpG context: 18.9% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.8% 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1374901 (33.18%) aligned concordantly 0 times 974119 (23.51%) aligned concordantly exactly 1 time 1794648 (43.31%) aligned concordantly >1 times 66.82% overall alignment rate 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1374685 (33.18%) aligned concordantly 0 times 973975 (23.51%) aligned concordantly exactly 1 time 1795008 (43.32%) aligned concordantly >1 times 66.82% overall alignment rate Processed 4143668 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4143668 Number of paired-end alignments with a unique best hit: 2366866 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 437043 Sequence pairs did not map uniquely: 1339759 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1183850 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1183016 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 106509710 Total methylated C's in CpG context: 2514636 Total methylated C's in CHG context: 137161 Total methylated C's in CHH context: 610178 Total methylated C's in Unknown context: 15174 Total unmethylated C's in CpG context: 10762141 Total unmethylated C's in CHG context: 18085009 Total unmethylated C's in CHH context: 74400585 Total unmethylated C's in Unknown context: 102145 C methylated in CpG context: 18.9% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% Processed 4000000 sequence pairs so far 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1373407 (33.14%) aligned concordantly 0 times 975719 (23.55%) aligned concordantly exactly 1 time 1794542 (43.31%) aligned concordantly >1 times 66.86% overall alignment rate 4143668 reads; of these: 4143668 (100.00%) were paired; of these: 1374001 (33.16%) aligned concordantly 0 times 973800 (23.50%) aligned concordantly exactly 1 time 1795867 (43.34%) aligned concordantly >1 times 66.84% overall alignment rate Processed 4143668 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4143668 Number of paired-end alignments with a unique best hit: 2367868 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 435901 Sequence pairs did not map uniquely: 1339899 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1185180 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1182688 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 106582446 Total methylated C's in CpG context: 2515781 Total methylated C's in CHG context: 137291 Total methylated C's in CHH context: 608976 Total methylated C's in Unknown context: 15076 Total unmethylated C's in CpG context: 10761256 Total unmethylated C's in CHG context: 18099942 Total unmethylated C's in CHH context: 74459200 Total unmethylated C's in Unknown context: 101939 C methylated in CpG context: 18.9% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 16574672. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.1 /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.1 /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.2 /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.2 /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.3 /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.3 /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.4 /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.4 /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.5 /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.5 /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.6 /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.6 /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.7 /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.7 /tmp/13-wgbs-Qui5-1134936/Qui5_R1.fq.gz.temp.8 /tmp/13-wgbs-Qui5-1134936/Qui5_R2.fq.gz.temp.8 Now merging BAM files Qui5_R1.fq.gz.temp.1_bismark_bt2_pe.bam Qui5_R1.fq.gz.temp.2_bismark_bt2_pe.bam Qui5_R1.fq.gz.temp.3_bismark_bt2_pe.bam Qui5_R1.fq.gz.temp.4_bismark_bt2_pe.bam Qui5_R1.fq.gz.temp.5_bismark_bt2_pe.bam Qui5_R1.fq.gz.temp.6_bismark_bt2_pe.bam Qui5_R1.fq.gz.temp.7_bismark_bt2_pe.bam Qui5_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Qui5_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Qui5_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Qui5_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Qui5_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Qui5_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Qui5_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Qui5_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Qui5_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Qui5_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1_bismark_bt2_PE_report.txt Now merging temporary reports Qui5_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Qui5_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Qui5_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Qui5_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Qui5_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Qui5_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Qui5_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Qui5_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Qui5_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 33149345 Number of paired-end alignments with a unique best hit: 18928762 Mapping efficiency: 57.1% Sequence pairs with no alignments under any condition: 3495122 Sequence pairs did not map uniquely: 10725461 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 9473641 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 9455121 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 852023413 Total methylated C's in CpG context: 20141665 Total methylated C's in CHG context: 1098706 Total methylated C's in CHH context: 4873801 Total methylated C's in Unknown context: 120864 Total unmethylated C's in CpG context: 86065434 Total unmethylated C's in CHG context: 144666332 Total unmethylated C's in CHH context: 595177475 Total unmethylated C's in Unknown context: 816182 C methylated in CpG context: 19.0% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 12.9% Deleting temporary report files... Qui5_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui5_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 48m 36s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Qui5_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Qui5_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Qui5_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Qui5_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Qui5_pe.bam: 18928762 Total number duplicated alignments removed: 1150988 (6.08%) Duplicated alignments were found at: 1086763 different position(s) Total count of deduplicated leftover sequences: 17777774 (93.92% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Qui5_R1.fq.gz -2 output/13-wgbs/trimmed/Qui5_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui5-1134936 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Qui5_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Qui5_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Qui5_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui5_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui5_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Qui5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui5_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Qui5_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Qui5_R1.fq.gz -2 output/13-wgbs/trimmed/Qui5_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui5-1134936 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Qui5_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Qui5_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Qui5_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.8 Processed 17777774 lines in total Total number of methylation call strings processed: 35555548 Final Cytosine Methylation Report ================================= Total number of C's analysed: 589998557 Total methylated C's in CpG context: 13893470 Total methylated C's in CHG context: 714439 Total methylated C's in CHH context: 3197326 Total C to T conversions in CpG context: 59716158 Total C to T conversions in CHG context: 100153256 Total C to T conversions in CHH context: 412323908 C methylated in CpG context: 18.9% C methylated in non-CpG context: 0.8% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Qui5_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui5_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui5_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui5_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Qui5_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Qui5_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Qui5_pe.deduplicated.txt.gz Writing bedGraph to file: Qui5_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Qui5_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Qui5_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Qui5_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui5_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Qui5_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Qui5.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Qui5.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1428279 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1678811 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3121057 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2976342 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2960864 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2621159 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2879077 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1420129 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2898557 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2707888 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Qui5.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Qui5.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs/dedup/Qui5_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Qui5_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1484166149 33.90 378413849 32.06 3.922 C 711997298 16.26 211781786 17.94 3.362 G 779027640 17.80 211810957 17.95 3.678 T 1402342993 32.03 378309330 32.05 3.707 AA 533710559 12.28 128492079 10.89 4.154 AC 239639936 5.51 68264877 5.78 3.510 AG 238408159 5.49 62424886 5.29 3.819 AT 462203269 10.63 119230832 10.10 3.877 CA 288995345 6.65 80836853 6.85 3.575 CC 125922893 2.90 42358709 3.59 2.973 CG 88254101 2.03 26104181 2.21 3.381 CT 203321099 4.68 62481783 5.29 3.254 GA 261882212 6.03 67679435 5.73 3.869 GC 116274393 2.68 33452245 2.83 3.476 GG 143469169 3.30 42378301 3.59 3.385 GT 251705104 5.79 68300800 5.79 3.685 TA 388690839 8.94 101400983 8.59 3.833 TC 224977324 5.18 67705770 5.74 3.323 TG 303300481 6.98 80903356 6.85 3.749 TT 475340428 10.94 128294772 10.87 3.705 [Fri Oct 9 15:12:59 PDT 2026] Qui5 done