[Fri Oct 9 08:07:42 PDT 2026] Pum1 (Pum/Pumalin) Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs/trimmed/Pum1_R1.fq.gz output/13-wgbs/trimmed/Pum1_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/ Using temp directory: /tmp/13-wgbs-Pum1-1351037 Temporary files will be written into the directory: /tmp/13-wgbs-Pum1-1351037/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum1_R1.fq.gz and output/13-wgbs/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum1_R1.fq.gz and output/13-wgbs/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum1_R1.fq.gz and output/13-wgbs/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum1_R1.fq.gz and output/13-wgbs/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum1_R1.fq.gz and output/13-wgbs/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum1_R1.fq.gz and output/13-wgbs/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum1_R1.fq.gz and output/13-wgbs/trimmed/Pum1_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs/trimmed/Pum1_R1.fq.gz and output/13-wgbs/trimmed/Pum1_R2.fq.gz Finished subdividing output/13-wgbs/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4797033) Finished subdividing output/13-wgbs/trimmed/Pum1_R1.fq.gz for PID: 1351493 and offset 8 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum1_R1.fq.gz<) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4797034) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs/trimmed/Pum1_R2.fq.gz for PID: 1351493 and offset 8 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.8 to /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.2 to /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4797034) Finished subdividing output/13-wgbs/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum1_R2.fq.gz<) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.5 to /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.5_C_to_T.fastq Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.1 to /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.4 to /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.6 to /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.3 to /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.7 to /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.7_C_to_T.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.8 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.8 to /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.5 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.5 to /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.1 (4797034 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.1 to /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.2 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.2 to /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.4 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.4 to /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.6 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.6 to /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.3 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.3 to /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.7 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.7 to /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.7_G_to_A.fastq Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.8 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.8_C_to_T.fastq and Pum1_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.5 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.5_C_to_T.fastq and Pum1_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.1 (4797034 sequences in total) Input files are Pum1_R1.fq.gz.temp.1_C_to_T.fastq and Pum1_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.2 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.2_C_to_T.fastq and Pum1_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.6 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.6_C_to_T.fastq and Pum1_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.3 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.3_C_to_T.fastq and Pum1_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.4 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.4_C_to_T.fastq and Pum1_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.7 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.7_C_to_T.fastq and Pum1_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:13863:1056_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TTGTTAAAATATTTTGTTTGAAGTATTATTTTATTATTGAAAAAGTGATATAAGTTTTTAAATTATAATTTATGTGAGGTGATTAAAGGAGTTATTAAATAAAATTTTAGTGTAATGAGTTATTTTAATATTTGTATGGTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:13863:1056_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAAACTTCTTACACAACATATTAATTAATAAATTAAATATTTTTTCACAAAATTTATCTAAATTTTCTTCAAAATTAAAAACACCATACAAATATTAAAATAACTCATTACACTAAAATTTTATTTAATAACTCCTTTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:39516:1042_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_1B_CT_converted 165086635 42 141M = 165086690 196 TATGTTTATTTATTTTGTAATGTTATTGAATTTAAAAAAAAATATTTATGAATAAATAAAAATTTTTGTATGGTATGAAAATAAATTTTAAATAGTATAAGTTTTGATGTGATAAAGTAGGGTTTATAGGGTTTGTAGATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:39516:1042_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_1B_CT_converted 165086690 42 141M = 165086635 -196 ATAAAAATTTTTGTATGGTATGAAAATAAATTTTAAATAGTATAAGTTTTGATGTGATAAAGTAGGGTTTATAGGGTTTGTAGATTTTATTTTTTATGTTAAAAAGTAGGTATTTTTTTTAATTTTTGTTTTAAAATTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:46781:1042_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_6B_CT_converted 9009 2 141M = 9084 216 TATTAATTTTTTGATTTTATAAATTAGATAGTTATAAATATTTTAGTATTATTTAATTAAAAAGAAGTGTATGTATATGTGTGTGTAAATTGGTAATTTTGATAATGTAAATTAGTTAAGGGTTTTAATATTTATTTATGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-30 XS:i:-34 XN:i:0 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:12T0T10A49G64T1 YS:i:-30 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:46781:1042_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_6B_CT_converted 9084 2 141M = 9009 -216 TATGTGTGTGTAAATTGGTAATTTTGATAATGTAAATTAGTTAAGGGTTTTAATATTTATTTATGATATGAATATTAAGTTATTTTAATGAATAATAAAAAAGTTAGGTTGATTTTAAAGTTTGTGAATAAATGTTGTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-30 XS:i:-30 XN:i:0 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:64T42A14A7T2T7 YS:i:-30 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:29938:1042_1:N:0:TGAGTACT+GNCAATAA/1 99 Chromosome_8B_CT_converted 1661251 6 141M = 1661285 175 TTTATTTGAGTTATTTTGGTTTATATTAGAAGAATTTATATATATTTGTATGTAAAATTATAGTTTTTATTATGGTTTTAATTTATTTTTGGAGGATATGGTTTTTGTAAATTTGAATTTATATTATGTTAGAAAGTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIII AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29938:1042_2:N:0:TGAGTACT+GNCAATAA/2 147 Chromosome_8B_CT_converted 1661285 6 141M = 1661251 -175 TTTATATATATTTGTATGTAAAATTATAGTTTTTATTATGGTTTTAATTTATTTTTGGAGGATATGGTTTTTGTAAATTTGAATTTATATTATGTTAGAAAGTTTTTAAGTAAATGTGAATTTTTTTGGTTTAATGGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:108T8T23 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:12326:1056_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_2A_CT_converted 92910652 42 141M = 92910759 248 AATTTAATAAATAAAGATAAAAGTTTGAGATATTTGTTAATAAGTGTTAATGATGATTATTTTTTAATGGTTTGGTTGTGATTATTTTTGGTATAAGGAATGGTATTGATTTTTTTTAAAAAAAAAGAAATTGTTTTGTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:26A114 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:12326:1056_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_2A_CT_converted 92910759 42 141M = 92910652 -248 GATTTTTTTTAAAAAAAAAGAAATTGTTTTGTTATTTAAAAAGAAAAAGTAAGATTATAAGTTTAATTAAAATAAGTTGATATAGTGGTGATAAATTTGATAATAAATTTTTTAGTAAGTTATATTTTGAATTTAATAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:10142:1056_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 ATTGGGAAATTTTTTTATTGGTGTAAGTGGGATTTGAATTTGTGTTGATAGAGTTGAGAGGTTGTGTGATTTTGAGTGTAATGTTTTAATTATTTGGTTATGGAGGTTTTATATGAGAAGATATTAGTAGTATTGTTATAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:10142:1056_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAAAACATCAAATTTTTTTTAACTCTCTAACCCTCATTATAACCCCATCCCTACCAAACAAAATCATAACTTAACCAATTTTAAATCCATACAATATAAAAATACATTTATAACAATACTACAAATATCTTCTCATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:13993:1056_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_6B_CT_converted 37777289 7 72M1D69M = 37777332 185 AATTGTAAAAGAATTAAATAATAGGATTTGTTTATGAAATTGATAGGGTAATAGATTATTTTTTATTAAATAGGATAGAATTTAGGTGATTTAAATAAGTGTTAAAAATGAAGATGATTTTAGGGAAGAAAATATATTAGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-8 XS:i:-22 XN:i:0 XM:i:0 XO:i:1 XG:i:1 NM:i:1 MD:Z:72^T69 YS:i:-14 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:13993:1056_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_6B_CT_converted 37777332 7 29M1D112M = 37777289 -185 TAGGGTAATAGATTATTTTTTATTAAATAGGATAGAATTTAGGTGATTTAAATAAGTGTTAAAAATGAAGATGATTTTAGGGAAGAAAATATATTAGATTATTTAATTGATTTTTATATTAGATTTATAGAGAATTTAGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-14 XS:i:-28 XN:i:0 XM:i:1 XO:i:1 XG:i:1 NM:i:2 MD:Z:29^T110A1 YS:i:-8 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:24954:1042_1:N:0:TGAGTACT+GNCAATAA/1 77 * 0 0 * * 0 0 TTTATTTAGAGAAAAATTTAATTTTTAAATTTAAAATATGTATAGTTTATTTAGTGAATAAAAATTGTATTAGAGTTTTGTGGGGATTAAAATATTAAATAATGTGTGAAGTGTTTAAAGTTAAAATTTTGTTTTAGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:24954:1042_2:N:0:TGAGTACT+GNCAATAA/2 141 * 0 0 * * 0 0 TTATCAACAAAAAATCAAATTATAACTACTTTAATAAAACTAAAACAAAATTTTAACTTTAAACACTTCACACATTATTTAATATTTTAATCCCCACAAAACTCTAATACAATTTTTATTCACTAAATAAACTATACATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:13993:1056_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_7B_GA_converted 153244284 1 141M = 153244241 -184 TCTAATATATTTTCTTCCCTAAAATCATCTTCATTTTTAACACTTATTTAAATCACCTAAATTCTATCCTATTTAATAAAAAATAATCTATTACCCTATCAATTTCATAAACAAATCCTATTATTTAATTCTTTTACAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:13993:1056_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_7B_GA_converted 153244241 1 141M = 153244284 184 AACTAAATTCTCTATAAATCTAATATAAAAATCAATTAAATAATCTAATATATTTTCTTCCCTAAAATCATCTTCATTTTTAACACTTATTTAAATCACCTAAATTCTATCCTATTTAATAAAAAATAATCTATTACCCTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:1T139 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:46781:1042_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_8B_GA_converted 94145035 32 141M = 94144960 -216 TCATAAATAAATATTAAAACCCTTAACTAATTTACATTATCAAAATTACCAATTTACACACACATATACATACACTTCTTTTTAATTAAATAATACTAAAATATTTATAACTATCTAATTTATAAAATCAAAAAATTAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-36 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:46781:1042_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_8B_GA_converted 94144960 32 141M = 94145035 216 ATTACAACATTTATTCACAAACTTTAAAATCAACCTAACTTTTTTATTATTCATTAAAATAACTTAATATTCATATCATAAATAAATATTAAAACCCTTAACTAATTTACATTATCAAAATTACCAATTTACACACACATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-30 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:39516:1042_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_1B_GA_converted 90944069 42 141M = 90944014 -196 AATCTACAAACCCTATAAACCCTACTTTATCACATCAAAACTTATACTATTTAAAATTTATTTTCATACCATACAAAAATTTTTATTTATTCATAAATATTTTTTTTTAAATTCAATAACATTACAAAATAAATAAACATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:21T119 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:39516:1042_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_1B_GA_converted 90944014 42 141M = 90944069 196 AAAAATTTTAAAACAAAAATTAAAAAAAATACCTACTTTTTAACATAAAAAATAAAATCTACAAACCCTATAAACCCTACTTTATCACATCAAAACTTATACTATTTAAAATTTATTTTCATACCATACAAAAATTTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:76T64 YS:i:-6 YT:Z:CP >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:29938:1042_1:N:0:TGAGTACT+GNCAATAA/1 83 Chromosome_1B_GA_converted 110242932 6 104M2D37M = 110242898 -177 AAAAACTTTCTAACATAATATAAATTCAAATTTACAAAAACCATATCCTCCAAAAATAAATTAAAACCATAATAAAAACTATAATTTTACATACAAATATATATAAATTCTTCTAATATAAACCAAAATAACTCAAATAAA IIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-29 XS:i:-26 XN:i:0 XM:i:3 XO:i:1 XG:i:2 NM:i:5 MD:Z:45A35C22^AA3A33 YS:i:-18 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29938:1042_2:N:0:TGAGTACT+GNCAATAA/2 163 Chromosome_1B_GA_converted 110242898 6 141M = 110242932 177 AAAACCATTAAACCAAAAAAATTCACATTTACTTAAAAACTTTCTAACATAATATAAATTCAAATTTACAAAAACCATATCCTCCAAAAATAAATTAAAACCATAATAAAAACTATAATTTTACATACAAATATATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-18 XS:i:-20 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:32A46A35C25 YS:i:-29 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:13863:1056_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_4A_GA_converted 6500079 42 141M = 6499998 -222 CACCATACAAATATTAAAATAACTCATTACACTAAAATTTTATTTAATAACTCCTTTAATCACCTCACATAAATTATAATTTAAAAACTTATATCACTTTTTCAATAATAAAATAATACTTCAAACAAAATATTTTAACAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:13863:1056_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_4A_GA_converted 6499998 42 141M = 6500079 222 AAAACTTCTTACACAACATATTAATTAATAAATTAAATATTTTTTCACAAAATTTATCTAAATTTTCTTCAAAATTAAAAACACCATACAAATATTAAAATAACTCATTACACTAAAATTTTATTTAATAACTCCTTTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:24954:1042_1:N:0:TGAGTACT+GNCAATAA/1 83 Chromosome_7B_GA_converted 38773985 0 126M2D15M = 38773950 -178 AAAACTAAAACAAAATTTTAACTTTAAACACTTCACACATTATTTAATATTTTAATCCCCACAAAACTCTAATACAATTTTTATTCACTAAATAAACTATACATATTTTAAATTTAAAAATTAAATTTTTCTCTAAATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-71 XS:i:-71 XN:i:0 XM:i:10 XO:i:1 XG:i:2 NM:i:12 MD:Z:25C5A1T16A5T1T24C20T17T3^TA4A10 YS:i:-60 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:24954:1042_2:N:0:TGAGTACT+GNCAATAA/2 163 Chromosome_7B_GA_converted 38773950 0 141M = 38773985 178 TTATCAACAAAAAATCAAATTATAACTACTTTAATAAAACTAAAACAAAATTTTAACTTTAAACACTTCACACATTATTTAATATTTTAATCCCCACAAAACTCTAATACAATTTTTATTCACTAAATAAACTATACATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII AS:i:-60 XS:i:-60 XN:i:0 XM:i:10 XO:i:0 XG:i:0 NM:i:10 MD:Z:21C8C29C5A1T16A5T1T24C20T1 YS:i:-71 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:12326:1056_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 AATTTAATAAATAAAGATAAAAGTTTGAGATATTTGTTAATAAGTGTTAATGATGATTATTTTTTAATGGTTTGGTTGTGATTATTTTTGGTATAAGGAATGGTATTGATTTTTTTTAAAAAAAAAGAAATTGTTTTGTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:12326:1056_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AATTATTAAATTCAAAATATAACTTACTAAAAAATTTATTATCAAATTTATCACCACTATATCAACTTATTTTAATTAAACTTATAATCTTACTTTTTCTTTTTAAATAACAAAACAATTTCTTTTTTTTTAAAAAAAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:10142:1056_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 ATTGGGAAATTTTTTTATTGGTGTAAGTGGGATTTGAATTTGTGTTGATAGAGTTGAGAGGTTGTGTGATTTTGAGTGTAATGTTTTAATTATTTGGTTATGGAGGTTTTATATGAGAAGATATTAGTAGTATTGTTATAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:10142:1056_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAAAACATCAAATTTTTTTTAACTCTCTAACCCTCATTATAACCCCATCCCTACCAAACAAAATCATAACTTAACCAATTTTAAATCCATACAATATAAAAATACATTTATAACAATACTACAAATATCTTCTCATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.8 and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.3 and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.4 and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.2 and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.7 and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.1 and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.6 and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.5 and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.5 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2252:8119:10388_1:N:0:TGAGTACT+GACAATAA Chromosome_9B 91966292 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2358:38165:8931_1:N:0:TGAGTACT+GACAATAA Chromosome_9B 91966292 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1691291 (35.26%) aligned concordantly 0 times 1100143 (22.93%) aligned concordantly exactly 1 time 2005599 (41.81%) aligned concordantly >1 times 64.74% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1693544 (35.30%) aligned concordantly 0 times 1099002 (22.91%) aligned concordantly exactly 1 time 2004487 (41.79%) aligned concordantly >1 times 64.70% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 2681755 Mapping efficiency: 55.9% Sequence pairs with no alignments under any condition: 616837 Sequence pairs did not map uniquely: 1498441 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1341635 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1340120 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 118459839 Total methylated C's in CpG context: 2804641 Total methylated C's in CHG context: 121519 Total methylated C's in CHH context: 537600 Total methylated C's in Unknown context: 14307 Total unmethylated C's in CpG context: 11596423 Total unmethylated C's in CHG context: 20109308 Total unmethylated C's in CHH context: 83290348 Total unmethylated C's in Unknown context: 127904 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.1% 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1690718 (35.25%) aligned concordantly 0 times 1101305 (22.96%) aligned concordantly exactly 1 time 2005010 (41.80%) aligned concordantly >1 times 64.75% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1692093 (35.27%) aligned concordantly 0 times 1099681 (22.92%) aligned concordantly exactly 1 time 2005259 (41.80%) aligned concordantly >1 times 64.73% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 2682236 Mapping efficiency: 55.9% Sequence pairs with no alignments under any condition: 614720 Sequence pairs did not map uniquely: 1500077 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1343045 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1339190 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 118509312 Total methylated C's in CpG context: 2807516 Total methylated C's in CHG context: 121186 Total methylated C's in CHH context: 536825 Total methylated C's in Unknown context: 14007 Total unmethylated C's in CpG context: 11617323 Total unmethylated C's in CHG context: 20112288 Total unmethylated C's in CHH context: 83314174 Total unmethylated C's in Unknown context: 128005 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% 4797034 reads; of these: 4797034 (100.00%) were paired; of these: 1689774 (35.23%) aligned concordantly 0 times 1100443 (22.94%) aligned concordantly exactly 1 time 2006817 (41.83%) aligned concordantly >1 times 64.77% overall alignment rate 4797034 reads; of these: 4797034 (100.00%) were paired; of these: 1691497 (35.26%) aligned concordantly 0 times 1101171 (22.96%) aligned concordantly exactly 1 time 2004366 (41.78%) aligned concordantly >1 times 64.74% overall alignment rate Processed 4797034 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797034 Number of paired-end alignments with a unique best hit: 2686264 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 613637 Sequence pairs did not map uniquely: 1497133 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1345205 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1341059 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 118674816 Total methylated C's in CpG context: 2815892 Total methylated C's in CHG context: 121394 Total methylated C's in CHH context: 538780 Total methylated C's in Unknown context: 14162 Total unmethylated C's in CpG context: 11624275 Total unmethylated C's in CHG context: 20140201 Total unmethylated C's in CHH context: 83434274 Total unmethylated C's in Unknown context: 128648 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1688967 (35.21%) aligned concordantly 0 times 1101581 (22.96%) aligned concordantly exactly 1 time 2006485 (41.83%) aligned concordantly >1 times 64.79% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1691344 (35.26%) aligned concordantly 0 times 1101823 (22.97%) aligned concordantly exactly 1 time 2003866 (41.77%) aligned concordantly >1 times 64.74% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1693080 (35.29%) aligned concordantly 0 times 1099508 (22.92%) aligned concordantly exactly 1 time 2004445 (41.79%) aligned concordantly >1 times 64.71% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1692475 (35.28%) aligned concordantly 0 times 1100649 (22.94%) aligned concordantly exactly 1 time 2003909 (41.77%) aligned concordantly >1 times 64.72% overall alignment rate Processed 4797033 sequences in total Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 2686291 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 613868 Sequence pairs did not map uniquely: 1496874 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1346363 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1339928 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 118679983 Total methylated C's in CpG context: 2815952 Total methylated C's in CHG context: 121867 Total methylated C's in CHH context: 537740 Total methylated C's in Unknown context: 14368 Total unmethylated C's in CpG context: 11634532 Total unmethylated C's in CHG context: 20134592 Total unmethylated C's in CHH context: 83435300 Total unmethylated C's in Unknown context: 128617 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.0% Successfully deleted the temporary files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 2684626 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 615179 Sequence pairs did not map uniquely: 1497228 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1344034 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1340592 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 118581142 Total methylated C's in CpG context: 2806430 Total methylated C's in CHG context: 120889 Total methylated C's in CHH context: 538894 Total methylated C's in Unknown context: 14477 Total unmethylated C's in CpG context: 11632470 Total unmethylated C's in CHG context: 20126115 Total unmethylated C's in CHH context: 83356344 Total unmethylated C's in Unknown context: 129004 C methylated in CpG context: 19.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.1% 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1688998 (35.21%) aligned concordantly 0 times 1100301 (22.94%) aligned concordantly exactly 1 time 2007734 (41.85%) aligned concordantly >1 times 64.79% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1692882 (35.29%) aligned concordantly 0 times 1099455 (22.92%) aligned concordantly exactly 1 time 2004696 (41.79%) aligned concordantly >1 times 64.71% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 2684607 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 614109 Sequence pairs did not map uniquely: 1498317 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1343644 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1340962 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 118615327 Total methylated C's in CpG context: 2810925 Total methylated C's in CHG context: 121040 Total methylated C's in CHH context: 539144 Total methylated C's in Unknown context: 14265 Total unmethylated C's in CpG context: 11615430 Total unmethylated C's in CHG context: 20129609 Total unmethylated C's in CHH context: 83399179 Total unmethylated C's in Unknown context: 128200 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.0% 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1688602 (35.20%) aligned concordantly 0 times 1100638 (22.94%) aligned concordantly exactly 1 time 2007793 (41.85%) aligned concordantly >1 times 64.80% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1690897 (35.25%) aligned concordantly 0 times 1099593 (22.92%) aligned concordantly exactly 1 time 2006543 (41.83%) aligned concordantly >1 times 64.75% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 2685689 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 612957 Sequence pairs did not map uniquely: 1498387 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1344449 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1341240 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 118617550 Total methylated C's in CpG context: 2806238 Total methylated C's in CHG context: 121734 Total methylated C's in CHH context: 537209 Total methylated C's in Unknown context: 14160 Total unmethylated C's in CpG context: 11626986 Total unmethylated C's in CHG context: 20128871 Total unmethylated C's in CHH context: 83396512 Total unmethylated C's in Unknown context: 128242 C methylated in CpG context: 19.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% Now waiting for all child processes to complete 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1689617 (35.22%) aligned concordantly 0 times 1098709 (22.90%) aligned concordantly exactly 1 time 2008707 (41.87%) aligned concordantly >1 times 64.78% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 1689700 (35.22%) aligned concordantly 0 times 1099368 (22.92%) aligned concordantly exactly 1 time 2007965 (41.86%) aligned concordantly >1 times 64.78% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 2686523 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 613656 Sequence pairs did not map uniquely: 1496854 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1344522 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1342001 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 118681013 Total methylated C's in CpG context: 2816828 Total methylated C's in CHG context: 121707 Total methylated C's in CHH context: 538854 Total methylated C's in Unknown context: 14094 Total unmethylated C's in CpG context: 11616925 Total unmethylated C's in CHG context: 20140596 Total unmethylated C's in CHH context: 83446103 Total unmethylated C's in Unknown context: 127655 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.9% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 19188132. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.1 /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.1 /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.2 /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.2 /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.3 /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.3 /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.4 /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.4 /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.5 /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.5 /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.6 /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.6 /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.7 /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.7 /tmp/13-wgbs-Pum1-1351037/Pum1_R1.fq.gz.temp.8 /tmp/13-wgbs-Pum1-1351037/Pum1_R2.fq.gz.temp.8 Now merging BAM files Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.2_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.3_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.4_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.5_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.6_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.7_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Pum1_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1_bismark_bt2_PE_report.txt Now merging temporary reports Pum1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Pum1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 38376265 Number of paired-end alignments with a unique best hit: 21477991 Mapping efficiency: 56.0% Sequence pairs with no alignments under any condition: 4914963 Sequence pairs did not map uniquely: 11983311 Sequence pairs which were discarded because genomic sequence could not be extracted: 2 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 10752897 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 10725092 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 948818982 Total methylated C's in CpG context: 22484422 Total methylated C's in CHG context: 971336 Total methylated C's in CHH context: 4305046 Total methylated C's in Unknown context: 113840 Total unmethylated C's in CpG context: 92964364 Total unmethylated C's in CHG context: 161021580 Total unmethylated C's in CHH context: 667072234 Total unmethylated C's in Unknown context: 1026275 C methylated in CpG context: 19.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 10.0% Deleting temporary report files... Pum1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 56m 24s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs/bismark/Pum1_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs/bismark/Pum1_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs/bismark/Pum1_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Pum1_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs/bismark/Pum1_pe.bam: 21477989 Total number duplicated alignments removed: 1502326 (6.99%) Duplicated alignments were found at: 1396857 different position(s) Total count of deduplicated leftover sequences: 19975663 (93.01% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_1B LN:231619483 skipping header line: @SQ SN:Chromosome_5B LN:125625032 skipping header line: @SQ SN:Chromosome_6B LN:129267145 skipping header line: @SQ SN:Chromosome_7B LN:183991082 skipping header line: @SQ SN:Chromosome_8B LN:108828118 skipping header line: @SQ SN:Chromosome_9B LN:91966420 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Pum1_R1.fq.gz -2 output/13-wgbs/trimmed/Pum1_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Pum1-3530457 --output_dir output/13-wgbs/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Pum1_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs/dedup/Pum1_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs/dedup/Pum1_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum1_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum1_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs/dedup/Pum1_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_1B LN:231619483 skipping SAM header line: @SQ SN:Chromosome_5B LN:125625032 skipping SAM header line: @SQ SN:Chromosome_6B LN:129267145 skipping SAM header line: @SQ SN:Chromosome_7B LN:183991082 skipping SAM header line: @SQ SN:Chromosome_8B LN:108828118 skipping SAM header line: @SQ SN:Chromosome_9B LN:91966420 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome -1 output/13-wgbs/trimmed/Pum1_R1.fq.gz -2 output/13-wgbs/trimmed/Pum1_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Pum1-3530457 --output_dir output/13-wgbs/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/bismark/Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs/bismark/Pum1_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs/dedup/Pum1_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.8 Processed 19975663 lines in total Total number of methylation call strings processed: 39951326 Final Cytosine Methylation Report ================================= Total number of C's analysed: 721909696 Total methylated C's in CpG context: 17152846 Total methylated C's in CHG context: 825343 Total methylated C's in CHH context: 3659336 Total C to T conversions in CpG context: 70866488 Total C to T conversions in CHG context: 122425814 Total C to T conversions in CHH context: 506979869 C methylated in CpG context: 19.5% C methylated in non-CpG context: 0.7% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Pum1_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 141 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 141 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum1_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum1_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum1_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/Non_CpG_context_Pum1_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Pum1_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/CpG_context_Pum1_pe.deduplicated.txt.gz Writing bedGraph to file: Pum1_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Pum1_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Now writing methylation information for file >>CpG_context_Pum1_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Pum1_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_1B.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_5B.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_6B.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_7B.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_8B.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_9B.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs/methylation/Pum1_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome/ Couldn't find files ending in .fa, trying .fa.gz instead chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Pum1.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Pum1.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1412505 different covered positions) Writing cytosine report for chromosome Chromosome_1B (stored 1821888 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3110534 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 3016474 different covered positions) Writing cytosine report for chromosome Chromosome_5B (stored 2953860 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2584133 different covered positions) Writing cytosine report for chromosome Chromosome_6B (stored 2869718 different covered positions) Writing cytosine report for chromosome Chromosome_7B (stored 1489478 different covered positions) Writing cytosine report for chromosome Chromosome_8B (stored 2890166 different covered positions) Writing cytosine report for last chromosome Chromosome_9B (stored 2734460 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Pum1.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Pum1.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome/ chr Chromosome_10A (41401248 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_1B (231619483 bp) chr Chromosome_5B (125625032 bp) chr Chromosome_6B (129267145 bp) chr Chromosome_7B (183991082 bp) chr Chromosome_8B (108828118 bp) chr Chromosome_9B (91966420 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Could not find genomic nucleotide frequency table in the genome folder, calculating genomic frequencies (this may take several minutes depending on genome size) ... ==================================================================================================================================================================== Processing chromosome >> Chromosome_1B << Processing chromosome >> Chromosome_4A << Processing chromosome >> Chromosome_2A << Processing chromosome >> Chromosome_7B << Processing chromosome >> Chromosome_8B << Processing chromosome >> Chromosome_9B << Processing chromosome >> Chromosome_5B << Processing chromosome >> Chromosome_10A << Processing chromosome >> Chromosome_6B << Processing chromosome >> Chromosome_6A << Writing genomic nucleotide frequencies to the file >data/13-wgbs-genome/genomic_nucleotide_frequencies.txt< for future re-use Writing count of (di-)nucleotide: A 378413849 Writing count of (di-)nucleotide: AA 128492079 Writing count of (di-)nucleotide: AC 68264877 Writing count of (di-)nucleotide: AG 62424886 Writing count of (di-)nucleotide: AT 119230832 Writing count of (di-)nucleotide: C 211781786 Writing count of (di-)nucleotide: CA 80836853 Writing count of (di-)nucleotide: CC 42358709 Writing count of (di-)nucleotide: CG 26104181 Writing count of (di-)nucleotide: CT 62481783 Writing count of (di-)nucleotide: G 211810957 Writing count of (di-)nucleotide: GA 67679435 Writing count of (di-)nucleotide: GC 33452245 Writing count of (di-)nucleotide: GG 42378301 Writing count of (di-)nucleotide: GT 68300800 Writing count of (di-)nucleotide: T 378309330 Writing count of (di-)nucleotide: TA 101400983 Writing count of (di-)nucleotide: TC 67705770 Writing count of (di-)nucleotide: TG 80903356 Writing count of (di-)nucleotide: TT 128294772 Calculating read frequencies from file 'output/13-wgbs/dedup/Pum1_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Printing nucleotide stats to >> output/13-wgbs/dedup/Pum1_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1674607836 34.52 378413849 32.06 4.425 C 773107031 15.94 211781786 17.94 3.650 G 857417613 17.67 211810957 17.95 4.048 T 1546279595 31.87 378309330 32.05 4.087 AA 610997778 12.69 128492079 10.89 4.755 AC 265183944 5.51 68264877 5.78 3.885 AG 268436666 5.57 62424886 5.29 4.300 AT 518414203 10.76 119230832 10.10 4.348 CA 319409004 6.63 80836853 6.85 3.951 CC 133887397 2.78 42358709 3.59 3.161 CG 93687800 1.95 26104181 2.21 3.589 CT 220227904 4.57 62481783 5.29 3.525 GA 294125852 6.11 67679435 5.73 4.346 GC 124855008 2.59 33452245 2.83 3.732 GG 155806851 3.23 42378301 3.59 3.677 GT 276531524 5.74 68300800 5.79 4.049 TA 437856512 9.09 101400983 8.59 4.318 TC 243608146 5.06 67705770 5.74 3.598 TG 333355306 6.92 80903356 6.85 4.120 TT 520293596 10.80 128294772 10.87 4.055 [Fri Oct 9 10:15:11 PDT 2026] Pum1 done