[Sat Oct 10 10:02:32 PDT 2026] Rio3 (Rio/Rio_Pudeto) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 33380360 total bases: 5040434360 Q20 bases: 4978714428(98.7755%) Q30 bases: 4810722503(95.4426%) Q40 bases: 4810722503(95.4426%) Read2 before filtering: total reads: 33380360 total bases: 5040434360 Q20 bases: 4968891911(98.5806%) Q30 bases: 4800151010(95.2329%) Q40 bases: 4800151010(95.2329%) Read1 after filtering: total reads: 32773197 total bases: 4516123672 Q20 bases: 4476837799(99.1301%) Q30 bases: 4349633152(96.3134%) Q40 bases: 4349633152(96.3134%) Read2 after filtering: total reads: 32773197 total bases: 4518031814 Q20 bases: 4475741533(99.064%) Q30 bases: 4347639525(96.2286%) Q40 bases: 4347639525(96.2286%) Filtering result: reads passed filter: 65546394 reads failed due to low quality: 506754 reads failed due to too many N: 1136 reads failed due to too short: 706436 reads with adapter trimmed: 9542459 bases trimmed due to adapters: 196520334 Duplication rate: 3.91718% Insert size peak (evaluated by paired-end reads): 184 JSON report: output/13-wgbs-hapa/fastp/Rio3.fastp.json HTML report: output/13-wgbs-hapa/fastp/Rio3.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP3 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP3 (paired)_R2.fastq.gz -o output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz -O output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs-hapa/fastp/Rio3.fastp.json --html output/13-wgbs-hapa/fastp/Rio3.fastp.html fastp v1.0.1, time used: 63 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome-hapa/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/ Using temp directory: /tmp/13-wgbs-Rio3-2540785 Temporary files will be written into the directory: /tmp/13-wgbs-Rio3-2540785/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz for PID: 2541589 and offset 8 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.3 to /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.5 to /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.7 to /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.1 to /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.4 to /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.6 to /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz for PID: 2541589 and offset 8 (sequences written out: 4096649) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.8 to /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4096650) Using the subset file >/tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio3_R1.fq.gz.temp.2 to /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.2_C_to_T.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.5 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.5 to /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.3 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.3 to /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.7 (4096649 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.7 to /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.1 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.1 to /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.6 (4096649 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.6 to /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.4 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.4 to /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.8 (4096649 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.8 to /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Rio3_R1.fq.gz.temp.2 (4096650 sequences in total) Writing a G -> A converted version of the input file Rio3_R2.fq.gz.temp.2 to /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.2_G_to_A.fastq Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.5 (4096650 sequences in total) Input files are Rio3_R1.fq.gz.temp.5_C_to_T.fastq and Rio3_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.3 (4096650 sequences in total) Input files are Rio3_R1.fq.gz.temp.3_C_to_T.fastq and Rio3_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.7 (4096649 sequences in total) Input files are Rio3_R1.fq.gz.temp.7_C_to_T.fastq and Rio3_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.1 (4096650 sequences in total) Input files are Rio3_R1.fq.gz.temp.1_C_to_T.fastq and Rio3_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:34485:1042_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 GAGGTTAAGGAAGGGGATAAAGAAGAGTTTAATATTTTGTAGTAAGTTAAATAAAGATGGTATATTAGTGATAGAAAATGATATTATATTGGTGATGAGTGATTTTAATGGTAAGGTTGGTGTAGATAATAGAGATAGAGA 999IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I9III9IIIIIIIII999IIIIII9IIIIIII9IIIIIIIIII9IIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:34485:1042_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 TTATCATTCACCTCACCTATTCCATACATTCCCAATATCATATACTCTCTATCTCTATTATCTACACCAACCTTACCATTAAAATCACTCATCACCAATATAATATCATTTTCTATCACTAATATACCATCTTTATTTAAC II9*I9I9IIII9I9IIIIII99I9II*I99III9*I9*99*I9*II99I9*9999*99*9I9*999II9I9*IIIIIII*I9III*9IIIIII99I9III99I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:32494:1042_1:N:0:AGCGGCAA+GNGATGTA/1 99 Chromosome_10A_CT_converted 3321452 6 141M = 3321325 -268 ATGATGAAGTTTGGATATATGATGAAGTTTGGTTATATAATGAAGTTTGGATATATGATGAAGTTTGATTATATGATGAAGTTTGATTATATAATGAAGTTTGATTATAGGATGAAGTTTGATTATATGATGAAGTTTGGA I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIII9IIIIII AS:i:-18 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:2A99A6T31 YS:i:-35 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:32494:1042_2:N:0:AGCGGCAA+GNGATGTA/2 147 Chromosome_10A_CT_converted 3321325 6 32M2D109M = 3321452 268 TAATGAAGTTTGGTTATATAATGAAGTTTGGTTATATGATGAAGTTTGATTATATGATGAAGTTTGATTATATGATGAAGTTTGGTTATATAATGAAGTTTGATTATGTAATGAAGTTTGGTTATATAATGAAGTTTGGAT IIIIIIII99IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-35 XS:i:-48 XN:i:0 XM:i:4 XO:i:1 XG:i:2 NM:i:6 MD:Z:19G12^TA16G35A22A33 YS:i:-18 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.6 (4096649 sequences in total) Input files are Rio3_R1.fq.gz.temp.6_C_to_T.fastq and Rio3_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.4 (4096650 sequences in total) Input files are Rio3_R1.fq.gz.temp.4_C_to_T.fastq and Rio3_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.8 (4096649 sequences in total) Input files are Rio3_R1.fq.gz.temp.8_C_to_T.fastq and Rio3_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:48383:1042_1:N:0:AGCGGCAA+GTGATGTA/1 99 Chromosome_3A_CT_converted 68861616 0 7M2I94M8I6M = 68861606 -117 ATTTTTTAATATAAAGAAATTTAAATTTGGTGTTAATGTAAATGATTGGTGTGATTTTGTAAAATTGATTTTTGATATTATTGTTGTGAATTATGTGGTATAATTTTTTTTTTTTTT II9IIII9III99IIIII9IIIIIII9IIIIIII9I9IIII9III*99IIIII9I*II*I9IIIIIIII99III*I9I9I**99*I9*999I9999I9I9I9*I99I**III*9I99 AS:i:-70 XS:i:-70 XN:i:0 XM:i:5 XO:i:2 XG:i:10 NM:i:15 MD:Z:7G70A22A1A1A1 YS:i:-29 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:48383:1042_2:N:0:AGCGGCAA+GTGATGTA/2 147 Chromosome_3A_CT_converted 68861606 0 17M2I98M = 68861616 117 AAGATAAGGAATTTTTTAATATAAAGAAATTTAAATTTGGTGTTAATGTAAATGATTGGTGTGATTTTGTAAAATTGATTTTTGATATTAATGTTGTGAATTATGTGGTATAATTTT II99IIIIIIIIII9IIIIII999IIIIIIIIII*99IIIIII99*IIIIIIIIIIIII999I9II9I9I99*99III9I9II9II*9II*II**III9IIII9*9II9**II9*** AS:i:-29 XS:i:-29 XN:i:0 XM:i:3 XO:i:1 XG:i:2 NM:i:5 MD:Z:17G93A1A1 YS:i:-70 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:25424:1042_1:N:0:AGCGGCAA+GNGATGTA/1 77 * 0 0 * * 0 0 AGGTGGAAAATAAATTATGTTTTTTTTTATGTGTATGAATGTTTTTGATATAAAAAATAAATATTTAAAGTGATATTATTGTGAAGAGAAAATTTTTTAAAAATTTGATTTAGGGGTTATAAATTTTATAATTGGTAGTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:25424:1042_2:N:0:AGCGGCAA+GNGATGTA/2 141 * 0 0 * * 0 0 AAAAAAAAACTACCAATTATAAAATTTATAACCCCTAAATCAAATTTTTAAAAAATTTTCTCTTCACAATAATATCACTTTAAATATTTATTTTTTATATCAAAAACATTCATACACATAAAAAAAAACATAATTTATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:32559:1042_1:N:0:AGCGGCAA+GNGATGTA/1 77 * 0 0 * * 0 0 TGTTTTTTTTTTTATTTATGTGGATTTAGTTGTAGGATAGTTGAAAAATTGTTTAAGTGGTTATAAATAATAGATAATTAATTAATTTTTTTTTTGTTGTTTTAAAATATATTTGTGTGTTGTAGTTTAAAAGATTGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIII9IIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:32559:1042_2:N:0:AGCGGCAA+GNGATGTA/2 141 * 0 0 * * 0 0 TAATAAATATATCATAAATATTAATAAATTCATACAAAACATAAATTTATTAAAAATACTCATATCTTAAAAAAATTAAAAACAATCTTTTAAACTACAACACACAAATATATTTTAAAACAACAAAAAAAAAATTAATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:42736:1042_1:N:0:AGCGGCAA+GTGATGTA/1 99 Chromosome_3A_CT_converted 81046297 1 141M = 81046413 257 TTATTTTGTAGAATATTGAATATATTTTTTTGTATGTAGAATGTGTATTGATATAGTAGTTTATATTTTTTAAAATTATTTTGATTATTTTTTTTTTTTAATTTTTTTAAAATTTTTGTTTTAAATTTAGTTATTGTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIII9I AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:42736:1042_2:N:0:AGCGGCAA+GTGATGTA/2 147 Chromosome_3A_CT_converted 81046413 1 141M = 81046297 -257 TGTTTTAAATTTAGTTATTGTTTATTATGTTAAGAAATTTTTAGTAAAATTGATAGTATAGAAAAATTGTTATAAATTAGTGATTGTAATTAAGAGATAAGTGATGGTTGTTATTAATTAGTATGTAAGGAGGTTTTATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:140G0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:50260:1042_1:N:0:AGCGGCAA+GTGATGTA/1 99 Chromosome_4A_CT_converted 22313857 42 141M = 22313885 169 TTTAAATTTTAATTGTTATATTTTATTGATAAAAAAATAGATAATATTAGATTATATGAAATATTTTTAGATTAAATAATTTAAAATATATTTAAATAATTGTTAAGAAATGTTTGTTTATTTGGAATTAGAAAAATTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:50260:1042_2:N:0:AGCGGCAA+GTGATGTA/2 147 Chromosome_4A_CT_converted 22313885 42 141M = 22313857 -169 ATAAAAAAATAGATAATATTAGATTATATGAAATATTTTTAGATTAAATAATTTAAAATATATTTAAATAATTGTTAAGAAATGTTTGTTTATTTGGAATTAGAAAAATTTTAGAAAAAAAGTATTTTAGATAATTTATTA IIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Rio3_R2.fq.gz.temp.2 (4096650 sequences in total) Input files are Rio3_R1.fq.gz.temp.2_C_to_T.fastq and Rio3_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:30763:1042_1:N:0:AGCGGCAA+GNGATGTA/1 99 Chromosome_9A_CT_converted 44674023 42 141M = 44674081 208 TTATTTGGTTATTTTTTTTGATAAAATGAATTGTTTTGTGTAAATAATTTTTAAAATTTATGTGGTTAAGGTATTATGGGTTAGGAAAATGATTGTGTATTATATTATGTATGTTTATTGATGATGGTGTATATAAAGGAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-32 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:30763:1042_2:N:0:AGCGGCAA+GNGATGTA/2 147 Chromosome_9A_CT_converted 44674081 42 86M9D55M = 44674023 -208 TATGTGGTTAAGGTATTATGGGTTAGGAAAATGATTGTGTATTATATTATGTATGTTTATTGATGATGGTGTATATAAAGGAGGGAGGGGGGGGGAGGTTTAGTGTGTTATTAAAAGATTTATTTATTTATGTTTTAAGGA IIIIIIIIIIIIIIIIIIIIIII*IIIIII9IIIIIIIII9I99I9I**9II99II9I9**I99I999I9IIIII99I9I99I9*99**9I*9**9**IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-32 XN:i:0 XM:i:0 XO:i:1 XG:i:9 NM:i:9 MD:Z:86^GGGGGGGGG55 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:42736:1042_1:N:0:AGCGGCAA+GTGATGTA/1 83 Chromosome_6A_GA_converted 36936191 6 42M1D99M = 36936075 -258 ATAAACAATAACTAAATTTAAAACAAAAATTTTAAAAAAATTAAAAAAAAAAAATAATCAAAATAATTTTAAAAAATATAAACTACTATATCAATACACATTCTACATACAAAAAAATATATTCAATATTCTACAAAATAA I9IIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-8 XS:i:-11 XN:i:0 XM:i:0 XO:i:1 XG:i:1 NM:i:1 MD:Z:42^A99 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:42736:1042_2:N:0:AGCGGCAA+GTGATGTA/2 163 Chromosome_6A_GA_converted 36936075 6 141M = 36936191 258 AAATAAAACCTCCTTACATACTAATTAATAACAACCATCACTTATCTCTTAATTACAATCACTAATTTATAACAATTTTTCTATACTATCAATTTTACTAAAAATTTCTTAACATAATAAACAATAACTAAATTTAAAACA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:0C140 YS:i:-8 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:32494:1042_1:N:0:AGCGGCAA+GNGATGTA/1 83 Chromosome_8A_GA_converted 7676722 0 141M = 7676721 -142 TCCAAACTTCATCATATAATCAAACTTCATCCTATAATCAAACTTCATTATATAATCAAACTTCATCATATAATCAAACTTCATCATATATCCAAACTTCATTATATAACCAAACTTCATCATATATCCAAACTTCATCAT IIIIII9IIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I AS:i:-48 XS:i:-60 XN:i:0 XM:i:8 XO:i:0 XG:i:0 NM:i:8 MD:Z:19C11A5C8T5A37A35A11T2 YS:i:-60 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:32494:1042_2:N:0:AGCGGCAA+GNGATGTA/2 163 Chromosome_8A_GA_converted 7676721 0 141M = 7676722 142 ATCCAAACTTCATTATATAACCAAACTTCATTACATAATCAAACTTCATTATATAACCAAACTTCATCATATAATCAAACTTCATCATATAATCAAACTTCATCATATAACCAAACTTCATTATATAACCAAACTTCATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII99IIIIIIII AS:i:-60 XS:i:-60 XN:i:0 XM:i:10 XO:i:0 XG:i:0 NM:i:10 MD:Z:13C17C1T4C8T5A2T35C10T17C19 YS:i:-48 YT:Z:CP >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:50260:1042_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 TTTAAATTTTAATTGTTATATTTTATTGATAAAAAAATAGATAATATTAGATTATATGAAATATTTTTAGATTAAATAATTTAAAATATATTTAAATAATTGTTAAGAAATGTTTGTTTATTTGGAATTAGAAAAATTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:50260:1042_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 TAATAAATTATCTAAAATACTTTTTTTCTAAAATTTTTCTAATTCCAAATAAACAAACATTTCTTAACAATTATTTAAATATATTTTAAATTATTTAATCTAAAAATATTTCATATAATCTAATATTATCTATTTTTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:32559:1042_1:N:0:AGCGGCAA+GNGATGTA/1 77 * 0 0 * * 0 0 TGTTTTTTTTTTTATTTATGTGGATTTAGTTGTAGGATAGTTGAAAAATTGTTTAAGTGGTTATAAATAATAGATAATTAATTAATTTTTTTTTTGTTGTTTTAAAATATATTTGTGTGTTGTAGTTTAAAAGATTGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIII9IIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:32559:1042_2:N:0:AGCGGCAA+GNGATGTA/2 141 * 0 0 * * 0 0 TAATAAATATATCATAAATATTAATAAATTCATACAAAACATAAATTTATTAAAAATACTCATATCTTAAAAAAATTAAAAACAATCTTTTAAACTACAACACACAAATATATTTTAAAACAACAAAAAAAAAATTAATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:25424:1042_1:N:0:AGCGGCAA+GNGATGTA/1 83 Chromosome_2A_GA_converted 73601428 40 3M3D138M = 73601425 -147 AAACTACCAATTATAAAATTTATAACCCCTAAATCAAATTTTTAAAAAATTTTCTCTTCACAATAATATCACTTTAAATATTTATTTTTTATATCAAAAACATTCATACACATAAAAAAAAACATAATTTATTTTCCACCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-14 XN:i:0 XM:i:0 XO:i:1 XG:i:3 NM:i:3 MD:Z:3^CTT138 YS:i:-24 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:25424:1042_2:N:0:AGCGGCAA+GNGATGTA/2 163 Chromosome_2A_GA_converted 73601425 40 141M = 73601428 147 AAAAAAAAACTACCAATTATAAAATTTATAACCCCTAAATCAAATTTTTAAAAAATTTTCTCTTCACAATAATATCACTTTAAATATTTATTTTTTATATCAAAAACATTCATACACATAAAAAAAAACATAATTTATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII AS:i:-24 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:0T5C0T0T132 YS:i:-14 YT:Z:CP >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:34485:1042_1:N:0:AGCGGCAA+GTGATGTA/1 77 * 0 0 * * 0 0 GAGGTTAAGGAAGGGGATAAAGAAGAGTTTAATATTTTGTAGTAAGTTAAATAAAGATGGTATATTAGTGATAGAAAATGATATTATATTGGTGATGAGTGATTTTAATGGTAAGGTTGGTGTAGATAATAGAGATAGAGA 999IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I9III9IIIIIIIII999IIIIII9IIIIIII9IIIIIIIIII9IIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:34485:1042_2:N:0:AGCGGCAA+GTGATGTA/2 141 * 0 0 * * 0 0 TTATCATTCACCTCACCTATTCCATACATTCCCAATATCATATACTCTCTATCTCTATTATCTACACCAACCTTACCATTAAAATCACTCATCACCAATATAATATCATTTTCTATCACTAATATACCATCTTTATTTAAC II9*I9I9IIII9I9IIIIII99I9II*I99III9*I9*99*I9*II99I9*9999*99*9I9*999II9I9*IIIIIII*I9III*9IIIIII99I9III99I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:48383:1042_1:N:0:AGCGGCAA+GTGATGTA/1 83 Chromosome_5A_GA_converted 22583479 0 4M8I105M = 22583481 119 AAAAAAAAAAAAAATTATACCACATAATTCACAACAATAATATCAAAAATCAATTTTACAAAATCACACCAATCATTTACATTAACACCAAATTTAAATTTCTTTATATTAAAAAAT 99I9*III**I99I*9I9I9I9999I999*9I*99**I9I9I*III99IIIIIIII9I*II*I9IIIII99*III9IIII9I9IIIIIII9IIIIIII9IIIII99III9IIII9II AS:i:-53 XS:i:-70 XN:i:0 XM:i:4 XO:i:1 XG:i:8 NM:i:12 MD:Z:1T1T1T22T80 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:48383:1042_2:N:0:AGCGGCAA+GTGATGTA/2 163 Chromosome_5A_GA_converted 22583481 0 117M = 22583479 -119 AAAATTATACCACATAATTCACAACATTAATATCAAAAATCAATTTTACAAAATCACACCAATCATTTACATTAACACCAAATTTAAATTTCTTTATATTAAAAAATTCCTTATCTT ***9II**9II9*9IIII9III**II*II9*II9II9I9III99*99I9I9II9I999IIIIIIIIIIIII*99IIIIII99*IIIIIIIIII999IIIIII9IIIIIIIIII99II AS:i:-12 XS:i:-29 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:1T1T113 YS:i:-53 YT:Z:CP >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.6 and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.4 and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.3 and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.8 and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.5 and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.1 and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.7 and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.7 Found first alignment: LH00129:489:23JFWNLT4:8:1101:30763:1042_1:N:0:AGCGGCAA+GNGATGTA/1 77 * 0 0 * * 0 0 TTATTTGGTTATTTTTTTTGATAAAATGAATTGTTTTGTGTAAATAATTTTTAAAATTTATGTGGTTAAGGTATTATGGGTTAGGAAAATGATTGTGTATTATATTATGTATGTTTATTGATGATGGTGTATATAAAGGAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:30763:1042_2:N:0:AGCGGCAA+GNGATGTA/2 141 * 0 0 * * 0 0 TCCTTAAAACATAAATAAATAAATCTTTTAATAACACACTAAACCTCCCCCCCCCTCCCTCCTTTATATACACCATCATCAATAAACATACATAATATAATACACAATCATTTTCCTAACCCATAATACCTTAACCACATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII**9**9*I9**99*9I99I9I99IIIII9I999I99I**9I9II99II9**I9I99I9IIIIIIIII9IIIIII*IIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Rio3_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.2 and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.2 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1119:23345:17282_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973134 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1119:40342:27217_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973144 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1192:3751:26614_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973131 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1231:14405:18137_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973133 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1211:30836:9127_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973130 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1249:46045:26334_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1231:46191:24204_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973136 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1231:14397:18151_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973133 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1246:2230:20505_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973128 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1397:39403:27862_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973125 Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1389:47048:29137_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973129 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1480:38521:4587_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973123 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2234:14769:18599_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2258:32947:13037_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973138 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2158:32292:20982_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973118 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2116:31087:9057_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973133 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2128:6752:23322_1:N:0:AGCGGCAA+GTGATGTA Chromosome_6A 76092827 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2154:34412:8202_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973136 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2169:20675:18319_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973118 Processed 4000000 sequence pairs so far 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1672760 (40.83%) aligned concordantly 0 times 913760 (22.31%) aligned concordantly exactly 1 time 1510130 (36.86%) aligned concordantly >1 times 59.17% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1667946 (40.71%) aligned concordantly 0 times 913594 (22.30%) aligned concordantly exactly 1 time 1515110 (36.98%) aligned concordantly >1 times 59.29% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2779754 Mapping efficiency: 67.9% Sequence pairs with no alignments under any condition: 660084 Sequence pairs did not map uniquely: 656812 Sequence pairs which were discarded because genomic sequence could not be extracted: 5 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1389620 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1390129 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 119498213 Total methylated C's in CpG context: 3148074 Total methylated C's in CHG context: 157370 Total methylated C's in CHH context: 697742 Total methylated C's in Unknown context: 16614 Total unmethylated C's in CpG context: 11536359 Total unmethylated C's in CHG context: 20408334 Total unmethylated C's in CHH context: 83550334 Total unmethylated C's in Unknown context: 124760 C methylated in CpG context: 21.4% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.8% Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2367:24477:15825_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973123 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2323:11201:14045_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973121 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2406:38707:11635_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973119 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1672275 (40.82%) aligned concordantly 0 times 914769 (22.33%) aligned concordantly exactly 1 time 1509606 (36.85%) aligned concordantly >1 times 59.18% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1668022 (40.72%) aligned concordantly 0 times 914089 (22.31%) aligned concordantly exactly 1 time 1514539 (36.97%) aligned concordantly >1 times 59.28% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2779432 Mapping efficiency: 67.8% Sequence pairs with no alignments under any condition: 659481 Sequence pairs did not map uniquely: 657737 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1389303 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1390129 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 119524132 Total methylated C's in CpG context: 3155087 Total methylated C's in CHG context: 157625 Total methylated C's in CHH context: 698922 Total methylated C's in Unknown context: 16095 Total unmethylated C's in CpG context: 11528034 Total unmethylated C's in CHG context: 20406896 Total unmethylated C's in CHH context: 83577568 Total unmethylated C's in Unknown context: 124629 C methylated in CpG context: 21.5% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.4% 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1668158 (40.72%) aligned concordantly 0 times 914584 (22.33%) aligned concordantly exactly 1 time 1513908 (36.95%) aligned concordantly >1 times 59.28% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1673014 (40.84%) aligned concordantly 0 times 913892 (22.31%) aligned concordantly exactly 1 time 1509744 (36.85%) aligned concordantly >1 times 59.16% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2778857 Mapping efficiency: 67.8% Sequence pairs with no alignments under any condition: 660306 Sequence pairs did not map uniquely: 657487 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1389658 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1389195 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 119490988 Total methylated C's in CpG context: 3151689 Total methylated C's in CHG context: 156999 Total methylated C's in CHH context: 698283 Total methylated C's in Unknown context: 16597 Total unmethylated C's in CpG context: 11525397 Total unmethylated C's in CHG context: 20393811 Total unmethylated C's in CHH context: 83564809 Total unmethylated C's in Unknown context: 125813 C methylated in CpG context: 21.5% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.7% Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1672670 (40.83%) aligned concordantly 0 times 914223 (22.32%) aligned concordantly exactly 1 time 1509756 (36.85%) aligned concordantly >1 times 59.17% overall alignment rate Processed 4000000 sequence pairs so far 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1669658 (40.76%) aligned concordantly 0 times 913506 (22.30%) aligned concordantly exactly 1 time 1513485 (36.94%) aligned concordantly >1 times 59.24% overall alignment rate Processed 4096649 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096649 Number of paired-end alignments with a unique best hit: 2780014 Mapping efficiency: 67.9% Sequence pairs with no alignments under any condition: 660360 Sequence pairs did not map uniquely: 656275 Sequence pairs which were discarded because genomic sequence could not be extracted: 2 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1389456 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1390556 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 119488542 Total methylated C's in CpG context: 3147706 Total methylated C's in CHG context: 157366 Total methylated C's in CHH context: 697356 Total methylated C's in Unknown context: 16448 Total unmethylated C's in CpG context: 11537360 Total unmethylated C's in CHG context: 20397502 Total unmethylated C's in CHH context: 83551252 Total unmethylated C's in Unknown context: 125538 C methylated in CpG context: 21.4% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.6% Now waiting for all child processes to complete 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1668483 (40.73%) aligned concordantly 0 times 913449 (22.30%) aligned concordantly exactly 1 time 1514717 (36.97%) aligned concordantly >1 times 59.27% overall alignment rate 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1672463 (40.83%) aligned concordantly 0 times 914133 (22.31%) aligned concordantly exactly 1 time 1510053 (36.86%) aligned concordantly >1 times 59.17% overall alignment rate Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2464:44144:6955_1:N:0:AGCGGCAA+GTGATGTA Chromosome_4A 93973123 Processed 4096649 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096649 Number of paired-end alignments with a unique best hit: 2781210 Mapping efficiency: 67.9% Sequence pairs with no alignments under any condition: 660575 Sequence pairs did not map uniquely: 654864 Sequence pairs which were discarded because genomic sequence could not be extracted: 2 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1390782 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1390426 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 119548253 Total methylated C's in CpG context: 3154002 Total methylated C's in CHG context: 157412 Total methylated C's in CHH context: 700638 Total methylated C's in Unknown context: 16588 Total unmethylated C's in CpG context: 11527302 Total unmethylated C's in CHG context: 20407300 Total unmethylated C's in CHH context: 83601599 Total unmethylated C's in Unknown context: 125517 C methylated in CpG context: 21.5% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.7% 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1669342 (40.75%) aligned concordantly 0 times 914353 (22.32%) aligned concordantly exactly 1 time 1512955 (36.93%) aligned concordantly >1 times 59.25% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1673179 (40.84%) aligned concordantly 0 times 913976 (22.31%) aligned concordantly exactly 1 time 1509495 (36.85%) aligned concordantly >1 times 59.16% overall alignment rate Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2779485 Mapping efficiency: 67.8% Sequence pairs with no alignments under any condition: 660675 Sequence pairs did not map uniquely: 656490 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1390367 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1389115 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 119515458 Total methylated C's in CpG context: 3159250 Total methylated C's in CHG context: 156543 Total methylated C's in CHH context: 698981 Total methylated C's in Unknown context: 16523 Total unmethylated C's in CpG context: 11522034 Total unmethylated C's in CHG context: 20407087 Total unmethylated C's in CHH context: 83571563 Total unmethylated C's in Unknown context: 125851 C methylated in CpG context: 21.5% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.6% Processed 4000000 sequence pairs so far 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1674170 (40.87%) aligned concordantly 0 times 914336 (22.32%) aligned concordantly exactly 1 time 1508144 (36.81%) aligned concordantly >1 times 59.13% overall alignment rate 4096650 reads; of these: 4096650 (100.00%) were paired; of these: 1667227 (40.70%) aligned concordantly 0 times 915163 (22.34%) aligned concordantly exactly 1 time 1514260 (36.96%) aligned concordantly >1 times 59.30% overall alignment rate Processed 4000000 sequence pairs so far Processed 4096650 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096650 Number of paired-end alignments with a unique best hit: 2779019 Mapping efficiency: 67.8% Sequence pairs with no alignments under any condition: 660485 Sequence pairs did not map uniquely: 657146 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1390592 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1388424 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 119472310 Total methylated C's in CpG context: 3151354 Total methylated C's in CHG context: 157396 Total methylated C's in CHH context: 699157 Total methylated C's in Unknown context: 16673 Total unmethylated C's in CpG context: 11524004 Total unmethylated C's in CHG context: 20410833 Total unmethylated C's in CHH context: 83529566 Total unmethylated C's in Unknown context: 126661 C methylated in CpG context: 21.5% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.6% 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1674233 (40.87%) aligned concordantly 0 times 914967 (22.33%) aligned concordantly exactly 1 time 1507449 (36.80%) aligned concordantly >1 times 59.13% overall alignment rate 4096649 reads; of these: 4096649 (100.00%) were paired; of these: 1669347 (40.75%) aligned concordantly 0 times 915254 (22.34%) aligned concordantly exactly 1 time 1512048 (36.91%) aligned concordantly >1 times 59.25% overall alignment rate Processed 4096649 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4096649 Number of paired-end alignments with a unique best hit: 2779738 Mapping efficiency: 67.9% Sequence pairs with no alignments under any condition: 660863 Sequence pairs did not map uniquely: 656048 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1390411 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1389323 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 119526351 Total methylated C's in CpG context: 3149579 Total methylated C's in CHG context: 157183 Total methylated C's in CHH context: 699082 Total methylated C's in Unknown context: 16494 Total unmethylated C's in CpG context: 11538372 Total unmethylated C's in CHG context: 20403443 Total unmethylated C's in CHH context: 83578692 Total unmethylated C's in Unknown context: 126028 C methylated in CpG context: 21.4% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.6% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 16386596. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.1 /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.1 /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.2 /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.2 /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.3 /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.3 /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.4 /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.4 /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.5 /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.5 /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.6 /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.6 /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.7 /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.7 /tmp/13-wgbs-Rio3-2540785/Rio3_R1.fq.gz.temp.8 /tmp/13-wgbs-Rio3-2540785/Rio3_R2.fq.gz.temp.8 Now merging BAM files Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.2_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.3_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.4_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.5_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.6_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.7_bismark_bt2_pe.bam Rio3_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Rio3_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Rio3_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1_bismark_bt2_PE_report.txt Now merging temporary reports Rio3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Rio3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Rio3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 32773197 Number of paired-end alignments with a unique best hit: 22237509 Mapping efficiency: 67.9% Sequence pairs with no alignments under any condition: 5282829 Sequence pairs did not map uniquely: 5252859 Sequence pairs which were discarded because genomic sequence could not be extracted: 23 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 11120189 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 11117297 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 956064247 Total methylated C's in CpG context: 25216741 Total methylated C's in CHG context: 1257894 Total methylated C's in CHH context: 5590161 Total methylated C's in Unknown context: 132032 Total unmethylated C's in CpG context: 92238862 Total unmethylated C's in CHG context: 163235206 Total unmethylated C's in CHH context: 668525383 Total unmethylated C's in Unknown context: 1004797 C methylated in CpG context: 21.5% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.6% Deleting temporary report files... Rio3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 47m 32s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs-hapa/bismark/Rio3_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs-hapa/bismark/Rio3_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs-hapa/bismark/Rio3_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Rio3_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs-hapa/bismark/Rio3_pe.bam: 22237486 Total number duplicated alignments removed: 1069270 (4.81%) Duplicated alignments were found at: 1019486 different position(s) Total count of deduplicated leftover sequences: 21168216 (95.19% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_1A LN:100680956 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_3A LN:93095432 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_5A LN:90413844 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_7A LN:74165749 skipping header line: @SQ SN:Chromosome_8A LN:54853936 skipping header line: @SQ SN:Chromosome_9A LN:66796497 skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio3-2540785 --output_dir output/13-wgbs-hapa/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Rio3_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Rio3_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Rio3_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_1A LN:100680956 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_3A LN:93095432 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_5A LN:90413844 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_7A LN:74165749 skipping SAM header line: @SQ SN:Chromosome_8A LN:54853936 skipping SAM header line: @SQ SN:Chromosome_9A LN:66796497 skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Rio3_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Rio3_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio3-2540785 --output_dir output/13-wgbs-hapa/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio3_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Rio3_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.8 Processed 21168216 lines in total Total number of methylation call strings processed: 42336432 Final Cytosine Methylation Report ================================= Total number of C's analysed: 673982762 Total methylated C's in CpG context: 17767405 Total methylated C's in CHG context: 834636 Total methylated C's in CHH context: 3732506 Total C to T conversions in CpG context: 65040051 Total C to T conversions in CHG context: 114986620 Total C to T conversions in CHH context: 471621544 C methylated in CpG context: 21.5% C methylated in non-CpG context: 0.8% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Rio3_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Rio3_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Rio3_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Rio3_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Rio3_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Rio3_pe.deduplicated.txt.gz Writing bedGraph to file: Rio3_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Rio3_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Now writing methylation information for file >>CpG_context_Rio3_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Rio3_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp Sorting input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio3_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs-hapa/methylation/Rio3_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Rio3.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Rio3.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1322580 different covered positions) Writing cytosine report for chromosome Chromosome_1A (stored 3180247 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 2976066 different covered positions) Writing cytosine report for chromosome Chromosome_3A (stored 2801209 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2832688 different covered positions) Writing cytosine report for chromosome Chromosome_5A (stored 2651717 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2499739 different covered positions) Writing cytosine report for chromosome Chromosome_7A (stored 2329990 different covered positions) Writing cytosine report for chromosome Chromosome_8A (stored 1773155 different covered positions) Writing cytosine report for last chromosome Chromosome_9A (stored 2104525 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Rio3.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Rio3.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs-hapa/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome-hapa/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome-hapa/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Processed 41500000 lines Processed 42000000 lines Printing nucleotide stats to >> output/13-wgbs-hapa/dedup/Rio3_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1797300308 34.85 253281200 32.09 7.096 C 803214791 15.58 141394985 17.92 5.681 G 914687842 17.74 141251970 17.90 6.476 T 1641712273 31.84 253281001 32.09 6.482 AA 665143643 12.99 86162409 10.92 7.720 AC 277670428 5.42 45489259 5.76 6.104 AG 288239682 5.63 41639512 5.28 6.922 AT 553970209 10.82 79989139 10.14 6.926 CA 334438136 6.53 54159510 6.86 6.175 CC 136190806 2.66 28259664 3.58 4.819 CG 98014972 1.91 17208692 2.18 5.696 CT 228345692 4.46 41766898 5.29 5.467 GA 316840247 6.19 45250237 5.73 7.002 GC 130480650 2.55 22357630 2.83 5.836 GG 165240323 3.23 28206624 3.57 5.858 GT 295312642 5.77 45437311 5.76 6.499 TA 467652122 9.13 67706051 8.58 6.907 TC 253039340 4.94 45288269 5.74 5.587 TG 356603731 6.97 54196921 6.87 6.580 TT 552671082 10.79 86086811 10.91 6.420 [Sat Oct 10 11:49:39 PDT 2026] Rio3 done