[Sat Oct 10 10:02:32 PDT 2026] Rio2 (Rio/Rio_Pudeto) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 36433770 total bases: 5501499270 Q20 bases: 5436463482(98.8179%) Q30 bases: 5258670935(95.5861%) Q40 bases: 5258670935(95.5861%) Read2 before filtering: total reads: 36433770 total bases: 5501499270 Q20 bases: 5427245772(98.6503%) Q30 bases: 5246298777(95.3613%) Q40 bases: 5246298777(95.3613%) Read1 after filtering: total reads: 35781535 total bases: 4947942645 Q20 bases: 4905852886(99.1493%) Q30 bases: 4771250759(96.429%) Q40 bases: 4771250759(96.429%) Read2 after filtering: total reads: 35781535 total bases: 4949716719 Q20 bases: 4903581030(99.0679%) Q30 bases: 4761300392(96.1934%) Q40 bases: 4761300392(96.1934%) Filtering result: reads passed filter: 71563070 reads failed due to low quality: 577296 reads failed due to too many N: 1314 reads failed due to too short: 725860 reads with adapter trimmed: 8016937 bases trimmed due to adapters: 177551387 Duplication rate: 5.11724% Insert size peak (evaluated by paired-end reads): 188 JSON report: output/13-wgbs-hapa/fastp/Rio2.fastp.json HTML report: output/13-wgbs-hapa/fastp/Rio2.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP2 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/RP2 (paired)_R2.fastq.gz -o output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz -O output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs-hapa/fastp/Rio2.fastp.json --html output/13-wgbs-hapa/fastp/Rio2.fastp.html fastp v1.0.1, time used: 68 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome-hapa/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/ Using temp directory: /tmp/13-wgbs-Rio2-2540784 Temporary files will be written into the directory: /tmp/13-wgbs-Rio2-2540784/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz Paired-end alignments will be performed ======================================= Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz for PID: 2541645 and offset 8 (sequences written out: 4472691) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.5 to /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz for PID: 2541645 and offset 8 (sequences written out: 4472691) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.8 to /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.4 to /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.7 to /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.6 to /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.1 to /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.2 to /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4472692) Using the subset file >/tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Rio2_R1.fq.gz.temp.3 to /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.3_C_to_T.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.5 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.5 to /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.8 (4472691 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.8 to /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.7 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.7 to /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.6 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.6 to /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.4 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.4 to /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.1 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.1 to /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.2 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.2 to /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Rio2_R1.fq.gz.temp.3 (4472692 sequences in total) Writing a G -> A converted version of the input file Rio2_R2.fq.gz.temp.3 to /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.3_G_to_A.fastq Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.5 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.5_C_to_T.fastq and Rio2_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.8 (4472691 sequences in total) Input files are Rio2_R1.fq.gz.temp.8_C_to_T.fastq and Rio2_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.7 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.7_C_to_T.fastq and Rio2_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.6 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.6_C_to_T.fastq and Rio2_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.4 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.4_C_to_T.fastq and Rio2_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:38530:1042_1:N:0:GGCTATCG+TCTTAGTA/1 99 Chromosome_5A_CT_converted 87218148 42 141M = 87218481 474 GAATGAGAATTTTTGATATAGTGTGATAGAATGAGAATTTTTGATATAGTGTGAATTTGGAATGATATTTATGTATATGTATATTTTATTTATGTTATGGTATAAAATAGAAAATAATTATGTTGTTGATTAGTTAATGAT 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:38530:1042_2:N:0:GGCTATCG+TCTTAGTA/2 147 Chromosome_5A_CT_converted 87218481 42 141M = 87218148 -474 AAAAAGTTGTTATGATTGATTTAATTGAATTTTATGTATGGTGTTTAAAGGGAGATAATTTTAGTTTTTATAGTGTGTGGGAAGAAGATGGAATTAGTATATATGTTGTTTGAGAGTTTGAGAGGGGTGAATTTGTTTTTT IIIIIIIII9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIII9IIIIIIIIIIII9IIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:138G2 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:44435:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 ATAAATTGTTTTGAATTTTAGATGAGTTGTAAATGATTTTTGTTTATAATTATTGTAATTAATAGTTTTTATGATTTTTGTTTGGTTTAGATAATTTTATAATTTAAGGATAGAGTAGGATAATAGTTAATGTAATAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:44435:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 AATACACTAAAATTAAAATATTCACTAATAAATATATTTATTACATTAACTATTATCCTACTCTATCCTTAAATTATAAAATTATCTAAACCAAACAAAAATCATAAAAACTATTAATTACAATAATTATAAACAAAAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:35423:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 GGTTTAAGAGATATATTGAAGGATATTGGTTATAAAAAGGAGATTTATTTTTGATTGGGTTTTTTTGTGATTATAGATTTTTATAATTTATTTTAGATTTATTTGAGTATGTGGTTATAAATTTATAATATGATTGTTATA IIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:35423:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 CCTACATTTCAATTTATATCCCCTTATACTTAACATTAATTTCCTCTAAAAAAATTATCCATCTTACCATATAACAATCATATTATAAATTTATAACCACATACTCAAATAAATCTAAAATAAATTATAAAAATCTATAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:37429:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 ATGATATGAGGGGTGAAATATATGATAAAGAATTTTTATTTGTATGATTTTTTGGTATGGTTGGATGTGTTGTATTATGGTTGTTAGATTATGATTATGTATGAAGTAATAGATATTTTATTAAATTATTAATAAAATTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9III9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:37429:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 TCAATTTCTACAAAATATAAATTTTATTAATAATTTAATAAAATATCTATTACTTCATACATAATCATAATCTAACAACCATAATACAACACATCCAACCATACCAAAAAATCATACAAATAAAAATTCTTTATCATATAT III9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:29614:1042_1:N:0:GGCTATCG+TNTTAGTA/1 77 * 0 0 * * 0 0 GTTTTTTGAGTATGTTGAAATTGATGTTATTTGATGTTATTATTAATGGATTATGAAATGTTGTAATTAATATAGTTGTTAATATAGTTTTTTTTTTTTGTTTGTATATATAGTTTGTAAATAAAATTTTGTTATTGAAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9II**I*9*9*9*9III*I*I9**I9III9**I*I*9*99I* YT:Z:UP LH00129:489:23JFWNLT4:8:1101:29614:1042_2:N:0:GGCTATCG+TNTTAGTA/2 141 * 0 0 * * 0 0 CTTAATAAACAAAATACAAACCTCCAATATCATAATCAATATATCATAACCAAAAACTCTAATAATAAAATACTATTCAAATTTTATATTCCTTAACTTCTATCATTAAATATATTTACTATTTCAATTACTAAATTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.1 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.1_C_to_T.fastq and Rio2_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.2 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.2_C_to_T.fastq and Rio2_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:44435:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 ATAAATTGTTTTGAATTTTAGATGAGTTGTAAATGATTTTTGTTTATAATTATTGTAATTAATAGTTTTTATGATTTTTGTTTGGTTTAGATAATTTTATAATTTAAGGATAGAGTAGGATAATAGTTAATGTAATAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:44435:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 AATACACTAAAATTAAAATATTCACTAATAAATATATTTATTACATTAACTATTATCCTACTCTATCCTTAAATTATAAAATTATCTAAACCAAACAAAAATCATAAAAACTATTAATTACAATAATTATAAACAAAAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:38530:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 GAATGAGAATTTTTGATATAGTGTGATAGAATGAGAATTTTTGATATAGTGTGAATTTGGAATGATATTTATGTATATGTATATTTTATTTATGTTATGGTATAAAATAGAAAATAATTATGTTGTTGATTAGTTAATGAT 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:38530:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 AAAAAACAAATTCACCCCTCTCAAACTCTCAAACAACATATATACTAATTCCATCTTCTTCCCACACACTATAAAAACTAAAATTATCTCCCTTTAAACACCATACATAAAATTCAATTAAATCAATCATAACAACTTTTT IIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIII9IIIIIIIIIIII9IIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:29614:1042_1:N:0:GGCTATCG+TNTTAGTA/1 83 Chromosome_7A_GA_converted 66484714 12 141M = 66484594 -261 ATTTCAATAACAAAATTTTATTTACAAACTATATATACAAACAAAAAAAAAAAACTATATTAACAACTATATTAATTACAACATTTCATAATCCATTAATAATAACATCAAATAACATCAATTTCAACATACTCAAAAAAC *I99*9*I*I**9III9I**9I*I*III9*9*9*9*I**II9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-18 XS:i:-18 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:8T2T26T102 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29614:1042_2:N:0:GGCTATCG+TNTTAGTA/2 163 Chromosome_7A_GA_converted 66484594 12 141M = 66484714 261 CTTAATAAACAAAATACAAACCTCCAATATCATAATCAATATATCATAACCAAAAACTCTAATAATAAAATACTATTCAAATTTTATATTCCTTAACTTCTATCATTAAATATATTTACTATTTCAATTACTAAATTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIII AS:i:0 XS:i:-18 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-18 YT:Z:CP >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:37429:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 ATGATATGAGGGGTGAAATATATGATAAAGAATTTTTATTTGTATGATTTTTTGGTATGGTTGGATGTGTTGTATTATGGTTGTTAGATTATGATTATGTATGAAGTAATAGATATTTTATTAAATTATTAATAAAATTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9III9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:37429:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 TCAATTTCTACAAAATATAAATTTTATTAATAATTTAATAAAATATCTATTACTTCATACATAATCATAATCTAACAACCATAATACAACACATCCAACCATACCAAAAAATCATACAAATAAAAATTCTTTATCATATAT III9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Created G -> A converted version of the FastQ file Rio2_R2.fq.gz.temp.3 (4472692 sequences in total) Input files are Rio2_R1.fq.gz.temp.3_C_to_T.fastq and Rio2_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:25343:1042_1:N:0:GGCTATCG+TNTTAGTA/1 77 * 0 0 * * 0 0 ATGAGAGAGGAGAGGGAGAATTAATGAGAGAGGAGAGAAAATTAATGAGAGAGGAGAGAAAATGAATGAGAGGAGAGGGAGAATTAATGAGAGAGGAGAGAAAATTAATGAGAGAGGAGAGAAAATGAATGAGAGGAGAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:25343:1042_2:N:0:GGCTATCG+TNTTAGTA/2 141 * 0 0 * * 0 0 CATTAATTTTCTCTCCTCTCTCATTAATTCTCCCTCTCCTCTCATTCATTTTCTCTCCTCTCTCATTAATTTTCTCTCCTCTCTCATTAATTCTCCCTCTCCTCTCACTCATTTTCTCTCCTCTCTCATTAATTTTCTCTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I99IIII9IIII9IIIIIIIIIIIIIIIII*IIIIIIIIIIIIIII9IIIII9IIII9III***III*I99II9II9IIIIII*9II*II9II9I9 YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:35423:1042_1:N:0:GGCTATCG+TCTTAGTA/1 77 * 0 0 * * 0 0 GGTTTAAGAGATATATTGAAGGATATTGGTTATAAAAAGGAGATTTATTTTTGATTGGGTTTTTTTGTGATTATAGATTTTTATAATTTATTTTAGATTTATTTGAGTATGTGGTTATAAATTTATAATATGATTGTTATA IIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:35423:1042_2:N:0:GGCTATCG+TCTTAGTA/2 141 * 0 0 * * 0 0 CCTACATTTCAATTTATATCCCCTTATACTTAACATTAATTTCCTCTAAAAAAATTATCCATCTTACCATATAACAATCATATTATAAATTTATAACCACATACTCAAATAAATCTAAAATAAATTATAAAAATCTATAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:26637:1042_1:N:0:GGCTATCG+TNTTAGTA/1 99 Chromosome_2A_CT_converted 9419729 12 141M = 9419829 241 GGAGATTTTTTAAAATTTTATATTTTTATGTTGTATTATATGTTTTTTTTAAATTGATAAAAATGGATATAGTATGTTTATTATTAATAAAAGTATTATGAATAAATGATTTAAGTTGGATAAGATGGTTTAATGTGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-12 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:136A4 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:26637:1042_2:N:0:GGCTATCG+TNTTAGTA/2 147 Chromosome_2A_CT_converted 9419829 12 141M = 9419729 -241 AATAAATGATTTAAGTTGGATAAGATGGTTTAATGTGTTTTTTTGGTTTTTGAAGTTATATTGTATATTTGTAAGTAGATTTTTTGATTTTAGAAATTAGATAAATTTGTTATTAATTATTTTTTTTATGGTTTTATATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-18 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:36A104 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:25343:1042_1:N:0:GGCTATCG+TNTTAGTA/1 77 * 0 0 * * 0 0 ATGAGAGAGGAGAGGGAGAATTAATGAGAGAGGAGAGAAAATTAATGAGAGAGGAGAGAAAATGAATGAGAGGAGAGGGAGAATTAATGAGAGAGGAGAGAAAATTAATGAGAGAGGAGAGAAAATGAATGAGAGGAGAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:25343:1042_2:N:0:GGCTATCG+TNTTAGTA/2 141 * 0 0 * * 0 0 CATTAATTTTCTCTCCTCTCTCATTAATTCTCCCTCTCCTCTCATTCATTTTCTCTCCTCTCTCATTAATTTTCTCTCCTCTCTCATTAATTCTCCCTCTCCTCTCACTCATTTTCTCTCCTCTCTCATTAATTTTCTCTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I99IIII9IIII9IIIIIIIIIIIIIIIII*IIIIIIIIIIIIIII9IIIII9IIII9III***III*I99II9II9IIIIII*9II*II9II9I9 YT:Z:UP >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:27835:1042_1:N:0:GGCTATCG+TNTTAGTA/1 99 Chromosome_3A_CT_converted 14120 1 141M = 14290 311 GAATTTGATTTTTGGTTGTTATTTTTTTTAATGGTGGTTATTTTGAAATATTTAAAAATAGATTGGGAGGAAATATTGATGTTAGAAATGAATTTTGGATTTTTTATTTATTTTAGAATTTAAATGTTGTAGAGATTTTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIII9IIIIIIIIIIIIII9IIIIIIIII*IIII9IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-30 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:27835:1042_2:N:0:GGCTATCG+TNTTAGTA/2 147 Chromosome_3A_CT_converted 14290 1 141M = 14120 -311 TATTTTGAAAAGGGTTGTTTAAAAGAAAATTTTTATGGTGGAAATGGATTTGGGGTTATTAAATTATTTTATAAATAGAATTTGGTTGAAATTTGATAATTTTGATTTTTTGATGTTTTTTGGTGGTTATTTTGAAATGGT I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-30 XS:i:-30 XN:i:0 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:11T12A4A5G41A63 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:26637:1042_1:N:0:GGCTATCG+TNTTAGTA/1 83 Chromosome_2A_GA_converted 9401796 6 141M = 9401696 -241 AAAACACATTAAACCATCTTATCCAACTTAAATCATTTATTCATAATACTTTTATTAATAATAAACATACTATATCCATTTTTATCAATTTAAAAAAAACATATAATACAACATAAAAATATAAAATTTTAAAAAATCTCC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-12 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:4T136 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:26637:1042_2:N:0:GGCTATCG+TNTTAGTA/2 163 Chromosome_2A_GA_converted 9401696 6 141M = 9401796 241 ATATATAAAACCATAAAAAAAATAATTAATAACAAATTTATCTAATTTCTAAAATCAAAAAATCTACTTACAAATATACAATATAACTTCAAAAACCAAAAAAACACATTAAACCATCTTATCCAACTTAAATCATTTATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-12 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:104T36 YS:i:-6 YT:Z:CP >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.8 and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.7 and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.4 and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.6 and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.5 and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.5 Found first alignment: LH00129:489:23JFWNLT4:8:1101:27835:1042_1:N:0:GGCTATCG+TNTTAGTA/1 83 Chromosome_1A_GA_converted 47937722 31 141M = 47937552 -311 TTAAAATCTCTACAACATTTAAATTCTAAAATAAATAAAAAATCCAAAATTCATTTCTAACATCAATATTTCCTCCCAATCTATTTTTAAATATTTCAAAATAACCACCATTAAAAAAAATAACAACCAAAAATCAAATTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII9IIII*IIIIIIIII9IIIIIIIIIIIIII9IIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:27835:1042_2:N:0:GGCTATCG+TNTTAGTA/2 163 Chromosome_1A_GA_converted 47937552 31 141M = 47937722 311 ACCATTTCAAAATAACCACCAAAAAACATCAAAAAATCAAAATTATCAAATTTCAACCAAATTCTATTTATAAAATAATTTAATAACCCCAAATCCATTTCCACCATAAAAATTTTCTTTTAAACAACCCTTTTCAAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I AS:i:0 XS:i:-42 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Rio2_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.1 and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.2 and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.3 and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.3 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1138:11161:24401_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973118 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1162:2675:4013_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973131 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1171:1364:16007_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973121 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1179:20691:11453_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973128 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1194:35949:14956_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1193:22269:15783_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1194:35941:14970_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1203:15190:27063_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1204:23118:10276_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1213:30164:28842_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973126 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1218:26192:8286_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973134 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1227:26030:24569_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973114 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1237:49467:8384_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973151 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1310:42364:20547_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973127 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1313:16306:23840_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973114 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1318:31354:1084_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1435:24081:18698_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973138 Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1447:27867:27581_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973122 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1461:48278:23280_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1473:42453:21374_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973132 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1482:28595:13653_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973135 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2106:12706:18501_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973124 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2287:26589:20323_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973134 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2307:43100:25914_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973117 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2318:30383:20954_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973124 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2331:16282:4545_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973131 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2351:38222:27049_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973117 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2358:33303:13289_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973126 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2398:49022:29081_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973118 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2402:43319:26937_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973116 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2418:16298:15138_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973132 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2425:22527:27217_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973127 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2429:40285:19104_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973118 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2434:5846:19622_1:N:0:GGCTATCG+TCTTAGTA Chromosome_6A 76092822 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2483:11177:16610_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973133 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1848016 (41.32%) aligned concordantly 0 times 1000917 (22.38%) aligned concordantly exactly 1 time 1623759 (36.30%) aligned concordantly >1 times 58.68% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1845641 (41.26%) aligned concordantly 0 times 1003085 (22.43%) aligned concordantly exactly 1 time 1623966 (36.31%) aligned concordantly >1 times 58.74% overall alignment rate Processed 4472692 sequences in total 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1845510 (41.26%) aligned concordantly 0 times 1001328 (22.39%) aligned concordantly exactly 1 time 1625854 (36.35%) aligned concordantly >1 times 58.74% overall alignment rate Successfully deleted the temporary files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 3021042 Mapping efficiency: 67.5% Sequence pairs with no alignments under any condition: 749387 Sequence pairs did not map uniquely: 702263 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1508871 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1512170 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 132922920 Total methylated C's in CpG context: 3321711 Total methylated C's in CHG context: 149224 Total methylated C's in CHH context: 656195 Total methylated C's in Unknown context: 15941 Total unmethylated C's in CpG context: 12942755 Total unmethylated C's in CHG context: 22635250 Total unmethylated C's in CHH context: 93217785 Total unmethylated C's in Unknown context: 137781 C methylated in CpG context: 20.4% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.4% 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1846405 (41.28%) aligned concordantly 0 times 1000587 (22.37%) aligned concordantly exactly 1 time 1625700 (36.35%) aligned concordantly >1 times 58.72% overall alignment rate Processed 4472692 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 3020122 Mapping efficiency: 67.5% Sequence pairs with no alignments under any condition: 748566 Sequence pairs did not map uniquely: 704004 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1506996 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1513123 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 132876513 Total methylated C's in CpG context: 3320941 Total methylated C's in CHG context: 148917 Total methylated C's in CHH context: 656198 Total methylated C's in Unknown context: 16133 Total unmethylated C's in CpG context: 12937535 Total unmethylated C's in CHG context: 22631746 Total unmethylated C's in CHH context: 93181176 Total unmethylated C's in Unknown context: 136932 C methylated in CpG context: 20.4% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.5% 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1847872 (41.31%) aligned concordantly 0 times 1002786 (22.42%) aligned concordantly exactly 1 time 1622034 (36.27%) aligned concordantly >1 times 58.69% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1848702 (41.33%) aligned concordantly 0 times 1001235 (22.39%) aligned concordantly exactly 1 time 1622755 (36.28%) aligned concordantly >1 times 58.67% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1847572 (41.31%) aligned concordantly 0 times 1001016 (22.38%) aligned concordantly exactly 1 time 1624104 (36.31%) aligned concordantly >1 times 58.69% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1847279 (41.30%) aligned concordantly 0 times 1003187 (22.43%) aligned concordantly exactly 1 time 1622226 (36.27%) aligned concordantly >1 times 58.70% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1847521 (41.31%) aligned concordantly 0 times 1001164 (22.38%) aligned concordantly exactly 1 time 1624007 (36.31%) aligned concordantly >1 times 58.69% overall alignment rate Processed 4472692 sequences in total Processed 4472692 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 3021161 Mapping efficiency: 67.5% Sequence pairs with no alignments under any condition: 749625 Sequence pairs did not map uniquely: 701906 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1508162 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1512996 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 132892243 Total methylated C's in CpG context: 3317361 Total methylated C's in CHG context: 148645 Total methylated C's in CHH context: 657070 Total methylated C's in Unknown context: 16009 Total unmethylated C's in CpG context: 12935950 Total unmethylated C's in CHG context: 22638258 Total unmethylated C's in CHH context: 93194959 Total unmethylated C's in Unknown context: 138410 C methylated in CpG context: 20.4% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.4% Successfully deleted the temporary files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 3019095 Mapping efficiency: 67.5% Sequence pairs with no alignments under any condition: 749973 Sequence pairs did not map uniquely: 703624 Sequence pairs which were discarded because genomic sequence could not be extracted: 5 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1508540 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1510550 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 132799341 Total methylated C's in CpG context: 3316064 Total methylated C's in CHG context: 149258 Total methylated C's in CHH context: 657432 Total methylated C's in Unknown context: 15778 Total unmethylated C's in CpG context: 12926160 Total unmethylated C's in CHG context: 22613188 Total unmethylated C's in CHH context: 93137239 Total unmethylated C's in Unknown context: 137343 C methylated in CpG context: 20.4% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.3% 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1845785 (41.27%) aligned concordantly 0 times 1002201 (22.41%) aligned concordantly exactly 1 time 1624706 (36.33%) aligned concordantly >1 times 58.73% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1845572 (41.26%) aligned concordantly 0 times 1002317 (22.41%) aligned concordantly exactly 1 time 1624803 (36.33%) aligned concordantly >1 times 58.74% overall alignment rate Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2494:49079:18669_1:N:0:GGCTATCG+TCTTAGTA Chromosome_4A 93973115 Processed 4472692 sequences in total 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1846726 (41.29%) aligned concordantly 0 times 1000671 (22.37%) aligned concordantly exactly 1 time 1625295 (36.34%) aligned concordantly >1 times 58.71% overall alignment rate Successfully deleted the temporary files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 3020288 Mapping efficiency: 67.5% Sequence pairs with no alignments under any condition: 748429 Sequence pairs did not map uniquely: 703975 Sequence pairs which were discarded because genomic sequence could not be extracted: 5 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1510104 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1510179 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 132888826 Total methylated C's in CpG context: 3319494 Total methylated C's in CHG context: 148467 Total methylated C's in CHH context: 655387 Total methylated C's in Unknown context: 16493 Total unmethylated C's in CpG context: 12937691 Total unmethylated C's in CHG context: 22635310 Total unmethylated C's in CHH context: 93192477 Total unmethylated C's in Unknown context: 137787 C methylated in CpG context: 20.4% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.7% Processed 4472692 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 3021439 Mapping efficiency: 67.6% Sequence pairs with no alignments under any condition: 748411 Sequence pairs did not map uniquely: 702842 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1508017 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1513418 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 132886936 Total methylated C's in CpG context: 3319150 Total methylated C's in CHG context: 148259 Total methylated C's in CHH context: 656040 Total methylated C's in Unknown context: 15744 Total unmethylated C's in CpG context: 12926565 Total unmethylated C's in CHG context: 22630297 Total unmethylated C's in CHH context: 93206625 Total unmethylated C's in Unknown context: 137974 C methylated in CpG context: 20.4% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.2% 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1847642 (41.31%) aligned concordantly 0 times 1002744 (22.42%) aligned concordantly exactly 1 time 1622306 (36.27%) aligned concordantly >1 times 58.69% overall alignment rate 4472692 reads; of these: 4472692 (100.00%) were paired; of these: 1847226 (41.30%) aligned concordantly 0 times 1001296 (22.39%) aligned concordantly exactly 1 time 1624170 (36.31%) aligned concordantly >1 times 58.70% overall alignment rate Processed 4472692 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472692 Number of paired-end alignments with a unique best hit: 3020973 Mapping efficiency: 67.5% Sequence pairs with no alignments under any condition: 749830 Sequence pairs did not map uniquely: 701889 Sequence pairs which were discarded because genomic sequence could not be extracted: 8 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1509079 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1511886 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 132908590 Total methylated C's in CpG context: 3313505 Total methylated C's in CHG context: 147718 Total methylated C's in CHH context: 657364 Total methylated C's in Unknown context: 15927 Total unmethylated C's in CpG context: 12924949 Total unmethylated C's in CHG context: 22623693 Total unmethylated C's in CHH context: 93241361 Total unmethylated C's in Unknown context: 137962 C methylated in CpG context: 20.4% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.3% 4472691 reads; of these: 4472691 (100.00%) were paired; of these: 1848965 (41.34%) aligned concordantly 0 times 1000047 (22.36%) aligned concordantly exactly 1 time 1623679 (36.30%) aligned concordantly >1 times 58.66% overall alignment rate 4472691 reads; of these: 4472691 (100.00%) were paired; of these: 1845663 (41.27%) aligned concordantly 0 times 1002167 (22.41%) aligned concordantly exactly 1 time 1624861 (36.33%) aligned concordantly >1 times 58.73% overall alignment rate Processed 4472691 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4472691 Number of paired-end alignments with a unique best hit: 3020577 Mapping efficiency: 67.5% Sequence pairs with no alignments under any condition: 749863 Sequence pairs did not map uniquely: 702251 Sequence pairs which were discarded because genomic sequence could not be extracted: 7 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1508232 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1512338 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 132868514 Total methylated C's in CpG context: 3314253 Total methylated C's in CHG context: 148524 Total methylated C's in CHH context: 661195 Total methylated C's in Unknown context: 15969 Total unmethylated C's in CpG context: 12928326 Total unmethylated C's in CHG context: 22634024 Total unmethylated C's in CHH context: 93182192 Total unmethylated C's in Unknown context: 138045 C methylated in CpG context: 20.4% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.4% Now waiting for all child processes to complete All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 17890764. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.1 /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.1 /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.2 /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.2 /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.3 /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.3 /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.4 /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.4 /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.5 /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.5 /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.6 /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.6 /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.7 /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.7 /tmp/13-wgbs-Rio2-2540784/Rio2_R1.fq.gz.temp.8 /tmp/13-wgbs-Rio2-2540784/Rio2_R2.fq.gz.temp.8 Now merging BAM files Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.2_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.3_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.4_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.5_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.6_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.7_bismark_bt2_pe.bam Rio2_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Rio2_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Rio2_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1_bismark_bt2_PE_report.txt Now merging temporary reports Rio2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Rio2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Rio2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 35781535 Number of paired-end alignments with a unique best hit: 24164697 Mapping efficiency: 67.5% Sequence pairs with no alignments under any condition: 5994084 Sequence pairs did not map uniquely: 5622754 Sequence pairs which were discarded because genomic sequence could not be extracted: 36 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 12068001 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 12096660 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1063043883 Total methylated C's in CpG context: 26542479 Total methylated C's in CHG context: 1189012 Total methylated C's in CHH context: 5256881 Total methylated C's in Unknown context: 127994 Total unmethylated C's in CpG context: 103459931 Total unmethylated C's in CHG context: 181041766 Total unmethylated C's in CHH context: 745553814 Total unmethylated C's in Unknown context: 1102234 C methylated in CpG context: 20.4% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.4% Deleting temporary report files... Rio2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Rio2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 47m 16s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs-hapa/bismark/Rio2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs-hapa/bismark/Rio2_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs-hapa/bismark/Rio2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Rio2_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs-hapa/bismark/Rio2_pe.bam: 24164661 Total number duplicated alignments removed: 1493159 (6.18%) Duplicated alignments were found at: 1397476 different position(s) Total count of deduplicated leftover sequences: 22671502 (93.82% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_1A LN:100680956 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_3A LN:93095432 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_5A LN:90413844 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_7A LN:74165749 skipping header line: @SQ SN:Chromosome_8A LN:54853936 skipping header line: @SQ SN:Chromosome_9A LN:66796497 skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio2-2540784 --output_dir output/13-wgbs-hapa/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Rio2_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Rio2_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Rio2_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_1A LN:100680956 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_3A LN:93095432 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_5A LN:90413844 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_7A LN:74165749 skipping SAM header line: @SQ SN:Chromosome_8A LN:54853936 skipping SAM header line: @SQ SN:Chromosome_9A LN:66796497 skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Rio2_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Rio2_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Rio2-2540784 --output_dir output/13-wgbs-hapa/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Rio2_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Rio2_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.8 Processed 22671502 lines in total Total number of methylation call strings processed: 45343004 Final Cytosine Methylation Report ================================= Total number of C's analysed: 776530372 Total methylated C's in CpG context: 19388501 Total methylated C's in CHG context: 751851 Total methylated C's in CHH context: 3359226 Total C to T conversions in CpG context: 75708997 Total C to T conversions in CHG context: 132323331 Total C to T conversions in CHH context: 544998466 C methylated in CpG context: 20.4% C methylated in non-CpG context: 0.6% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Rio2_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Rio2_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Rio2_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Rio2_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Rio2_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Rio2_pe.deduplicated.txt.gz Writing bedGraph to file: Rio2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Rio2_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Now writing methylation information for file >>CpG_context_Rio2_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Rio2_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp Sorting input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Rio2_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs-hapa/methylation/Rio2_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Rio2.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Rio2.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1437805 different covered positions) Writing cytosine report for chromosome Chromosome_1A (stored 3384374 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3133554 different covered positions) Writing cytosine report for chromosome Chromosome_3A (stored 2967164 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2997194 different covered positions) Writing cytosine report for chromosome Chromosome_5A (stored 2808728 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2663392 different covered positions) Writing cytosine report for chromosome Chromosome_7A (stored 2436171 different covered positions) Writing cytosine report for chromosome Chromosome_8A (stored 1902912 different covered positions) Writing cytosine report for last chromosome Chromosome_9A (stored 2245125 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Rio2.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Rio2.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs-hapa/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome-hapa/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome-hapa/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Processed 41500000 lines Processed 42000000 lines Processed 42500000 lines Processed 43000000 lines Processed 43500000 lines Processed 44000000 lines Processed 44500000 lines Processed 45000000 lines Printing nucleotide stats to >> output/13-wgbs-hapa/dedup/Rio2_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1911922721 34.45 253281200 32.09 7.549 C 881478269 15.88 141394985 17.92 6.234 G 983389001 17.72 141251970 17.90 6.962 T 1773020497 31.95 253281001 32.09 7.000 AA 697541803 12.66 86162409 10.92 8.096 AC 301727327 5.48 45489259 5.76 6.633 AG 306542051 5.56 41639512 5.28 7.362 AT 592921717 10.76 79989139 10.14 7.413 CA 363793042 6.60 54159510 6.86 6.717 CC 152098947 2.76 28259664 3.58 5.382 CG 107188061 1.95 17208692 2.18 6.229 CT 251631615 4.57 41766898 5.29 6.025 GA 336507935 6.11 45250237 5.73 7.437 GC 143109163 2.60 22357630 2.83 6.401 GG 178613436 3.24 28206624 3.57 6.332 GT 318141115 5.77 45437311 5.76 7.002 TA 500059389 9.08 67706051 8.58 7.386 TC 278188988 5.05 45288269 5.74 6.143 TG 384003179 6.97 54196921 6.87 7.085 TT 597961648 10.85 86086811 10.91 6.946 [Sat Oct 10 11:53:06 PDT 2026] Rio2 done