[Sat Oct 10 07:51:44 PDT 2026] Qui4 (Qui/Quilhua) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 35048248 total bases: 5292285448 Q20 bases: 5230975709(98.8415%) Q30 bases: 5060616798(95.6225%) Q40 bases: 5060616798(95.6225%) Read2 before filtering: total reads: 35048248 total bases: 5292285448 Q20 bases: 5219882616(98.6319%) Q30 bases: 5037176361(95.1796%) Q40 bases: 5037176361(95.1796%) Read1 after filtering: total reads: 34443887 total bases: 4749972299 Q20 bases: 4710155819(99.1618%) Q30 bases: 4580106113(96.4238%) Q40 bases: 4580106113(96.4238%) Read2 after filtering: total reads: 34443887 total bases: 4751396487 Q20 bases: 4706455796(99.0542%) Q30 bases: 4562199303(96.0181%) Q40 bases: 4562199303(96.0181%) Filtering result: reads passed filter: 68887774 reads failed due to low quality: 556584 reads failed due to too many N: 1360 reads failed due to too short: 650778 reads with adapter trimmed: 9947087 bases trimmed due to adapters: 196331194 Duplication rate: 4.51384% Insert size peak (evaluated by paired-end reads): 183 JSON report: output/13-wgbs-hapa/fastp/Qui4.fastp.json HTML report: output/13-wgbs-hapa/fastp/Qui4.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui4 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui4 (paired)_R2.fastq.gz -o output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz -O output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs-hapa/fastp/Qui4.fastp.json --html output/13-wgbs-hapa/fastp/Qui4.fastp.html fastp v1.0.1, time used: 66 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome-hapa/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/ Using temp directory: /tmp/13-wgbs-Qui4-4081988 Temporary files will be written into the directory: /tmp/13-wgbs-Qui4-4081988/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz for PID: 4082425 and offset 8 (sequences written out: 4305485) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.2 to /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.5 to /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.7 to /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.6 to /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.3 to /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.1 to /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4305486) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.4 to /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz for PID: 4082425 and offset 8 (sequences written out: 4305485) Using the subset file >/tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui4_R1.fq.gz.temp.8 to /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.8_C_to_T.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.2 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.2 to /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.5 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.5 to /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.6 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.6 to /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.1 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.1 to /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.3 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.3 to /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.4 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.4 to /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.7 (4305486 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.7 to /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Qui4_R1.fq.gz.temp.8 (4305485 sequences in total) Writing a G -> A converted version of the input file Qui4_R2.fq.gz.temp.8 to /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.8_G_to_A.fastq Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.5 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.5_C_to_T.fastq and Qui4_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.6 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.6_C_to_T.fastq and Qui4_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.2 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.2_C_to_T.fastq and Qui4_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.1 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.1_C_to_T.fastq and Qui4_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.4 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.4_C_to_T.fastq and Qui4_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.7 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.7_C_to_T.fastq and Qui4_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.8 (4305485 sequences in total) Input files are Qui4_R1.fq.gz.temp.8_C_to_T.fastq and Qui4_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui4_R2.fq.gz.temp.3 (4305486 sequences in total) Input files are Qui4_R1.fq.gz.temp.3_C_to_T.fastq and Qui4_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:4738:1056_1:N:0:GGTACACG+ANCAGCGC/1 99 Chromosome_4A_CT_converted 39770802 40 141M = 39770798 -145 TTAATGGTAAATGAAAGATATTAGTAAATTTAATGTTATATTGAATAAGAGATTAATTTGTTTAGTAAATAAGATATTGTAGTGTAAATTTTTTTGAATGTGGTGTTTTAATATTTTGAATTTATATATATATATTGTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*II*IIII9I9II*9III99III*II***II*999*I9*9*9***99***9*99** AS:i:-30 XN:i:0 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:40G31A20A14A7G24 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:4738:1056_2:N:0:GGTACACG+ANCAGCGC/2 147 Chromosome_4A_CT_converted 39770798 40 141M = 39770802 145 TGATTTAATGGTAAATGAAAGATATTAGTAAATTTAATGTTATATTGAATAAGAGATTAATTTGTTTAGTAAATAAGATATTGTAGTGTAAATTTTTATGAATGTGGTGTTTAAATATTTGGAATTTATATATATATATTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:44G31A64 YS:i:-30 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:49872:1042_1:N:0:GGTACACG+AGCAGCGC/1 77 * 0 0 * * 0 0 TTGGTAATGGTGAAAGTTTTTTGAGAGGGATTAAAATAAATAATATATAATTAATTAATTAATGGAGTTTATGGTTGTGGTAGTGAAGGTTTTTTATAGTGTTAATGTTTATTGTGATATGGGATTTTTTTTTTTTTTT IIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIII9IIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:49872:1042_2:N:0:GGTACACG+AGCAGCGC/2 141 * 0 0 * * 0 0 AAAAATCCCATATCACAATAAACATTAACACTATAAAAAACCTTCACTACCACAACCATAAACTCCATTAATTAATTAATTATATATTATTTATTTTAATCCCTCTCAAAAAACTTTCACCATTACCAATAAAAAACAT IIIII9IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII9IIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:3346:1056_1:N:0:GGTACACG+ANCAGCGC/1 99 Chromosome_8A_CT_converted 48021544 24 141M = 48021620 211 AAATTTAATATGTATATTTTTTGTAATAATAGAATTATTTATTTTAAAATTATTTTAGATTTTAGAATTAATTGTGAAATGTAGGAAATGATTATTTGAGGAATTTAAAGGTATTTTTAAGTTATTTTTTTAGTAATTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:126A5A8 YS:i:-41 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:3346:1056_2:N:0:GGTACACG+ANCAGCGC/2 147 Chromosome_8A_CT_converted 48021620 24 100M6I35M = 48021544 -211 AAATGTAGGAAATGATTATTTGAGGAATTTAAAGGTATTTTTAAGTTATTTTTTTAGTAATTTTAAAATAATATTTGAAATAAAAGAATATAATGTTTGAATATATATAAGTATTTTAGTAAAATGAAGTATTGTAATTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-41 XN:i:0 XM:i:3 XO:i:1 XG:i:6 NM:i:9 MD:Z:50A5A49G28 YS:i:-12 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:34129:1042_1:N:0:GGTACACG+AGCAGCGC/1 77 * 0 0 * * 0 0 TTAGAGATAGAAATTAAATTATTATAGATTTAGAGATTTAAAATGAATTATTGTAGATGTAGAGATAGAAAATAAAATTATTATTTATTTTGAATAGAAAATGAATAATTGATATTGTTTTGTAAAATAGGATTGGTTAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:34129:1042_2:N:0:GGTACACG+AGCAGCGC/2 141 * 0 0 * * 0 0 ATAAAATTTAATAACTCTTAACCAATCCTATTTTACAAAACAATATCAATTATTCATTTTCTATTCAAAATAAATAATAATTTTATTTTCTATCTCTACATCTACAATAATTCATTTTAAATCTCTAAATCTATAATAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:26621:1042_1:N:0:GGTACACG+ANCAGCGC/1 77 * 0 0 * * 0 0 TTAAAATAAAGGTTAGGAATTAGTTTATAAATTGAATTTTAAAAATAATTAATTTTGATTGTAATAATAGTGGGTAAAGAATTATGGTGAAAAAAGGTGGGATTTGTTTTTATTTTTGTTTTTTTATGTTGTGTAATTTAA IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:26621:1042_2:N:0:GGTACACG+ANCAGCGC/2 141 * 0 0 * * 0 0 ATATACATACATATTAAATCCTTATCAAATATAATATTTCTATTAAAATCTAAATTAACTTTTAATTTTTTCACATACTATTCAATATTTTAAAAATATTTTTATTTTCATTAAAATAAACTTTTAATATATTAAACAACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:29129:1042_1:N:0:GGTACACG+ANCAGCGC/1 99 Chromosome_8A_CT_converted 14695937 7 9M2D132M = 14696054 258 AATTGTATTAAAAAAAAAAAAAAAAATGTAATAGATATTAATTTGTAAAAATTTATATTGTTTAAATATATATATAGTATTAAATTTTTTGTAGTAGTTAAATATTGATTTGTTAGAAGTTTTAAAGGTTATATAATAGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9*IIIIIIII9IIIIIIIIIIIII*IIII9III9I9IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII AS:i:-17 XS:i:-29 XN:i:0 XM:i:1 XO:i:1 XG:i:2 NM:i:3 MD:Z:9^AA117A14 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29129:1042_2:N:0:GGTACACG+ANCAGCGC/2 147 Chromosome_8A_CT_converted 14696054 7 141M = 14695937 -258 GAAGTTTTAAAGGTTATATAATAGTTAAGTGATTGTTTTTAGTAGTAGTTAAATATTGATTTTTTTAAATTTATAAATGATATATGTATGTAAGTGATGTAGTTTTTAGTAGTAGTTAAATATTGATTTGTTTAAGTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-30 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:11A50G78 YS:i:-17 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:49289:1042_1:N:0:GGTACACG+AGCAGCGC/1 99 Chromosome_8A_CT_converted 17818624 2 37M15D21M1D83M = 17818769 285 TTAATATATTTGGTGAATTGTTAATATGAAGTTAAAGTGTAAATATGTTAAAAGAGTATTTTATAGATTTTAAATAGTTTTATTGTTATTGATATTTGTATTAATATAGGGAGGTGATTATTTTATATTGATTTAGTGTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-64 XS:i:-64 XN:i:0 XM:i:1 XO:i:2 XG:i:16 NM:i:17 MD:Z:37^TGATTAGGGTTAAAA21^T9A73 YS:i:-32 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:49289:1042_2:N:0:GGTACACG+AGCAGCGC/2 147 Chromosome_8A_CT_converted 17818769 2 99M1I41M = 17818624 -285 GATTTAGTGTTTTTTTATGGGATTTGAAATTGTGATTGAGATGTATGAGAATTTGATTTATAGATGGGTAATTTTATTTTTATTTTAAATGGTAAGTTGAAAAAGAGTATGTTGTATTTTTGATGTAAAATATTTTGAAAA IIII9I9I9III9IIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-32 XS:i:-37 XN:i:0 XM:i:4 XO:i:1 XG:i:1 NM:i:5 MD:Z:24A14A10G12G76 YS:i:-64 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:45811:1042_1:N:0:GGTACACG+AGCAGCGC/1 77 * 0 0 * * 0 0 ATTGTTTATAAAAATATTAATAGATATTTTTATGAAGGAGTGGTTTTAGGAATTGATTATGTGGTTAATGGAGATTGATTAATTAAATTAGAGAAAAATGGTGTTAAATTTTTGATTTTTTTTATTAAGTATTTAAATTTT I9IIIIIIIIIII9I*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:45811:1042_2:N:0:GGTACACG+AGCAGCGC/2 141 * 0 0 * * 0 0 CTTTAAATCACAAAACTTTCCAAAATTTAAATACTTAATAAAAAAAATCAAAAATTTAACACCATTTTTCTCTAATTTAATTAATCAATCTCCATTAACCACATAATCAATTCCTAAAACCACTCCTTCATAAAAATATCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIII*II9IIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:26621:1042_1:N:0:GGTACACG+ANCAGCGC/1 77 * 0 0 * * 0 0 TTAAAATAAAGGTTAGGAATTAGTTTATAAATTGAATTTTAAAAATAATTAATTTTGATTGTAATAATAGTGGGTAAAGAATTATGGTGAAAAAAGGTGGGATTTGTTTTTATTTTTGTTTTTTTATGTTGTGTAATTTAA IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:26621:1042_2:N:0:GGTACACG+ANCAGCGC/2 141 * 0 0 * * 0 0 ATATACATACATATTAAATCCTTATCAAATATAATATTTCTATTAAAATCTAAATTAACTTTTAATTTTTTCACATACTATTCAATATTTTAAAAATATTTTTATTTTCATTAAAATAAACTTTTAATATATTAAACAACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:3346:1056_1:N:0:GGTACACG+ANCAGCGC/1 83 Chromosome_4A_GA_converted 19264412 42 141M = 19264336 -217 TAAAATTACTAAAAAAATAACTTAAAAATACCTTTAAATTCCTCAAATAATCATTTCCTACATTTCACAATTAATTCTAAAATCTAAAATAATTTTAAAATAAATAATTCTATTATTACAAAAAATATACATATTAAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:8T132 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:3346:1056_2:N:0:GGTACACG+ANCAGCGC/2 163 Chromosome_4A_GA_converted 19264336 42 141M = 19264412 217 TTAATTACAATACTTCATTTTACTAAAATACTTATATATATTCAAACATTATATTCTTTTATTTCAAATATTATTTTAAAATTACTAAAAAAATAACTTAAAAATACCTTTAAATTCCTCAAATAATCATTTCCTACATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:84T56 YS:i:-6 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:34129:1042_1:N:0:GGTACACG+AGCAGCGC/1 77 * 0 0 * * 0 0 TTAGAGATAGAAATTAAATTATTATAGATTTAGAGATTTAAAATGAATTATTGTAGATGTAGAGATAGAAAATAAAATTATTATTTATTTTGAATAGAAAATGAATAATTGATATTGTTTTGTAAAATAGGATTGGTTAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:34129:1042_2:N:0:GGTACACG+AGCAGCGC/2 141 * 0 0 * * 0 0 ATAAAATTTAATAACTCTTAACCAATCCTATTTTACAAAACAATATCAATTATTCATTTTCTATTCAAAATAAATAATAATTTTATTTTCTATCTCTACATCTACAATAATTCATTTTAAATCTCTAAATCTATAATAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:49289:1042_1:N:0:GGTACACG+AGCAGCGC/1 83 Chromosome_6A_GA_converted 28815945 35 141M = 28815816 -270 AAACACTAAATCAATATAAAATAATCACCTCCCTATATTAATACAAATATCAATAACAATAAAACTATTTAAAATCTATAAAATACTCTTTTAACATATTTACACTTTAACTTCATATTAACAATTCACCAAATATATTAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-70 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:49289:1042_2:N:0:GGTACACG+AGCAGCGC/2 163 Chromosome_6A_GA_converted 28815816 35 141M = 28815945 270 TTTTCAAAATATTTTACATCAAAAATACAACATACTCTTTTTCAACTTACCATTTAAAATAAAAATAAAATTACCCATCTATAAATCAAATTCTCATACATCTCAATCACAATTTCAAATCCCATAAAAAAACACTAAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIII9III9I9I9IIII AS:i:0 XS:i:-26 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:4738:1056_1:N:0:GGTACACG+ANCAGCGC/1 77 * 0 0 * * 0 0 TTAATGGTAAATGAAAGATATTAGTAAATTTAATGTTATATTGAATAAGAGATTAATTTGTTTAGTAAATAAGATATTGTAGTGTAAATTTTTTTGAATGTGGTGTTTTAATATTTTGAATTTATATATATATATTGTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*II*IIII9I9II*9III99III*II***II*999*I9*9*9***99***9*99** YT:Z:UP LH00129:489:23JFWNLT4:8:1101:4738:1056_2:N:0:GGTACACG+ANCAGCGC/2 141 * 0 0 * * 0 0 CAATATATATATATAAATTCCAAATATTTAAACACCACATTCATAAAAATTTACACTACAATATCTTATTTACTAAACAAATTAATCTCTTATTCAATATAACATTAAATTTACTAATATCTTTCATTTACCATTAAATCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:49872:1042_1:N:0:GGTACACG+AGCAGCGC/1 83 Chromosome_4A_GA_converted 51468683 42 1M5I133M = 51468688 144 AAAAAAAAAAAAAAATCCCATATCACAATAAACATTAACACTATAAAAAACCTTCACTACCACAACCATAAACTCCATTAATTAATTAATTATATATTATTTATTTTAATCCCTCTCAAAAAACTTTCACCATTACCAA IIIIIIIIIII9IIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIII AS:i:-20 XN:i:0 XM:i:0 XO:i:1 XG:i:5 NM:i:5 MD:Z:134 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:49872:1042_2:N:0:GGTACACG+AGCAGCGC/2 163 Chromosome_4A_GA_converted 51468688 42 139M = 51468683 -144 AAAAATCCCATATCACAATAAACATTAACACTATAAAAAACCTTCACTACCACAACCATAAACTCCATTAATTAATTAATTATATATTATTTATTTTAATCCCTCTCAAAAAACTTTCACCATTACCAATAAAAAACAT IIIII9IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIII9IIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:139 YS:i:-20 YT:Z:CP >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:29129:1042_1:N:0:GGTACACG+ANCAGCGC/1 83 Chromosome_4A_GA_converted 65720077 6 115M6I20M = 65719962 -250 AACTATTATATAACCTTTAAAACTTCTAACAAATCAATATTTAACTACTACAAAAAATTTAATACTATATATATATTTAAACAATATAAATTTTTACAAATTAATATCTATTACATTTTTTTTTTTTTTTTTAATACAATT IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIII9I9III9IIII*IIIIIIIIIIIII9IIIIIIII*9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-29 XS:i:-29 XN:i:0 XM:i:1 XO:i:1 XG:i:6 NM:i:7 MD:Z:14T120 YS:i:-24 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29129:1042_2:N:0:GGTACACG+ANCAGCGC/2 163 Chromosome_4A_GA_converted 65719962 6 141M = 65720077 250 ATAAACTTAAACAAATCAATATTTAACTACTACTAAAAACTACATCACTTACATACATATATCATTTATAAATTTAAAAAAATCAATATTTAACTACTACTAAAAACAATCACTTAACTATTATATAACCTTTAAAACTTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-24 XS:i:-30 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:51T12A13C50T11 YS:i:-29 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:45811:1042_1:N:0:GGTACACG+AGCAGCGC/1 83 Chromosome_8A_GA_converted 45352722 1 33M1I60M1D47M = 45352701 -162 AAAATTTAAATACTTAATAAAAAAAATCAAAAATTTAACACCATTTTTCTCTAATTTAATTAATCAATCTCCATTAACCACATAATCAATTCCTAAAACCACTCCTTCATAAAAATATCTATTAATATTTTTATAAACAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*I9IIIIIIIIIII9I AS:i:-16 XS:i:-16 XN:i:0 XM:i:0 XO:i:2 XG:i:2 NM:i:2 MD:Z:93^A47 YS:i:-16 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:45811:1042_2:N:0:GGTACACG+AGCAGCGC/2 163 Chromosome_8A_GA_converted 45352701 1 54M1I60M1D26M = 45352722 162 CTTTAAATCACAAAACTTTCCAAAATTTAAATACTTAATAAAAAAAATCAAAAATTTAACACCATTTTTCTCTAATTTAATTAATCAATCTCCATTAACCACATAATCAATTCCTAAAACCACTCCTTCATAAAAATATCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIII*II9IIII AS:i:-16 XS:i:-16 XN:i:0 XM:i:0 XO:i:2 XG:i:2 NM:i:2 MD:Z:114^A26 YS:i:-16 YT:Z:CP >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui4_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.1 and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.3 and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.7 and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.6 and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.5 and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.8 and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.4 and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.2 and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.2 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1114:6291:21822_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973132 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1121:21969:16161_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973136 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1127:45535:24499_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973116 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1150:17059:7712_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973121 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1167:15360:16820_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1183:45293:15587_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973114 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1228:33506:25101_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973132 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1234:36499:17619_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973124 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1285:18054:19608_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973126 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1285:18046:19622_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973126 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1284:24801:11817_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973131 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1331:20222:24232_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973129 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1338:44395:27539_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973144 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1351:13402:24919_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973131 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1392:37688:25984_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973131 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1434:27972:4335_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973137 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1474:18806:1266_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973193 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1482:44516:7964_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973123 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2103:20092:29025_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973134 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2198:42995:12728_1:N:0:GGTACACG+AGCAGCGC Chromosome_5A 3 Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2244:10101:1743_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973123 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2260:6687:9393_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973131 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2274:37098:12294_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973130 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2307:41822:13219_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2376:11930:14522_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973118 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2393:45649:6395_1:N:0:GGTACACG+AGTAGCGC Chromosome_4A 93973134 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2466:25165:28114_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973139 Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2486:19939:29543_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973131 Processed 4000000 sequence pairs so far 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1747589 (40.59%) aligned concordantly 0 times 960106 (22.30%) aligned concordantly exactly 1 time 1597791 (37.11%) aligned concordantly >1 times 59.41% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1746398 (40.56%) aligned concordantly 0 times 959994 (22.30%) aligned concordantly exactly 1 time 1599094 (37.14%) aligned concordantly >1 times 59.44% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2896105 Mapping efficiency: 67.3% Sequence pairs with no alignments under any condition: 701130 Sequence pairs did not map uniquely: 708251 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1446507 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1449595 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 128001669 Total methylated C's in CpG context: 3127384 Total methylated C's in CHG context: 145603 Total methylated C's in CHH context: 645291 Total methylated C's in Unknown context: 15955 Total unmethylated C's in CpG context: 12787602 Total unmethylated C's in CHG context: 21845099 Total unmethylated C's in CHH context: 89450690 Total unmethylated C's in Unknown context: 136952 C methylated in CpG context: 19.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.4% 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1745126 (40.53%) aligned concordantly 0 times 960837 (22.32%) aligned concordantly exactly 1 time 1599523 (37.15%) aligned concordantly >1 times 59.47% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1748200 (40.60%) aligned concordantly 0 times 958566 (22.26%) aligned concordantly exactly 1 time 1598720 (37.13%) aligned concordantly >1 times 59.40% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2896427 Mapping efficiency: 67.3% Sequence pairs with no alignments under any condition: 701099 Sequence pairs did not map uniquely: 707960 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1446583 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1449840 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 128045923 Total methylated C's in CpG context: 3138998 Total methylated C's in CHG context: 146934 Total methylated C's in CHH context: 646303 Total methylated C's in Unknown context: 16193 Total unmethylated C's in CpG context: 12781166 Total unmethylated C's in CHG context: 21853237 Total unmethylated C's in CHH context: 89479285 Total unmethylated C's in Unknown context: 136557 C methylated in CpG context: 19.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.6% Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2469:39800:23280_1:N:0:GGTACACG+AGCAGCGC Chromosome_4A 93973124 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1745600 (40.54%) aligned concordantly 0 times 960393 (22.31%) aligned concordantly exactly 1 time 1599493 (37.15%) aligned concordantly >1 times 59.46% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1746607 (40.57%) aligned concordantly 0 times 958469 (22.26%) aligned concordantly exactly 1 time 1600410 (37.17%) aligned concordantly >1 times 59.43% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1745691 (40.55%) aligned concordantly 0 times 959913 (22.30%) aligned concordantly exactly 1 time 1599882 (37.16%) aligned concordantly >1 times 59.45% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1747558 (40.59%) aligned concordantly 0 times 958889 (22.27%) aligned concordantly exactly 1 time 1599039 (37.14%) aligned concordantly >1 times 59.41% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2894916 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 701584 Sequence pairs did not map uniquely: 708986 Sequence pairs which were discarded because genomic sequence could not be extracted: 6 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1446032 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1448878 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127984351 Total methylated C's in CpG context: 3129621 Total methylated C's in CHG context: 147240 Total methylated C's in CHH context: 646521 Total methylated C's in Unknown context: 15984 Total unmethylated C's in CpG context: 12765597 Total unmethylated C's in CHG context: 21860111 Total unmethylated C's in CHH context: 89435261 Total unmethylated C's in Unknown context: 135061 C methylated in CpG context: 19.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.6% Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2896185 Mapping efficiency: 67.3% Sequence pairs with no alignments under any condition: 700456 Sequence pairs did not map uniquely: 708845 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1447291 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1448891 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 128056213 Total methylated C's in CpG context: 3127449 Total methylated C's in CHG context: 146621 Total methylated C's in CHH context: 648480 Total methylated C's in Unknown context: 16490 Total unmethylated C's in CpG context: 12782436 Total unmethylated C's in CHG context: 21852284 Total unmethylated C's in CHH context: 89498943 Total unmethylated C's in Unknown context: 136240 C methylated in CpG context: 19.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.8% 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1744381 (40.52%) aligned concordantly 0 times 960272 (22.30%) aligned concordantly exactly 1 time 1600833 (37.18%) aligned concordantly >1 times 59.48% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1747268 (40.58%) aligned concordantly 0 times 958038 (22.25%) aligned concordantly exactly 1 time 1600180 (37.17%) aligned concordantly >1 times 59.42% overall alignment rate Processed 4305486 sequences in total 4305485 reads; of these: 4305485 (100.00%) were paired; of these: 1746817 (40.57%) aligned concordantly 0 times 959454 (22.28%) aligned concordantly exactly 1 time 1599214 (37.14%) aligned concordantly >1 times 59.43% overall alignment rate Successfully deleted the temporary files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2894715 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 700987 Sequence pairs did not map uniquely: 709784 Sequence pairs which were discarded because genomic sequence could not be extracted: 5 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1444705 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1450005 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127995522 Total methylated C's in CpG context: 3137819 Total methylated C's in CHG context: 146405 Total methylated C's in CHH context: 648397 Total methylated C's in Unknown context: 16125 Total unmethylated C's in CpG context: 12770060 Total unmethylated C's in CHG context: 21848874 Total unmethylated C's in CHH context: 89443967 Total unmethylated C's in Unknown context: 135997 C methylated in CpG context: 19.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.6% 4305485 reads; of these: 4305485 (100.00%) were paired; of these: 1745166 (40.53%) aligned concordantly 0 times 959724 (22.29%) aligned concordantly exactly 1 time 1600595 (37.18%) aligned concordantly >1 times 59.47% overall alignment rate Processed 4305485 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305485 Number of paired-end alignments with a unique best hit: 2895203 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 701323 Sequence pairs did not map uniquely: 708959 Sequence pairs which were discarded because genomic sequence could not be extracted: 1 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1446760 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1448442 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127994979 Total methylated C's in CpG context: 3129542 Total methylated C's in CHG context: 146326 Total methylated C's in CHH context: 647702 Total methylated C's in Unknown context: 16241 Total unmethylated C's in CpG context: 12788394 Total unmethylated C's in CHG context: 21844738 Total unmethylated C's in CHH context: 89438277 Total unmethylated C's in Unknown context: 136274 C methylated in CpG context: 19.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.6% Now waiting for all child processes to complete 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1745732 (40.55%) aligned concordantly 0 times 960240 (22.30%) aligned concordantly exactly 1 time 1599514 (37.15%) aligned concordantly >1 times 59.45% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1747232 (40.58%) aligned concordantly 0 times 959756 (22.29%) aligned concordantly exactly 1 time 1598498 (37.13%) aligned concordantly >1 times 59.42% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2895652 Mapping efficiency: 67.3% Sequence pairs with no alignments under any condition: 701375 Sequence pairs did not map uniquely: 708459 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1446944 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1448704 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 127978221 Total methylated C's in CpG context: 3135297 Total methylated C's in CHG context: 146768 Total methylated C's in CHH context: 647782 Total methylated C's in Unknown context: 15979 Total unmethylated C's in CpG context: 12785624 Total unmethylated C's in CHG context: 21852479 Total unmethylated C's in CHH context: 89410271 Total unmethylated C's in Unknown context: 136713 C methylated in CpG context: 19.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.5% 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1743950 (40.51%) aligned concordantly 0 times 960089 (22.30%) aligned concordantly exactly 1 time 1601447 (37.20%) aligned concordantly >1 times 59.49% overall alignment rate 4305486 reads; of these: 4305486 (100.00%) were paired; of these: 1746677 (40.57%) aligned concordantly 0 times 959558 (22.29%) aligned concordantly exactly 1 time 1599251 (37.14%) aligned concordantly >1 times 59.43% overall alignment rate Processed 4305486 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4305486 Number of paired-end alignments with a unique best hit: 2895899 Mapping efficiency: 67.3% Sequence pairs with no alignments under any condition: 700331 Sequence pairs did not map uniquely: 709256 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1445872 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1450024 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 128034280 Total methylated C's in CpG context: 3127220 Total methylated C's in CHG context: 146598 Total methylated C's in CHH context: 645664 Total methylated C's in Unknown context: 16187 Total unmethylated C's in CpG context: 12797462 Total unmethylated C's in CHG context: 21848908 Total unmethylated C's in CHH context: 89468428 Total unmethylated C's in Unknown context: 135659 C methylated in CpG context: 19.6% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.7% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 17221940. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.1 /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.1 /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.2 /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.2 /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.3 /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.3 /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.4 /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.4 /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.5 /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.5 /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.6 /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.6 /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.7 /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.7 /tmp/13-wgbs-Qui4-4081988/Qui4_R1.fq.gz.temp.8 /tmp/13-wgbs-Qui4-4081988/Qui4_R2.fq.gz.temp.8 Now merging BAM files Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.2_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.3_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.4_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.5_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.6_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.7_bismark_bt2_pe.bam Qui4_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Qui4_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Qui4_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1_bismark_bt2_PE_report.txt Now merging temporary reports Qui4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Qui4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Qui4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 34443887 Number of paired-end alignments with a unique best hit: 23165102 Mapping efficiency: 67.3% Sequence pairs with no alignments under any condition: 5608285 Sequence pairs did not map uniquely: 5670500 Sequence pairs which were discarded because genomic sequence could not be extracted: 29 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 11570694 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 11594379 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1024091158 Total methylated C's in CpG context: 25053330 Total methylated C's in CHG context: 1172495 Total methylated C's in CHH context: 5176140 Total methylated C's in Unknown context: 129154 Total unmethylated C's in CpG context: 102258341 Total unmethylated C's in CHG context: 174805730 Total unmethylated C's in CHH context: 715625122 Total unmethylated C's in Unknown context: 1089453 C methylated in CpG context: 19.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.7% C methylated in Unknown context (CN or CHN): 10.6% Deleting temporary report files... Qui4_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui4_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 42m 50s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs-hapa/bismark/Qui4_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs-hapa/bismark/Qui4_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs-hapa/bismark/Qui4_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Qui4_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs-hapa/bismark/Qui4_pe.bam: 23165073 Total number duplicated alignments removed: 1227743 (5.30%) Duplicated alignments were found at: 1166280 different position(s) Total count of deduplicated leftover sequences: 21937330 (94.70% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_1A LN:100680956 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_3A LN:93095432 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_5A LN:90413844 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_7A LN:74165749 skipping header line: @SQ SN:Chromosome_8A LN:54853936 skipping header line: @SQ SN:Chromosome_9A LN:66796497 skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui4-4081988 --output_dir output/13-wgbs-hapa/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Qui4_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui4_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui4_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_1A LN:100680956 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_3A LN:93095432 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_5A LN:90413844 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_7A LN:74165749 skipping SAM header line: @SQ SN:Chromosome_8A LN:54853936 skipping SAM header line: @SQ SN:Chromosome_9A LN:66796497 skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Qui4_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Qui4_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui4-4081988 --output_dir output/13-wgbs-hapa/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui4_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Qui4_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.8 Processed 21937330 lines in total Total number of methylation call strings processed: 43874660 Final Cytosine Methylation Report ================================= Total number of C's analysed: 716264236 Total methylated C's in CpG context: 17508037 Total methylated C's in CHG context: 793316 Total methylated C's in CHH context: 3523238 Total C to T conversions in CpG context: 71667955 Total C to T conversions in CHG context: 122194817 Total C to T conversions in CHH context: 500576873 C methylated in CpG context: 19.6% C methylated in non-CpG context: 0.7% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui4_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui4_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui4_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui4_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Qui4_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui4_pe.deduplicated.txt.gz Writing bedGraph to file: Qui4_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Qui4_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Now writing methylation information for file >>CpG_context_Qui4_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Qui4_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp Sorting input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui4_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs-hapa/methylation/Qui4_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Qui4.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Qui4.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1439770 different covered positions) Writing cytosine report for chromosome Chromosome_1A (stored 3376093 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3126204 different covered positions) Writing cytosine report for chromosome Chromosome_3A (stored 2971434 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 3009642 different covered positions) Writing cytosine report for chromosome Chromosome_5A (stored 2815938 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2650235 different covered positions) Writing cytosine report for chromosome Chromosome_7A (stored 2417427 different covered positions) Writing cytosine report for chromosome Chromosome_8A (stored 1856970 different covered positions) Writing cytosine report for last chromosome Chromosome_9A (stored 2236060 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Qui4.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Qui4.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs-hapa/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome-hapa/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Could not find genomic nucleotide frequency table in the genome folder, calculating genomic frequencies (this may take several minutes depending on genome size) ... ==================================================================================================================================================================== Processing chromosome >> Chromosome_2A << Processing chromosome >> Chromosome_5A << Processing chromosome >> Chromosome_9A << Processing chromosome >> Chromosome_8A << Processing chromosome >> Chromosome_1A << Processing chromosome >> Chromosome_6A << Processing chromosome >> Chromosome_4A << Processing chromosome >> Chromosome_10A << Processing chromosome >> Chromosome_7A << Processing chromosome >> Chromosome_3A << Writing genomic nucleotide frequencies to the file >data/13-wgbs-genome-hapa/genomic_nucleotide_frequencies.txt< for future re-use Writing count of (di-)nucleotide: A 253281200 Writing count of (di-)nucleotide: AA 86162409 Writing count of (di-)nucleotide: AC 45489259 Writing count of (di-)nucleotide: AG 41639512 Writing count of (di-)nucleotide: AT 79989139 Writing count of (di-)nucleotide: C 141394985 Writing count of (di-)nucleotide: CA 54159510 Writing count of (di-)nucleotide: CC 28259664 Writing count of (di-)nucleotide: CG 17208692 Writing count of (di-)nucleotide: CT 41766898 Writing count of (di-)nucleotide: G 141251970 Writing count of (di-)nucleotide: GA 45250237 Writing count of (di-)nucleotide: GC 22357630 Writing count of (di-)nucleotide: GG 28206624 Writing count of (di-)nucleotide: GT 45437311 Writing count of (di-)nucleotide: T 253281001 Writing count of (di-)nucleotide: TA 67706051 Writing count of (di-)nucleotide: TC 45288269 Writing count of (di-)nucleotide: TG 54196921 Writing count of (di-)nucleotide: TT 86086811 Calculating read frequencies from file 'output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Processed 41500000 lines Processed 42000000 lines Processed 42500000 lines Processed 43000000 lines Processed 43500000 lines Printing nucleotide stats to >> output/13-wgbs-hapa/dedup/Qui4_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1821884647 34.15 253281200 32.09 7.193 C 854437589 16.01 141394985 17.92 6.043 G 951428496 17.83 141251970 17.90 6.736 T 1707554343 32.00 253281001 32.09 6.742 AA 660442974 12.47 86162409 10.92 7.665 AC 289727826 5.47 45489259 5.76 6.369 AG 292707617 5.53 41639512 5.28 7.030 AT 566483528 10.69 79989139 10.14 7.082 CA 349888660 6.61 54159510 6.86 6.460 CC 148560046 2.80 28259664 3.58 5.257 CG 105579656 1.99 17208692 2.18 6.135 CT 243820889 4.60 41766898 5.29 5.838 GA 321776359 6.07 45250237 5.73 7.111 GC 140078235 2.64 22357630 2.83 6.265 GG 174345144 3.29 28206624 3.57 6.181 GT 308248388 5.82 45437311 5.76 6.784 TA 476349979 8.99 67706051 8.58 7.036 TC 269865339 5.09 45288269 5.74 5.959 TG 371954588 7.02 54196921 6.87 6.863 TT 577132930 10.90 86086811 10.91 6.704 [Sat Oct 10 09:38:58 PDT 2026] Qui4 done