[Sat Oct 10 07:51:44 PDT 2026] Qui3 (Qui/Quilhua) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 42137866 total bases: 6362817766 Q20 bases: 6288233634(98.8278%) Q30 bases: 6092518841(95.7519%) Q40 bases: 6092518841(95.7519%) Read2 before filtering: total reads: 42137866 total bases: 6362817766 Q20 bases: 6279270768(98.6869%) Q30 bases: 6076434833(95.4991%) Q40 bases: 6076434833(95.4991%) Read1 after filtering: total reads: 41446330 total bases: 5722568364 Q20 bases: 5673740768(99.1468%) Q30 bases: 5524953195(96.5467%) Q40 bases: 5524953195(96.5467%) Read2 after filtering: total reads: 41446330 total bases: 5724768500 Q20 bases: 5673087308(99.0972%) Q30 bases: 5513545550(96.3104%) Q40 bases: 5513545550(96.3104%) Filtering result: reads passed filter: 82892660 reads failed due to low quality: 706846 reads failed due to too many N: 1614 reads failed due to too short: 674612 reads with adapter trimmed: 10275931 bases trimmed due to adapters: 207829890 Duplication rate: 6.01871% Insert size peak (evaluated by paired-end reads): 183 JSON report: output/13-wgbs-hapa/fastp/Qui3.fastp.json HTML report: output/13-wgbs-hapa/fastp/Qui3.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui3 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui3 (paired)_R2.fastq.gz -o output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz -O output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs-hapa/fastp/Qui3.fastp.json --html output/13-wgbs-hapa/fastp/Qui3.fastp.html fastp v1.0.1, time used: 77 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome-hapa/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/ Using temp directory: /tmp/13-wgbs-Qui3-4081989 Temporary files will be written into the directory: /tmp/13-wgbs-Qui3-4081989/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 5180792) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 5180792) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz for PID: 4082565 and offset 8 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.4 to /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 5180792) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.2 to /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 5180792) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.1 to /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.7 to /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.6 to /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz for PID: 4082565 and offset 8 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.8 to /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.5 to /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 5180791) Using the subset file >/tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui3_R1.fq.gz.temp.3 to /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.3_C_to_T.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.1 (5180792 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.1 to /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.4 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.4 to /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.7 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.7 to /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.6 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.6 to /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.2 (5180792 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.2 to /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.8 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.8 to /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.5 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.5 to /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Qui3_R1.fq.gz.temp.3 (5180791 sequences in total) Writing a G -> A converted version of the input file Qui3_R2.fq.gz.temp.3 to /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.3_G_to_A.fastq Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.1 (5180792 sequences in total) Input files are Qui3_R1.fq.gz.temp.1_C_to_T.fastq and Qui3_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.4 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.4_C_to_T.fastq and Qui3_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.6 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.6_C_to_T.fastq and Qui3_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.2 (5180792 sequences in total) Input files are Qui3_R1.fq.gz.temp.2_C_to_T.fastq and Qui3_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.5 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.5_C_to_T.fastq and Qui3_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.8 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.8_C_to_T.fastq and Qui3_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.7 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.7_C_to_T.fastq and Qui3_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui3_R2.fq.gz.temp.3 (5180791 sequences in total) Input files are Qui3_R1.fq.gz.temp.3_C_to_T.fastq and Qui3_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:25877:1042_1:N:0:TAACCATA+CNATCATG/1 77 * 0 0 * * 0 0 TTATTTTGTATATATAAATAGTTGTATTATAAATGTATTTAAATATTTTTGTAAAAATTGTATTTTTGTATAATGATTGTTAATATTTGTAAAATGTTTTTGTATTAATTGTATATTATTAAAAAGTTGAAGTATTGTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9IIIIIIII*IIIIIIIIIIIIII9IIIII*IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:25877:1042_2:N:0:TAACCATA+CNATCATG/2 141 * 0 0 * * 0 0 AAACCTTCCAATCCCAAACTTAAAACAAAAAATAATAATCCTAAAAATTCTCTACCATATCCAAACATTCACTTTATCTTATCTTTATAAAAAAATTAACACTAAAAAATCCTTAAACCTTTATATTACATATCAAAAATT IIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:43594:1042_1:N:0:TAACCATA+CAATCATG/1 77 * 0 0 * * 0 0 TTTTTTTGTATTTTTGAAATTTTGTATTAAAAGTGTAGATTTTTTTTTTATTAATTTTTTTGAAAATATATATAGAGTATTTTTATGAATATTTTTTAAAGGTATATGGTAAAAAAATTAATTTTATTTATAATTTTATGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIII9IIIIIIII9IIIIIIIIIIII9IIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:43594:1042_2:N:0:TAACCATA+CAATCATG/2 141 * 0 0 * * 0 0 TTCTCTAACCAACAAAAACCAATAATCCTAAAATAATTCTAATAACATTTCCAACCAACTTTATACCATTTCTTAACAAAACTAAATACTATTCAATAACTATTTCAAACCCTAAAATTTAAACTTTTTTTATTTCTACAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:40148:1042_1:N:0:TAACCATA+CAATCATG/1 99 Chromosome_9A_CT_converted 59488868 27 141M = 59488874 147 TAATTTTATTATAGTAGAATTTTAAATATTAAATTGTTATTTATAAATATAAGATGTATTGTAGAATTAAAGAAATTGAAGAAAGTATTGAAAATATATATATGTAAGTTAAAGTTTTTTTAAAGATGTATTTTTATGTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-81 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:40148:1042_2:N:0:TAACCATA+CAATCATG/2 147 Chromosome_9A_CT_converted 59488874 27 141M = 59488868 -147 TATTATAGTAGAATTTTAAATATTAAATTGTTATTTATAAATATAAGATGTATTGTAGAATTAAAGAAATTGAAGAAAGTATTGAAAATATATATATGTAAGTTAAAGTTTTTTTAAAGATGTATTTTTATGTATATAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-73 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:139A0A0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:39565:1042_1:N:0:TAACCATA+CAATCATG/1 99 Chromosome_3A_CT_converted 58325144 42 141M = 58325276 273 TTAAGTTTTGGATTTTTATTTTTTATATTAATTATATTGATTTTAATAAGTTTTTTGTTTTTAAGGATGAAATATAGTAGTAAGAATATATTAAGTAAGGTAGGTGAATGAAAATGTATTTTGATAGTGGAGTAGGAATAT IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:39565:1042_2:N:0:TAACCATA+CAATCATG/2 147 Chromosome_3A_CT_converted 58325276 42 141M = 58325144 -273 TAGGAATATATTGGAAATAATAATTAATATATTTTTATGTAATTTTTTTTTAATATTAGGATTTTTTATTTTAGTATTATAAATTATATATTATTGTATTTATTATTTTGTAATTTTATGATTTTGAGAATTATTTTTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:40681:1042_1:N:0:TAACCATA+CAATCATG/1 77 * 0 0 * * 0 0 GTGGATTTTATTATTTTATGAAAAGTTGGTATTAAATAATTGATTAGGTATTGAAAGTTTAAATTGTTTAGAATTTAAGAATGTTTTATTATTAAATATAATTAGTTATATAAAGAATATGATAATTTTTAATTTGTAAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:40681:1042_2:N:0:TAACCATA+CAATCATG/2 141 * 0 0 * * 0 0 AATATCCACCATCAATTCACATATCAACATTTTATATAACATATATTAAATTTCATTAACAACTTTAATTTCTAACTACAATTACAATATATATAAAATATCTCTACTTTACAAATTAAAAATTATCATATTCTTTATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:38093:1042_1:N:0:TAACCATA+CAATCATG/1 99 Chromosome_10A_CT_converted 8861113 42 141M = 8861135 163 ATATTGTATTTTTTAAGTTTGAAAATGTGTGATGTTTATTATAATTAAAAGATTATTTGATTATGGTTTTTATTTAAATTTGAGGATATGTTATTGTGGTTGTAAAATATGTAATTTTGATTAGTGAAAGTTAATTGTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:38093:1042_2:N:0:TAACCATA+CAATCATG/2 147 Chromosome_10A_CT_converted 8861135 42 141M = 8861113 -163 AAATGTGTGATGTTTATTATAATTAAAAGATTATTTGATTATGGTTTTTATTTAAATTTGAGGATATGTTATTGTGGTTGTAAAATATGTAATTTTGATTAGTGAAAGTTAATTGTTTATTTGTTTATTTGTTATATGTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:24501:1042_1:N:0:TAACCATA+CNATCATG/1 77 * 0 0 * * 0 0 AGAGTATATGTTTGAATTTTAGTTATTAATTATAATTTGGGGGGGGGGGTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*99I99**9**9*9******9* YT:Z:UP LH00129:489:23JFWNLT4:8:1101:24501:1042_2:N:0:TAACCATA+CNATCATG/2 141 * 0 0 * * 0 0 AAAACATCATATAAAAAAAAAATATCAACCATAATATAAATCTCAATAATCACCATATCATTAAAAA IIIIIIIIIIII99IIIII9I9IIII9I*I9IIII9I9IIIIII*IIIII9999*9I9II9I9II99 YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:35326:1042_1:N:0:TAACCATA+CAATCATG/1 99 Chromosome_3A_CT_converted 3596133 40 141M = 3596433 442 TTTTGTTGTTATTGTATTATATAAATATAAATATAATTTAGGATTTGTTTGGATTTGATAAGGAGATAGTAATTTTGAAAAGTAATATAGAGATATGTTTATGGATTATTTTTATTTATATGAATTAGTGTTTTGTAATGG IIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:103A37 YS:i:-44 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:35326:1042_2:N:0:TAACCATA+CAATCATG/2 147 Chromosome_3A_CT_converted 3596433 40 122M1D19M = 3596133 -442 GGTTTTAGAATTAAGTTGTTAATAGTTTTGGTGTTTTGTAGAGTTTATTGGAGAAGTGTATGTAGGATTTAAGGGAATTTATGTTGTATAAGATAAAATGATTTTTTTGTAAATTATTTTGATTTTTTTTTTTTTTTATAT **I9I***I9I*I9II9IIIII*9IIII*III9*9999*II9I*99*IIIII9II99I*99**9I99II9III99IIII999III999*III99IIIII*IIIIIII99IIIII9II9III*IIII9IIIIIIIIIIIIII AS:i:-44 XN:i:0 XM:i:6 XO:i:1 XG:i:1 NM:i:7 MD:Z:1A5T44T12T8T24T22^T19 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:24501:1042_1:N:0:TAACCATA+CNATCATG/1 77 * 0 0 * * 0 0 AGAGTATATGTTTGAATTTTAGTTATTAATTATAATTTGGGGGGGGGGGTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*99I99**9**9*9******9* YT:Z:UP LH00129:489:23JFWNLT4:8:1101:24501:1042_2:N:0:TAACCATA+CNATCATG/2 141 * 0 0 * * 0 0 AAAACATCATATAAAAAAAAAATATCAACCATAATATAAATCTCAATAATCACCATATCATTAAAAA IIIIIIIIIIII99IIIII9I9IIII9I*I9IIII9I9IIIIII*IIIII9999*9I9II9I9II99 YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:25877:1042_1:N:0:TAACCATA+CNATCATG/1 83 Chromosome_4A_GA_converted 25007456 42 141M = 25007306 -291 TAAACAATACTTCAACTTTTTAATAATATACAATTAATACAAAAACATTTTACAAATATTAACAATCATTATACAAAAATACAATTTTTACAAAAATATTTAAATACATTTATAATACAACTATTTATATATACAAAATAA IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII*IIIII9IIIIIIIIIIIIII*IIIIIIII9II9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:25877:1042_2:N:0:TAACCATA+CNATCATG/2 163 Chromosome_4A_GA_converted 25007306 42 141M = 25007456 291 AAACCTTCCAATCCCAAACTTAAAACAAAAAATAATAATCCTAAAAATTCTCTACCATATCCAAACATTCACTTTATCTTATCTTTATAAAAAAATTAACACTAAAAAATCCTTAAACCTTTATATTACATATCAAAAATT IIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:35326:1042_1:N:0:TAACCATA+CAATCATG/1 77 * 0 0 * * 0 0 TTTTGTTGTTATTGTATTATATAAATATAAATATAATTTAGGATTTGTTTGGATTTGATAAGGAGATAGTAATTTTGAAAAGTAATATAGAGATATGTTTATGGATTATTTTTATTTATATGAATTAGTGTTTTGTAATGG IIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:35326:1042_2:N:0:TAACCATA+CAATCATG/2 141 * 0 0 * * 0 0 ATATAAAAAAAAAAAAAAATCAAAATAATTTACAAAAAAATCATTTTATCTTATACAACATAAATTCCCTTAAATCCTACATACACTTCTCCAATAAACTCTACAAAACACCAAAACTATTAACAACTTAATTCTAAAACC IIIIIIIIIIIIII9IIII*III9II9IIIII99IIIIIII*IIIII99III*999III999IIII99III9II99I9**99*I99II9IIIII*99*I9II*9999*9III*IIII9*IIIII9II9I*I9I***I9I** YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:38093:1042_1:N:0:TAACCATA+CAATCATG/1 77 * 0 0 * * 0 0 ATATTGTATTTTTTAAGTTTGAAAATGTGTGATGTTTATTATAATTAAAAGATTATTTGATTATGGTTTTTATTTAAATTTGAGGATATGTTATTGTGGTTGTAAAATATGTAATTTTGATTAGTGAAAGTTAATTGTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:38093:1042_2:N:0:TAACCATA+CAATCATG/2 141 * 0 0 * * 0 0 AAACATATAACAAATAAACAAATAAACAATTAACTTTCACTAATCAAAATTACATATTTTACAACCACAATAACATATCCTCAAATTTAAATAAAAACCATAATCAAATAATCTTTTAATTATAATAAACATCACACATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:40148:1042_1:N:0:TAACCATA+CAATCATG/1 83 Chromosome_3A_GA_converted 26918488 0 109M16I9M1D7M = 26918482 -132 ATACATAAAAATACATCTTTAAAAAAACTTTAACTTACATATATATATTTTCAATACTTTCTTCAATTTCTTTAATTCTACAATACATCTTATATTTATAAATAACAATTTAATATTTAAAATTCTACTATAATAAAATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-67 XS:i:-67 XN:i:0 XM:i:1 XO:i:2 XG:i:17 NM:i:18 MD:Z:34A83^A7 YS:i:-71 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:40148:1042_2:N:0:TAACCATA+CAATCATG/2 163 Chromosome_3A_GA_converted 26918482 0 115M16I10M = 26918488 132 AATTATATACATAAAAATACATCTTTAAAAAAACTTTAACTTACATATATATATTTTCAATACTTTCTTCAATTTCTTTAATTCTACAATACATCTTATATTTATAAATAACAATTTAATATTTAAAATTCTACTATAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-71 XS:i:-71 XN:i:0 XM:i:3 XO:i:1 XG:i:16 NM:i:19 MD:Z:0T0T38A84 YS:i:-67 YT:Z:CP >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:39565:1042_1:N:0:TAACCATA+CAATCATG/1 77 * 0 0 * * 0 0 TTAAGTTTTGGATTTTTATTTTTTATATTAATTATATTGATTTTAATAAGTTTTTTGTTTTTAAGGATGAAATATAGTAGTAAGAATATATTAAGTAAGGTAGGTGAATGAAAATGTATTTTGATAGTGGAGTAGGAATAT IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:39565:1042_2:N:0:TAACCATA+CAATCATG/2 141 * 0 0 * * 0 0 TAAAAAAATAATTCTCAAAATCATAAAATTACAAAATAATAAATACAATAATATATAATTTATAATACTAAAATAAAAAATCCTAATATTAAAAAAAAATTACATAAAAATATATTAATTATTATTTCCAATATATTCCTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:40681:1042_1:N:0:TAACCATA+CAATCATG/1 83 Chromosome_7A_GA_converted 41567195 42 141M = 41567089 -247 CTTTACAAATTAAAAATTATCATATTCTTTATATAACTAATTATATTTAATAATAAAACATTCTTAAATTCTAAACAATTTAAACTTTCAATACCTAATCAATTATTTAATACCAACTTTTCATAAAATAATAAAATCCAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:58T82 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:40681:1042_2:N:0:TAACCATA+CAATCATG/2 163 Chromosome_7A_GA_converted 41567089 42 141M = 41567195 247 AATATCCACCATCAATTCACATATCAACATTTTATATAACATATATTAAATTTCATTAACAACTTTAATTTCTAACTACAATTACAATATATATAAAATATCTCTACTTTACAAATTAAAAATTATCATATTCTTTATATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:43594:1042_1:N:0:TAACCATA+CAATCATG/1 83 Chromosome_4A_GA_converted 84398494 42 141M = 84398281 -354 TCATAAAATTATAAATAAAATTAATTTTTTTACCATATACCTTTAAAAAATATTCATAAAAATACTCTATATATATTTTCAAAAAAATTAATAAAAAAAAAATCTACACTTTTAATACAAAATTTCAAAAATACAAAAAAA IIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIII9IIIIIIIIIIII9IIIIIIII9IIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:39T54T46 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:43594:1042_2:N:0:TAACCATA+CAATCATG/2 163 Chromosome_4A_GA_converted 84398281 42 141M = 84398494 354 TTCTCTAACCAACAAAAACCAATAATCCTAAAATAATTCTAATAACATTTCCAACCAACTTTATACCATTTCTTAACAAAACTAAATACTATTCAATAACTATTTCAAACCCTAAAATTTAAACTTTTTTTATTTCTACAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui3_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.1 and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.2 and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.4 and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.5 and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.8 and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.6 and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.3 and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.7 and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.7 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1120:43513:6731_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973124 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1133:23191:21444_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973151 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1142:46563:4951_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973129 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1170:32114:8258_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1170:21160:2681_1:N:0:TAACCATA+CAATCATG Chromosome_9A 1 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1192:44985:23854_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1196:5183:10795_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973206 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1285:7173:10178_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1311:11363:23350_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973139 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1298:30100:29431_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973117 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1318:16978:24723_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1320:49961:22467_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973128 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1325:17431:20743_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973128 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1325:43561:9449_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973126 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1353:50446:19468_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973135 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1366:17682:24877_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973166 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1360:44104:7642_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973126 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1366:18410:27203_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973166 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1368:11994:2724_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973116 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1383:41102:4545_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1390:44557:19720_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973121 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1429:18741:4013_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973117 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1434:20100:1462_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973135 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1441:50527:26839_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2132:15473:21948_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973118 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2166:28409:8987_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2177:47348:23069_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2190:24073:28772_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2209:43286:19034_1:N:0:TAACCATA+CAATCATG Chromosome_3A 93095291 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2207:42057:29207_1:N:0:TAACCATA+CAATCATA Chromosome_4A 2 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2243:36151:14718_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2251:43141:2724_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973116 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2280:46555:6030_1:N:0:TAACCATA+CAATCATG Chromosome_3A 1 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2311:22010:9786_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973123 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2317:7051:14928_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973117 Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2337:9956:12392_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973117 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2338:12868:12112_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973130 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2351:16169:21612_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973121 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2357:18652:14368_1:N:0:TAACCATA+CAATCATG Chromosome_4A 2 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2383:32737:2303_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973135 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2381:24841:13821_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973140 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2386:23199:29669_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2405:19834:8398_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973118 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2409:24655:7586_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973118 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2413:50446:2513_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2445:1405:25998_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973127 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2450:11679:26979_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973117 Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 5000000 sequence pairs so far 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2132341 (41.16%) aligned concordantly 0 times 1156912 (22.33%) aligned concordantly exactly 1 time 1891538 (36.51%) aligned concordantly >1 times 58.84% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2126077 (41.04%) aligned concordantly 0 times 1157876 (22.35%) aligned concordantly exactly 1 time 1896838 (36.61%) aligned concordantly >1 times 58.96% overall alignment rate Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 3490688 Mapping efficiency: 67.4% Sequence pairs with no alignments under any condition: 861103 Sequence pairs did not map uniquely: 829000 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1747312 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1743373 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 153574307 Total methylated C's in CpG context: 3911854 Total methylated C's in CHG context: 183792 Total methylated C's in CHH context: 830626 Total methylated C's in Unknown context: 22544 Total unmethylated C's in CpG context: 14754990 Total unmethylated C's in CHG context: 25874024 Total unmethylated C's in CHH context: 108019021 Total unmethylated C's in Unknown context: 169958 C methylated in CpG context: 21.0% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.7% Processed 5000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2490:23612:1575_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973122 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2126091 (41.04%) aligned concordantly 0 times 1157692 (22.35%) aligned concordantly exactly 1 time 1897008 (36.62%) aligned concordantly >1 times 58.96% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2131581 (41.14%) aligned concordantly 0 times 1158458 (22.36%) aligned concordantly exactly 1 time 1890752 (36.50%) aligned concordantly >1 times 58.86% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2131441 (41.14%) aligned concordantly 0 times 1157145 (22.34%) aligned concordantly exactly 1 time 1892205 (36.52%) aligned concordantly >1 times 58.86% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2127832 (41.07%) aligned concordantly 0 times 1157458 (22.34%) aligned concordantly exactly 1 time 1895501 (36.59%) aligned concordantly >1 times 58.93% overall alignment rate Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 3491469 Mapping efficiency: 67.4% Sequence pairs with no alignments under any condition: 859700 Sequence pairs did not map uniquely: 829622 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1747435 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1744030 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 153555047 Total methylated C's in CpG context: 3911409 Total methylated C's in CHG context: 183379 Total methylated C's in CHH context: 831866 Total methylated C's in Unknown context: 22303 Total unmethylated C's in CpG context: 14768353 Total unmethylated C's in CHG context: 25886145 Total unmethylated C's in CHH context: 107973895 Total unmethylated C's in Unknown context: 169116 C methylated in CpG context: 20.9% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.7% Now waiting for all child processes to complete Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 3493218 Mapping efficiency: 67.4% Sequence pairs with no alignments under any condition: 860649 Sequence pairs did not map uniquely: 826924 Sequence pairs which were discarded because genomic sequence could not be extracted: 6 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1748146 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1745066 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 153707459 Total methylated C's in CpG context: 3917062 Total methylated C's in CHG context: 184185 Total methylated C's in CHH context: 832675 Total methylated C's in Unknown context: 22527 Total unmethylated C's in CpG context: 14771400 Total unmethylated C's in CHG context: 25907134 Total unmethylated C's in CHH context: 108095003 Total unmethylated C's in Unknown context: 169885 C methylated in CpG context: 21.0% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.7% Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2495:29922:3816_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973116 5180792 reads; of these: 5180792 (100.00%) were paired; of these: 2125800 (41.03%) aligned concordantly 0 times 1158232 (22.36%) aligned concordantly exactly 1 time 1896760 (36.61%) aligned concordantly >1 times 58.97% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2132322 (41.16%) aligned concordantly 0 times 1157593 (22.34%) aligned concordantly exactly 1 time 1890876 (36.50%) aligned concordantly >1 times 58.84% overall alignment rate 5180792 reads; of these: 5180792 (100.00%) were paired; of these: 2131963 (41.15%) aligned concordantly 0 times 1157329 (22.34%) aligned concordantly exactly 1 time 1891500 (36.51%) aligned concordantly >1 times 58.85% overall alignment rate Processed 5180792 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180792 Number of paired-end alignments with a unique best hit: 3491114 Mapping efficiency: 67.4% Sequence pairs with no alignments under any condition: 861023 Sequence pairs did not map uniquely: 828655 Sequence pairs which were discarded because genomic sequence could not be extracted: 6 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1748385 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1742723 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 153538872 Total methylated C's in CpG context: 3916331 Total methylated C's in CHG context: 183815 Total methylated C's in CHH context: 828701 Total methylated C's in Unknown context: 22543 Total unmethylated C's in CpG context: 14758853 Total unmethylated C's in CHG context: 25880564 Total unmethylated C's in CHH context: 107970608 Total unmethylated C's in Unknown context: 168770 C methylated in CpG context: 21.0% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.8% 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2126747 (41.05%) aligned concordantly 0 times 1158108 (22.35%) aligned concordantly exactly 1 time 1895936 (36.60%) aligned concordantly >1 times 58.95% overall alignment rate Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 3491574 Mapping efficiency: 67.4% Sequence pairs with no alignments under any condition: 861266 Sequence pairs did not map uniquely: 827951 Sequence pairs which were discarded because genomic sequence could not be extracted: 10 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1746884 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1744680 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 153616172 Total methylated C's in CpG context: 3919379 Total methylated C's in CHG context: 184051 Total methylated C's in CHH context: 828899 Total methylated C's in Unknown context: 22357 Total unmethylated C's in CpG context: 14763891 Total unmethylated C's in CHG context: 25913193 Total unmethylated C's in CHH context: 108006759 Total unmethylated C's in Unknown context: 169035 C methylated in CpG context: 21.0% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.7% 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2127511 (41.07%) aligned concordantly 0 times 1158410 (22.36%) aligned concordantly exactly 1 time 1894870 (36.57%) aligned concordantly >1 times 58.93% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2133063 (41.17%) aligned concordantly 0 times 1157461 (22.34%) aligned concordantly exactly 1 time 1890267 (36.49%) aligned concordantly >1 times 58.83% overall alignment rate Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2498:34533:28282_1:N:0:TAACCATA+CAATCATG Chromosome_4A 93973130 Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 3492430 Mapping efficiency: 67.4% Sequence pairs with no alignments under any condition: 861490 Sequence pairs did not map uniquely: 826871 Sequence pairs which were discarded because genomic sequence could not be extracted: 11 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1747459 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1744960 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 153645816 Total methylated C's in CpG context: 3913698 Total methylated C's in CHG context: 184837 Total methylated C's in CHH context: 831022 Total methylated C's in Unknown context: 22735 Total unmethylated C's in CpG context: 14773251 Total unmethylated C's in CHG context: 25908564 Total unmethylated C's in CHH context: 108034444 Total unmethylated C's in Unknown context: 169498 C methylated in CpG context: 20.9% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.8% 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2132692 (41.17%) aligned concordantly 0 times 1157380 (22.34%) aligned concordantly exactly 1 time 1890719 (36.49%) aligned concordantly >1 times 58.83% overall alignment rate 5180791 reads; of these: 5180791 (100.00%) were paired; of these: 2126887 (41.05%) aligned concordantly 0 times 1157900 (22.35%) aligned concordantly exactly 1 time 1896004 (36.60%) aligned concordantly >1 times 58.95% overall alignment rate Processed 5180791 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180791 Number of paired-end alignments with a unique best hit: 3489010 Mapping efficiency: 67.3% Sequence pairs with no alignments under any condition: 861375 Sequence pairs did not map uniquely: 830406 Sequence pairs which were discarded because genomic sequence could not be extracted: 8 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1745775 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1743227 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 153500105 Total methylated C's in CpG context: 3912666 Total methylated C's in CHG context: 183594 Total methylated C's in CHH context: 830164 Total methylated C's in Unknown context: 22552 Total unmethylated C's in CpG context: 14747849 Total unmethylated C's in CHG context: 25883732 Total unmethylated C's in CHH context: 107942100 Total unmethylated C's in Unknown context: 169168 C methylated in CpG context: 21.0% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.8% 5180792 reads; of these: 5180792 (100.00%) were paired; of these: 2126480 (41.05%) aligned concordantly 0 times 1157927 (22.35%) aligned concordantly exactly 1 time 1896385 (36.60%) aligned concordantly >1 times 58.95% overall alignment rate 5180792 reads; of these: 5180792 (100.00%) were paired; of these: 2129448 (41.10%) aligned concordantly 0 times 1159871 (22.39%) aligned concordantly exactly 1 time 1891473 (36.51%) aligned concordantly >1 times 58.90% overall alignment rate Processed 5180792 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 5180792 Number of paired-end alignments with a unique best hit: 3493115 Mapping efficiency: 67.4% Sequence pairs with no alignments under any condition: 858835 Sequence pairs did not map uniquely: 828842 Sequence pairs which were discarded because genomic sequence could not be extracted: 2 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1746730 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1746383 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 153658451 Total methylated C's in CpG context: 3917740 Total methylated C's in CHG context: 184756 Total methylated C's in CHH context: 833007 Total methylated C's in Unknown context: 22704 Total unmethylated C's in CpG context: 14771830 Total unmethylated C's in CHG context: 25897766 Total unmethylated C's in CHH context: 108053352 Total unmethylated C's in Unknown context: 170146 C methylated in CpG context: 21.0% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.8% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 20723164. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.1 /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.1 /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.2 /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.2 /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.3 /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.3 /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.4 /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.4 /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.5 /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.5 /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.6 /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.6 /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.7 /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.7 /tmp/13-wgbs-Qui3-4081989/Qui3_R1.fq.gz.temp.8 /tmp/13-wgbs-Qui3-4081989/Qui3_R2.fq.gz.temp.8 Now merging BAM files Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.2_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.3_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.4_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.5_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.6_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.7_bismark_bt2_pe.bam Qui3_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Qui3_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Qui3_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1_bismark_bt2_PE_report.txt Now merging temporary reports Qui3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Qui3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Qui3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 41446330 Number of paired-end alignments with a unique best hit: 27932618 Mapping efficiency: 67.4% Sequence pairs with no alignments under any condition: 6885441 Sequence pairs did not map uniquely: 6628271 Sequence pairs which were discarded because genomic sequence could not be extracted: 50 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 13978126 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 13954442 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1228796229 Total methylated C's in CpG context: 31320139 Total methylated C's in CHG context: 1472409 Total methylated C's in CHH context: 6646960 Total methylated C's in Unknown context: 180265 Total unmethylated C's in CpG context: 118110417 Total unmethylated C's in CHG context: 207151122 Total unmethylated C's in CHH context: 864095182 Total unmethylated C's in Unknown context: 1355576 C methylated in CpG context: 21.0% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.7% Deleting temporary report files... Qui3_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui3_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 52m 4s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs-hapa/bismark/Qui3_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs-hapa/bismark/Qui3_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs-hapa/bismark/Qui3_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Qui3_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs-hapa/bismark/Qui3_pe.bam: 27932568 Total number duplicated alignments removed: 1987801 (7.12%) Duplicated alignments were found at: 1850915 different position(s) Total count of deduplicated leftover sequences: 25944767 (92.88% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_1A LN:100680956 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_3A LN:93095432 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_5A LN:90413844 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_7A LN:74165749 skipping header line: @SQ SN:Chromosome_8A LN:54853936 skipping header line: @SQ SN:Chromosome_9A LN:66796497 skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui3-4081989 --output_dir output/13-wgbs-hapa/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Qui3_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui3_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui3_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_1A LN:100680956 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_3A LN:93095432 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_5A LN:90413844 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_7A LN:74165749 skipping SAM header line: @SQ SN:Chromosome_8A LN:54853936 skipping SAM header line: @SQ SN:Chromosome_9A LN:66796497 skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Qui3_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Qui3_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui3-4081989 --output_dir output/13-wgbs-hapa/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui3_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Qui3_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24500000 Processed lines: 24500000 Processed lines: 24500000 Processed lines: 24500000 Processed lines: 24500000 Processed lines: 24500000 Processed lines: 24500000 Processed lines: 24500000 Processed lines: 25000000 Processed lines: 25000000 Processed lines: 25000000 Processed lines: 25000000 Processed lines: 25000000 Processed lines: 25000000 Processed lines: 25000000 Processed lines: 25000000 Processed lines: 25500000 Processed lines: 25500000 Processed lines: 25500000 Processed lines: 25500000 Processed lines: 25500000 Processed lines: 25500000 Processed lines: 25500000 Processed lines: 25500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.8 Processed 25944767 lines in total Total number of methylation call strings processed: 51889534 Final Cytosine Methylation Report ================================= Total number of C's analysed: 866461299 Total methylated C's in CpG context: 22027251 Total methylated C's in CHG context: 912847 Total methylated C's in CHH context: 4163561 Total C to T conversions in CpG context: 83537757 Total C to T conversions in CHG context: 146091620 Total C to T conversions in CHH context: 609728263 C methylated in CpG context: 20.9% C methylated in non-CpG context: 0.7% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui3_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui3_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui3_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui3_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Qui3_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui3_pe.deduplicated.txt.gz Writing bedGraph to file: Qui3_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Qui3_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Now writing methylation information for file >>CpG_context_Qui3_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Qui3_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp Sorting input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui3_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs-hapa/methylation/Qui3_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Qui3.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Qui3.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1442365 different covered positions) Writing cytosine report for chromosome Chromosome_1A (stored 3445558 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3215979 different covered positions) Writing cytosine report for chromosome Chromosome_3A (stored 3059099 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 3088103 different covered positions) Writing cytosine report for chromosome Chromosome_5A (stored 2863115 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2710340 different covered positions) Writing cytosine report for chromosome Chromosome_7A (stored 2471460 different covered positions) Writing cytosine report for chromosome Chromosome_8A (stored 1934526 different covered positions) Writing cytosine report for last chromosome Chromosome_9A (stored 2287541 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Qui3.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Qui3.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs-hapa/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome-hapa/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome-hapa/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Processed 41500000 lines Processed 42000000 lines Processed 42500000 lines Processed 43000000 lines Processed 43500000 lines Processed 44000000 lines Processed 44500000 lines Processed 45000000 lines Processed 45500000 lines Processed 46000000 lines Processed 46500000 lines Processed 47000000 lines Processed 47500000 lines Processed 48000000 lines Processed 48500000 lines Processed 49000000 lines Processed 49500000 lines Processed 50000000 lines Processed 50500000 lines Processed 51000000 lines Processed 51500000 lines Printing nucleotide stats to >> output/13-wgbs-hapa/dedup/Qui3_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 2180931225 34.68 253281200 32.09 8.611 C 999970322 15.90 141394985 17.92 7.072 G 1104868408 17.57 141251970 17.90 7.822 T 2003541542 31.86 253281001 32.09 7.910 AA 804034936 12.88 86162409 10.92 9.332 AC 342891232 5.49 45489259 5.76 7.538 AG 345561078 5.53 41639512 5.28 8.299 AT 673470607 10.79 79989139 10.14 8.420 CA 414194053 6.63 54159510 6.86 7.648 CC 172775424 2.77 28259664 3.58 6.114 CG 120960347 1.94 17208692 2.18 7.029 CT 284324612 4.55 41766898 5.29 6.807 GA 380523774 6.09 45250237 5.73 8.409 GC 161527754 2.59 22357630 2.83 7.225 GG 201336933 3.22 28206624 3.57 7.138 GT 353393100 5.66 45437311 5.76 7.778 TA 566246968 9.07 67706051 8.58 8.363 TC 315514425 5.05 45288269 5.74 6.967 TG 429083766 6.87 54196921 6.87 7.917 TT 678353309 10.86 86086811 10.91 7.880 [Sat Oct 10 09:51:53 PDT 2026] Qui3 done