[Sat Oct 10 07:51:54 PDT 2026] Qui2 (Qui/Quilhua) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 37248902 total bases: 5624584202 Q20 bases: 5553012526(98.7275%) Q30 bases: 5357316851(95.2482%) Q40 bases: 5357316851(95.2482%) Read2 before filtering: total reads: 37248902 total bases: 5624584202 Q20 bases: 5546827386(98.6176%) Q30 bases: 5353834420(95.1863%) Q40 bases: 5353834420(95.1863%) Read1 after filtering: total reads: 36627727 total bases: 5065717056 Q20 bases: 5017442236(99.047%) Q30 bases: 4866068337(96.0588%) Q40 bases: 4866068337(96.0588%) Read2 after filtering: total reads: 36627727 total bases: 5067805331 Q20 bases: 5018135856(99.0199%) Q30 bases: 4862639204(95.9516%) Q40 bases: 4862639204(95.9516%) Filtering result: reads passed filter: 73255454 reads failed due to low quality: 644014 reads failed due to too many N: 1892 reads failed due to too short: 596444 reads with adapter trimmed: 8101702 bases trimmed due to adapters: 163934720 Duplication rate: 5.18274% Insert size peak (evaluated by paired-end reads): 189 JSON report: output/13-wgbs-hapa/fastp/Qui2.fastp.json HTML report: output/13-wgbs-hapa/fastp/Qui2.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui2 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui2 (paired)_R2.fastq.gz -o output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz -O output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs-hapa/fastp/Qui2.fastp.json --html output/13-wgbs-hapa/fastp/Qui2.fastp.html fastp v1.0.1, time used: 70 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome-hapa/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/ Using temp directory: /tmp/13-wgbs-Qui2-2465597 Temporary files will be written into the directory: /tmp/13-wgbs-Qui2-2465597/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4578466) Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz for PID: 2466318 and offset 8 (sequences written out: 4578465) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz<) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.6 to /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz for PID: 2466318 and offset 8 (sequences written out: 4578465) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.8 to /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.4 to /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.1 to /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.3 to /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4578466) Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz<) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.7 to /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.7_C_to_T.fastq Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.5 to /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4578466) Using the subset file >/tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui2_R1.fq.gz.temp.2 to /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.2_C_to_T.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.6 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.6 to /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.8 (4578465 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.8 to /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.4 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.4 to /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.1 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.1 to /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.3 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.3 to /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.5 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.5 to /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.7 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.7 to /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Qui2_R1.fq.gz.temp.2 (4578466 sequences in total) Writing a G -> A converted version of the input file Qui2_R2.fq.gz.temp.2 to /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.2_G_to_A.fastq Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.6 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.6_C_to_T.fastq and Qui2_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.8 (4578465 sequences in total) Input files are Qui2_R1.fq.gz.temp.8_C_to_T.fastq and Qui2_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:43901:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 TTTATATTTAGTATTTGATGTTTAATTTTGTTTAAGTTATGATATAATTAATATTAAAATTTGTATGAGTAATTTGTAAAAAGAATAATAAATTTATTTATTAATAAATGAAAAGAAATTTTAGATATTTGGAAATAAAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:43901:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 TATTAAATACCAAATTATATATATATTATCATATAATTTAATCATACTTTTATTTCCAAATATCTAAAATTTCTTTTCATTTATTAATAAATAAATTTATTATTCTTTTTACAAATTACTCATACAAATTTTAATATTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:1582:1056_1:N:0:CATAAGCC+TNTCGGCT/1 77 * 0 0 * * 0 0 TGTTTAATATATATTTAAATGTGTGTTTATAATTTTTATAAAGATAAAATTATGAATATTTTAAATTTTTTGTTATATATAAAATGTATATGTATATATGTTGTGAATGTTGAATTGAGTGAAGTATTAAAAAGTTTATGG IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:1582:1056_2:N:0:CATAAGCC+TNTCGGCT/2 141 * 0 0 * * 0 0 CCTAACTAAATCATAATTATCACTTAAAACACACCATAAACTTTTTAATACTTCACTCAATTCAACATTCACAACATATATACATATACATTTTATATATAACAAAAAATTTAAAATATTCATAATTTTATCTTTATAAAA III9IIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.1 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.1_C_to_T.fastq and Qui2_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.4 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.4_C_to_T.fastq and Qui2_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.3 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.3_C_to_T.fastq and Qui2_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:43901:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 TTTATATTTAGTATTTGATGTTTAATTTTGTTTAAGTTATGATATAATTAATATTAAAATTTGTATGAGTAATTTGTAAAAAGAATAATAAATTTATTTATTAATAAATGAAAAGAAATTTTAGATATTTGGAAATAAAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:43901:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 TATTAAATACCAAATTATATATATATTATCATATAATTTAATCATACTTTTATTTCCAAATATCTAAAATTTCTTTTCATTTATTAATAAATAAATTTATTATTCTTTTTACAAATTACTCATACAAATTTTAATATTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:1582:1056_1:N:0:CATAAGCC+TNTCGGCT/1 83 Chromosome_4A_GA_converted 52134602 42 141M = 52134569 -174 CCATAAACTTTTTAATACTTCACTCAATTCAACATTCACAACATATATACATATACATTTTATATATAACAAAAAATTTAAAATATTCATAATTTTATCTTTATAAAAATTATAAACACACATTTAAATATATATTAAACA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:1582:1056_2:N:0:CATAAGCC+TNTCGGCT/2 163 Chromosome_4A_GA_converted 52134569 42 141M = 52134602 174 CCTAACTAAATCATAATTATCACTTAAAACACACCATAAACTTTTTAATACTTCACTCAATTCAACATTCACAACATATATACATATACATTTTATATATAACAAAAAATTTAAAATATTCATAATTTTATCTTTATAAAA III9IIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:38238:1042_1:N:0:CATAAGCC+TATCGGCT/1 99 Chromosome_10A_CT_converted 40424304 6 141M = 40424398 235 ATGGTGTGTGTGTGTGTGTGTTATTGATAGAGTATATATTTAAGTGTAAATGTGATGTATGAATATTTTGATATATGTAATTATTTTTTAATGTGTTTTTTAATTAATTTTTGTTGAAAAATTATAAGATTTTTAATGGTT IIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-11 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:38238:1042_2:N:0:CATAAGCC+TATCGGCT/2 147 Chromosome_10A_CT_converted 40424398 6 141M = 40424304 -235 GTTTTTTAATTAATTTTTGTTGAAAAATTATAAGATTTTTAATGGTTGTGTTAGAATTTTTATAATGGTTTTGTTTTATTGATTTTTTTTATATGGTGATTTTAAAGTGATATAAGTATTTTGATGATGAGTATTTTAATG 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:36151:1042_1:N:0:CATAAGCC+TATCGGCT/1 99 Chromosome_5A_CT_converted 87518785 42 141M = 87518969 325 TATAAATATATAAATTGTGTTTTATTGTATTAGAAGAAGAATAAAATTTATTTGTTATTTAGTTGTAGATTAGAATGATTAAATTTTTTTTAAATTGTTTATTGAATTGTTTGTAGGAATTTGGGAAGGAGTGGTAGTAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:36151:1042_2:N:0:CATAAGCC+TATCGGCT/2 147 Chromosome_5A_CT_converted 87518969 42 141M = 87518785 -325 AGAGGAATATAAATGTTTTAGTTAATTTGTATTTTATTTATGTATTAATTTTTAAGGAAGAATAATATATTTATAGAAATTTGATATGGATGATTATATATTGTAATAATAATATTTTGAAATTGAAAATGTTTAAATTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.5 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.5_C_to_T.fastq and Qui2_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:39872:1042_1:N:0:CATAAGCC+TATCGGCT/1 99 Chromosome_6A_CT_converted 67424570 6 141M = 67424809 380 TGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-18 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:75A23G41 YS:i:-24 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:39872:1042_2:N:0:CATAAGCC+TATCGGCT/2 147 Chromosome_6A_CT_converted 67424809 6 141M = 67424570 -380 TATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATAGATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATAGATAGATTAATGATAGTGTGTTTTATTGTATAATTAATATATAGATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-24 XS:i:-24 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:4A11G77T9A36 YS:i:-12 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.7 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.7_C_to_T.fastq and Qui2_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui2_R2.fq.gz.temp.2 (4578466 sequences in total) Input files are Qui2_R1.fq.gz.temp.2_C_to_T.fastq and Qui2_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:40018:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 AAATTTTATTAATAAAGTTGAAAAATATTAAGTTTATGTGGTAATTATAAATGATATTTGATGATTTTAGATTTTTATTTTTAAGTGTTTGTTTTTTAAAATTATATTTAATTTAAATTAAAATTAATTATATTTTTTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:40018:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 TTCCATTCTCAAATTTTACAAATATCATCACTACAACAAAAATATATTTATTAACTTATTTATCAAATTATTTATTAAACCACACCAATTTATAAAATAATTCTTCAAATTTTCAACCAAAAAAAATAAAACAAAAAAACA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:37640:1042_1:N:0:CATAAGCC+TATCGGCT/1 99 Chromosome_1A_CT_converted 48062079 42 141M = 48062207 269 TAGTTTTTTTTTTGTAAATTATGTTTTAAGATATGATTTGTTTATTGTTATTTGTATTTTATATAATGATTTATATAAGTATTATTTTGTTTTTATTATATAGAATGTATATAAGGAGATATGAAATTTATTTTTGAATGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIIIIIIIIIIIIIII*IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:37640:1042_2:N:0:CATAAGCC+TATCGGCT/2 147 Chromosome_1A_CT_converted 48062207 42 141M = 48062079 -269 TATTTTTGAATGTTTATAGGTTTTAGTAATTTTTTATGAATTTTAATTTTTTAATTATTGATTGGTTATATTTATTTTATATTTATTTTTATTTATGTAGATTAATAATTTTTATTTAAGTAGTTGATTTTTTTGTATTTT IIIII9IIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:140A0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:51765:1042_1:N:0:CATAAGCC+TATCGGCT/1 99 Chromosome_2A_CT_converted 39432930 6 141M = 39432945 156 TATTTTTTATGTATAATAAAATAAAAAGTATGTTAAATTGGGTTAAATGTAATATGGTTTAGAAGAGGTTATGAAATATATGTTATGTTTATTTTTTTGATGTATGAAAATTAATATGTTAATAAGTTATATTGTTTATTA IIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIII9II9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9 AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:51765:1042_2:N:0:CATAAGCC+TATCGGCT/2 147 Chromosome_2A_CT_converted 39432945 6 141M = 39432930 -156 ATAAAATAAAAAGTATGTTAAATTGGGTTAAATGTAATATGGTTTAGAAGAGGTTATGAAATATATGTTATGTTTATTTTTTTGATGTATGAAAATTAATATGTTAATAAGTTATATTGTTTATTATATTTATATAAAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Reading in the sequence files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.6 and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.8 and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.8 Found first alignment: LH00129:489:23JFWNLT4:8:1101:36151:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 TATAAATATATAAATTGTGTTTTATTGTATTAGAAGAAGAATAAAATTTATTTGTTATTTAGTTGTAGATTAGAATGATTAAATTTTTTTTAAATTGTTTATTGAATTGTTTGTAGGAATTTGGGAAGGAGTGGTAGTAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:36151:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 TAAATTTAAACATTTTCAATTTCAAAATATTATTATTACAATATATAATCATCCATATCAAATTTCTATAAATATATTATTCTTCCTTAAAAATTAATACATAAATAAAATACAAATTAACTAAAACATTTATATTCCTCT IIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:40018:1042_1:N:0:CATAAGCC+TATCGGCT/1 83 Chromosome_10A_GA_converted 3834458 42 141M = 3834259 -340 TAAAAAAAATATAATTAATTTTAATTTAAATTAAATATAATTTTAAAAAACAAACACTTAAAAATAAAAATCTAAAATCATCAAATATCATTTATAATTACCACATAAACTTAATATTTTTCAACTTTATTAATAAAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:40018:1042_2:N:0:CATAAGCC+TATCGGCT/2 163 Chromosome_10A_GA_converted 3834259 42 141M = 3834458 340 TTCCATTCTCAAATTTTACAAATATCATCACTACAACAAAAATATATTTATTAACTTATTTATCAAATTATTTATTAAACCACACCAATTTATAAAATAATTCTTCAAATTTTCAACCAAAAAAAATAAAACAAAAAAACA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:38238:1042_1:N:0:CATAAGCC+TATCGGCT/1 83 Chromosome_1A_GA_converted 83127976 2 4M2I96M2I37M = 83127889 -224 AACCATTAAAAATCTTATAATTTTTCAACAAAAATTAATTAAAAAACACATTAAAAAATAATTACATATATCAAAATATTCATACATCACATTTACACTTAAATATATACTCTATCAATAACACACACACACACACACCAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIII AS:i:-70 XS:i:-67 XN:i:0 XM:i:8 XO:i:2 XG:i:4 NM:i:12 MD:Z:3A7T65C33T5T16A0C0A0 YS:i:-60 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:38238:1042_2:N:0:CATAAGCC+TATCGGCT/2 163 Chromosome_1A_GA_converted 83127889 2 28M1I1M1I62M7I41M = 83127976 224 CATTAAAATACTCATCATCAAAATACTTATATCACTTTAAAATCACCATATAAAAAAAATCAATAAAACAAAACCATTATAAAAATTCTAACACAACCATTAAAAATCTTATAATTTTTCAACAAAAATTAATTAAAAAAC IIIIIIIII9IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9 AS:i:-60 XS:i:-65 XN:i:0 XM:i:3 XO:i:3 XG:i:9 NM:i:12 MD:Z:46C35T15T33 YS:i:-70 YT:Z:CP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:39872:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 TGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATATAGATTAAAGATAGTGTGTTTTATTGTATAATTAATATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:39872:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 AATCTATATATTAATTATACAATAAAACACACTATCATTAATCTATCTATTAATTATACAATAAAACACACTATCTTTAATCTATCTATTAATTATACAATAAAACACACTATCTTTAATCTATATATTAATTATACAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:37640:1042_1:N:0:CATAAGCC+TATCGGCT/1 77 * 0 0 * * 0 0 TAGTTTTTTTTTTGTAAATTATGTTTTAAGATATGATTTGTTTATTGTTATTTGTATTTTATATAATGATTTATATAAGTATTATTTTGTTTTTATTATATAGAATGTATATAAGGAGATATGAAATTTATTTTTGAATGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIIIIIIIIIIIIIII*IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIII9IIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:37640:1042_2:N:0:CATAAGCC+TATCGGCT/2 141 * 0 0 * * 0 0 AAAATACAAAAAAATCAACTACTTAAATAAAAATTATTAATCTACATAAATAAAAATAAATATAAAATAAATATAACCAATCAATAATTAAAAAATTAAAATTCATAAAAAATTACTAAAACCTATAAACATTCAAAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII9IIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:51765:1042_1:N:0:CATAAGCC+TATCGGCT/1 83 Chromosome_9A_GA_converted 50548252 1 141M = 50548237 -156 TAATAAACAATATAACTTATTAACATATTAATTTTCATACATCAAAAAAATAAACATAACATATATTTCATAACCTCTTCTAAACCATATTACATTTAACCCAATTTAACATACTTTTTATTTTATTATACATAAAAAATA 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9II9IIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:30T110 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:51765:1042_2:N:0:CATAAGCC+TATCGGCT/2 163 Chromosome_9A_GA_converted 50548237 1 141M = 50548252 156 AATTTTATATAAATATAATAAACAATATAACTTATTAACATATTAATTTTCATACATCAAAAAAATAAACATAACATATATTTCATAACCTCTTCTAAACCATATTACATTTAACCCAATTTAACATACTTTTTATTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:45T95 YS:i:-6 YT:Z:CP >>> Writing bisulfite mapping results to Qui2_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.5 and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.3 and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.1 and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.4 and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.2 and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.7 and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.7 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1145:41709:28912_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973139 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1170:26524:24947_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973133 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1217:21929:14522_1:N:0:CATAAGCC+TATCGGCT Chromosome_8A 2 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1203:14486:21500_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1203:14494:21514_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1232:16727:2177_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973117 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1265:16776:1757_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973128 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1254:33093:13429_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1248:31596:8651_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973139 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1298:44225:12616_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973119 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1276:15028:22691_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973131 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1417:34396:23952_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973133 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1277:21330:27049_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1374:19389:21276_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1445:31807:9211_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1394:19364:4559_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973119 Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1433:7367:2667_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973117 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1429:40366:7950_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1471:15085:15391_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973126 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2136:50665:7039_1:N:0:CATAAGCC+TGTCGGCT Chromosome_4A 1 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1464:38643:3284_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973116 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2110:32049:13443_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973130 Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2136:50673:7025_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 1 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2178:7666:24765_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973128 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2178:19016:17661_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2195:50228:8553_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973133 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2272:15036:14017_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973127 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2268:24178:24358_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973133 Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2330:47307:29613_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973124 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2255:34832:5680_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2265:14704:16834_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973134 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2436:37365:19566_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973140 Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2346:21419:21430_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973132 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2460:26548:20309_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973117 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:492:23M2VFLT4:2:1114:26119:29683_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973123 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2461:38716:5148_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973123 Chromosomal sequence could not be extracted for LH00129:492:23M2VFLT4:2:1251:22997:1462_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973131 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2494:35196:28674_1:N:0:CATAAGCC+TATCGGCT Chromosome_8A 2 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:492:23M2VFLT4:2:2309:45843:14017_1:N:0:CATAAGCC+TATCGGCT Chromosome_6A 76092826 Processed 4000000 sequence pairs so far 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1886387 (41.20%) aligned concordantly 0 times 1010424 (22.07%) aligned concordantly exactly 1 time 1681655 (36.73%) aligned concordantly >1 times 58.80% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1884882 (41.17%) aligned concordantly 0 times 1008224 (22.02%) aligned concordantly exactly 1 time 1685360 (36.81%) aligned concordantly >1 times 58.83% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 3060619 Mapping efficiency: 66.8% Sequence pairs with no alignments under any condition: 785212 Sequence pairs did not map uniquely: 732635 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1531151 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1529465 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133073998 Total methylated C's in CpG context: 3575338 Total methylated C's in CHG context: 168308 Total methylated C's in CHH context: 753914 Total methylated C's in Unknown context: 18320 Total unmethylated C's in CpG context: 12621480 Total unmethylated C's in CHG context: 22471672 Total unmethylated C's in CHH context: 93483286 Total unmethylated C's in Unknown context: 148701 C methylated in CpG context: 22.1% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.0% 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1884815 (41.17%) aligned concordantly 0 times 1008005 (22.02%) aligned concordantly exactly 1 time 1685646 (36.82%) aligned concordantly >1 times 58.83% overall alignment rate Processed 4000000 sequence pairs so far 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1888454 (41.25%) aligned concordantly 0 times 1008857 (22.03%) aligned concordantly exactly 1 time 1681155 (36.72%) aligned concordantly >1 times 58.75% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 3059845 Mapping efficiency: 66.8% Sequence pairs with no alignments under any condition: 786092 Sequence pairs did not map uniquely: 732529 Sequence pairs which were discarded because genomic sequence could not be extracted: 7 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1531025 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1528813 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133049336 Total methylated C's in CpG context: 3575852 Total methylated C's in CHG context: 168237 Total methylated C's in CHH context: 756073 Total methylated C's in Unknown context: 17991 Total unmethylated C's in CpG context: 12617393 Total unmethylated C's in CHG context: 22463547 Total unmethylated C's in CHH context: 93468234 Total unmethylated C's in Unknown context: 148515 C methylated in CpG context: 22.1% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 10.8% 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1883946 (41.15%) aligned concordantly 0 times 1008786 (22.03%) aligned concordantly exactly 1 time 1685734 (36.82%) aligned concordantly >1 times 58.85% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1887279 (41.22%) aligned concordantly 0 times 1010237 (22.06%) aligned concordantly exactly 1 time 1680950 (36.71%) aligned concordantly >1 times 58.78% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 3060500 Mapping efficiency: 66.8% Sequence pairs with no alignments under any condition: 784671 Sequence pairs did not map uniquely: 733295 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1531697 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1528799 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133117655 Total methylated C's in CpG context: 3575430 Total methylated C's in CHG context: 167543 Total methylated C's in CHH context: 754312 Total methylated C's in Unknown context: 18080 Total unmethylated C's in CpG context: 12613435 Total unmethylated C's in CHG context: 22478837 Total unmethylated C's in CHH context: 93528098 Total unmethylated C's in Unknown context: 148014 C methylated in CpG context: 22.1% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 10.9% Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1884305 (41.16%) aligned concordantly 0 times 1009447 (22.05%) aligned concordantly exactly 1 time 1684714 (36.80%) aligned concordantly >1 times 58.84% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1887565 (41.23%) aligned concordantly 0 times 1009534 (22.05%) aligned concordantly exactly 1 time 1681367 (36.72%) aligned concordantly >1 times 58.77% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 3061549 Mapping efficiency: 66.9% Sequence pairs with no alignments under any condition: 784334 Sequence pairs did not map uniquely: 732583 Sequence pairs which were discarded because genomic sequence could not be extracted: 8 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1532137 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1529404 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133099288 Total methylated C's in CpG context: 3566524 Total methylated C's in CHG context: 168021 Total methylated C's in CHH context: 756227 Total methylated C's in Unknown context: 18427 Total unmethylated C's in CpG context: 12633893 Total unmethylated C's in CHG context: 22480686 Total unmethylated C's in CHH context: 93493937 Total unmethylated C's in Unknown context: 148380 C methylated in CpG context: 22.0% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.0% Chromosomal sequence could not be extracted for LH00129:492:23M2VFLT4:2:2366:29469:26993_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973117 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1884839 (41.17%) aligned concordantly 0 times 1008911 (22.04%) aligned concordantly exactly 1 time 1684716 (36.80%) aligned concordantly >1 times 58.83% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1887312 (41.22%) aligned concordantly 0 times 1010486 (22.07%) aligned concordantly exactly 1 time 1680668 (36.71%) aligned concordantly >1 times 58.78% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 3060773 Mapping efficiency: 66.9% Sequence pairs with no alignments under any condition: 785792 Sequence pairs did not map uniquely: 731901 Sequence pairs which were discarded because genomic sequence could not be extracted: 7 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1531203 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1529563 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133096831 Total methylated C's in CpG context: 3574673 Total methylated C's in CHG context: 168365 Total methylated C's in CHH context: 754879 Total methylated C's in Unknown context: 18098 Total unmethylated C's in CpG context: 12625024 Total unmethylated C's in CHG context: 22468121 Total unmethylated C's in CHH context: 93505769 Total unmethylated C's in Unknown context: 148051 C methylated in CpG context: 22.1% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 10.9% Chromosomal sequence could not be extracted for LH00129:492:23M2VFLT4:2:2259:50365:18627_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973116 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1888175 (41.24%) aligned concordantly 0 times 1008703 (22.03%) aligned concordantly exactly 1 time 1681588 (36.73%) aligned concordantly >1 times 58.76% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1884171 (41.15%) aligned concordantly 0 times 1008781 (22.03%) aligned concordantly exactly 1 time 1685514 (36.81%) aligned concordantly >1 times 58.85% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 3060399 Mapping efficiency: 66.8% Sequence pairs with no alignments under any condition: 785508 Sequence pairs did not map uniquely: 732559 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1532578 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1527817 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133082427 Total methylated C's in CpG context: 3571618 Total methylated C's in CHG context: 168114 Total methylated C's in CHH context: 754966 Total methylated C's in Unknown context: 17881 Total unmethylated C's in CpG context: 12622763 Total unmethylated C's in CHG context: 22464103 Total unmethylated C's in CHH context: 93500863 Total unmethylated C's in Unknown context: 147962 C methylated in CpG context: 22.1% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 10.8% Chromosomal sequence could not be extracted for LH00129:492:23M2VFLT4:2:2328:44314:3578_1:N:0:CATAAGCC+TATCGGCT Chromosome_4A 93973120 4578465 reads; of these: 4578465 (100.00%) were paired; of these: 1887911 (41.23%) aligned concordantly 0 times 1010310 (22.07%) aligned concordantly exactly 1 time 1680244 (36.70%) aligned concordantly >1 times 58.77% overall alignment rate 4578465 reads; of these: 4578465 (100.00%) were paired; of these: 1884366 (41.16%) aligned concordantly 0 times 1010075 (22.06%) aligned concordantly exactly 1 time 1684024 (36.78%) aligned concordantly >1 times 58.84% overall alignment rate Processed 4578465 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578465 Number of paired-end alignments with a unique best hit: 3061414 Mapping efficiency: 66.9% Sequence pairs with no alignments under any condition: 785406 Sequence pairs did not map uniquely: 731645 Sequence pairs which were discarded because genomic sequence could not be extracted: 6 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1532464 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1528944 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133138586 Total methylated C's in CpG context: 3577879 Total methylated C's in CHG context: 167917 Total methylated C's in CHH context: 755572 Total methylated C's in Unknown context: 18344 Total unmethylated C's in CpG context: 12618592 Total unmethylated C's in CHG context: 22490098 Total unmethylated C's in CHH context: 93528528 Total unmethylated C's in Unknown context: 148121 C methylated in CpG context: 22.1% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.0% Now waiting for all child processes to complete 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1885660 (41.19%) aligned concordantly 0 times 1009072 (22.04%) aligned concordantly exactly 1 time 1683734 (36.78%) aligned concordantly >1 times 58.81% overall alignment rate 4578466 reads; of these: 4578466 (100.00%) were paired; of these: 1882777 (41.12%) aligned concordantly 0 times 1007621 (22.01%) aligned concordantly exactly 1 time 1688068 (36.87%) aligned concordantly >1 times 58.88% overall alignment rate Processed 4578466 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4578466 Number of paired-end alignments with a unique best hit: 3060586 Mapping efficiency: 66.8% Sequence pairs with no alignments under any condition: 784735 Sequence pairs did not map uniquely: 733145 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1531513 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1529070 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133054170 Total methylated C's in CpG context: 3567659 Total methylated C's in CHG context: 168034 Total methylated C's in CHH context: 755044 Total methylated C's in Unknown context: 18294 Total unmethylated C's in CpG context: 12622554 Total unmethylated C's in CHG context: 22464382 Total unmethylated C's in CHH context: 93476497 Total unmethylated C's in Unknown context: 148743 C methylated in CpG context: 22.0% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.0% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 18313860. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.1 /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.1 /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.2 /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.2 /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.3 /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.3 /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.4 /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.4 /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.5 /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.5 /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.6 /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.6 /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.7 /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.7 /tmp/13-wgbs-Qui2-2465597/Qui2_R1.fq.gz.temp.8 /tmp/13-wgbs-Qui2-2465597/Qui2_R2.fq.gz.temp.8 Now merging BAM files Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.2_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.3_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.4_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.5_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.6_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.7_bismark_bt2_pe.bam Qui2_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Qui2_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Qui2_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1_bismark_bt2_PE_report.txt Now merging temporary reports Qui2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Qui2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Qui2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 36627727 Number of paired-end alignments with a unique best hit: 24485685 Mapping efficiency: 66.9% Sequence pairs with no alignments under any condition: 6281750 Sequence pairs did not map uniquely: 5860292 Sequence pairs which were discarded because genomic sequence could not be extracted: 42 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 12253768 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 12231875 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1064712291 Total methylated C's in CpG context: 28584973 Total methylated C's in CHG context: 1344539 Total methylated C's in CHH context: 6040987 Total methylated C's in Unknown context: 145435 Total unmethylated C's in CpG context: 100975134 Total unmethylated C's in CHG context: 179781446 Total unmethylated C's in CHH context: 747985212 Total unmethylated C's in Unknown context: 1186487 C methylated in CpG context: 22.1% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 10.9% Deleting temporary report files... Qui2_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui2_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 54m 23s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs-hapa/bismark/Qui2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs-hapa/bismark/Qui2_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs-hapa/bismark/Qui2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Qui2_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs-hapa/bismark/Qui2_pe.bam: 24485643 Total number duplicated alignments removed: 1566760 (6.40%) Duplicated alignments were found at: 1463793 different position(s) Total count of deduplicated leftover sequences: 22918883 (93.60% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_1A LN:100680956 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_3A LN:93095432 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_5A LN:90413844 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_7A LN:74165749 skipping header line: @SQ SN:Chromosome_8A LN:54853936 skipping header line: @SQ SN:Chromosome_9A LN:66796497 skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui2-2465597 --output_dir output/13-wgbs-hapa/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Qui2_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui2_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui2_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_1A LN:100680956 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_3A LN:93095432 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_5A LN:90413844 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_7A LN:74165749 skipping SAM header line: @SQ SN:Chromosome_8A LN:54853936 skipping SAM header line: @SQ SN:Chromosome_9A LN:66796497 skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Qui2_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Qui2_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui2-2465597 --output_dir output/13-wgbs-hapa/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui2_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Qui2_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.8 Processed 22918883 lines in total Total number of methylation call strings processed: 45837766 Final Cytosine Methylation Report ================================= Total number of C's analysed: 763050358 Total methylated C's in CpG context: 20425426 Total methylated C's in CHG context: 842856 Total methylated C's in CHH context: 3812989 Total C to T conversions in CpG context: 72530611 Total C to T conversions in CHG context: 128869538 Total C to T conversions in CHH context: 536568938 C methylated in CpG context: 22.0% C methylated in non-CpG context: 0.7% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui2_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui2_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui2_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui2_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Qui2_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui2_pe.deduplicated.txt.gz Writing bedGraph to file: Qui2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Qui2_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Now writing methylation information for file >>CpG_context_Qui2_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Qui2_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp Sorting input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui2_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs-hapa/methylation/Qui2_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Qui2.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Qui2.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1385655 different covered positions) Writing cytosine report for chromosome Chromosome_1A (stored 3236044 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3040077 different covered positions) Writing cytosine report for chromosome Chromosome_3A (stored 2888479 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 2930817 different covered positions) Writing cytosine report for chromosome Chromosome_5A (stored 2739732 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2571581 different covered positions) Writing cytosine report for chromosome Chromosome_7A (stored 2358663 different covered positions) Writing cytosine report for chromosome Chromosome_8A (stored 1824592 different covered positions) Writing cytosine report for last chromosome Chromosome_9A (stored 2181917 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Qui2.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Qui2.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs-hapa/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome-hapa/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome-hapa/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Processed 41500000 lines Processed 42000000 lines Processed 42500000 lines Processed 43000000 lines Processed 43500000 lines Processed 44000000 lines Processed 44500000 lines Processed 45000000 lines Processed 45500000 lines Printing nucleotide stats to >> output/13-wgbs-hapa/dedup/Qui2_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1945576021 35.02 253281200 32.09 7.681 C 872429262 15.70 141394985 17.92 6.170 G 976641451 17.58 141251970 17.90 6.914 T 1761395456 31.70 253281001 32.09 6.954 AA 726178632 13.16 86162409 10.92 8.428 AC 301402462 5.46 45489259 5.76 6.626 AG 308473405 5.59 41639512 5.28 7.408 AT 596162215 10.81 79989139 10.14 7.453 CA 363981237 6.60 54159510 6.86 6.721 CC 149066229 2.70 28259664 3.58 5.275 CG 105597782 1.91 17208692 2.18 6.136 CT 247070316 4.48 41766898 5.29 5.915 GA 340185726 6.17 45250237 5.73 7.518 GC 141015940 2.56 22357630 2.83 6.307 GG 177207304 3.21 28206624 3.57 6.282 GT 311088852 5.64 45437311 5.76 6.847 TA 501055646 9.08 67706051 8.58 7.400 TC 274620747 4.98 45288269 5.74 6.064 TG 378365505 6.86 54196921 6.87 6.981 TT 594772882 10.78 86086811 10.91 6.909 [Sat Oct 10 09:55:32 PDT 2026] Qui2 done