[Sat Oct 10 07:51:54 PDT 2026] Qui1 (Qui/Quilhua) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 39325033 total bases: 5938079983 Q20 bases: 5870610810(98.8638%) Q30 bases: 5696704896(95.9351%) Q40 bases: 5696704896(95.9351%) Read2 before filtering: total reads: 39325033 total bases: 5938079983 Q20 bases: 5863510309(98.7442%) Q30 bases: 5686813816(95.7686%) Q40 bases: 5686813816(95.7686%) Read1 after filtering: total reads: 38720614 total bases: 5338797963 Q20 bases: 5294000740(99.1609%) Q30 bases: 5160766716(96.6653%) Q40 bases: 5160766716(96.6653%) Read2 after filtering: total reads: 38720614 total bases: 5340552410 Q20 bases: 5294813491(99.1436%) Q30 bases: 5157895060(96.5798%) Q40 bases: 5157895060(96.5798%) Filtering result: reads passed filter: 77441228 reads failed due to low quality: 615766 reads failed due to too many N: 1620 reads failed due to too short: 591452 reads with adapter trimmed: 11202113 bases trimmed due to adapters: 209482108 Duplication rate: 5.90184% Insert size peak (evaluated by paired-end reads): 182 JSON report: output/13-wgbs-hapa/fastp/Qui1.fastp.json HTML report: output/13-wgbs-hapa/fastp/Qui1.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui1 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/Qui1 (paired)_R2.fastq.gz -o output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz -O output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs-hapa/fastp/Qui1.fastp.json --html output/13-wgbs-hapa/fastp/Qui1.fastp.html fastp v1.0.1, time used: 79 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome-hapa/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/ Using temp directory: /tmp/13-wgbs-Qui1-2994480 Temporary files will be written into the directory: /tmp/13-wgbs-Qui1-2994480/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4840076) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz for PID: 2994840 and offset 8 (sequences written out: 4840076) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.2 to /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4840076) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.7 to /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.3 to /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.3_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz for PID: 2994840 and offset 8 (sequences written out: 4840076) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.8 to /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.1 to /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.4 to /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.5 to /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4840077) Using the subset file >/tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Qui1_R1.fq.gz.temp.6 to /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.6_C_to_T.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.2 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.2 to /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.7 (4840076 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.7 to /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.3 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.3 to /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.3_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.8 (4840076 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.8 to /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.1 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.1 to /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.5 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.5 to /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.6 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.6 to /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Qui1_R1.fq.gz.temp.4 (4840077 sequences in total) Writing a G -> A converted version of the input file Qui1_R2.fq.gz.temp.4 to /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.4_G_to_A.fastq Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.2 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.2_C_to_T.fastq and Qui1_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.7 (4840076 sequences in total) Input files are Qui1_R1.fq.gz.temp.7_C_to_T.fastq and Qui1_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:28013:1042_1:N:0:CTGTCACT+ANTATTAA/1 99 Chromosome_4A_CT_converted 54205037 42 141M = 54205086 190 GTTGAGTGGATAATTGTTTTGTGGGTTTTTTGGTAAGTTATGGTTTTTAATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:28013:1042_2:N:0:CTGTCACT+ANTATTAA/2 147 Chromosome_4A_CT_converted 54205086 42 141M = 54205037 -190 ATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTTAGTATATTAATTATATGTAGTTTGTGTTATTTAGTATTTTGTTGATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:138A1G0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.3 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.3_C_to_T.fastq and Qui1_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:36507:1042_1:N:0:CTGTCACT+AATATTAA/1 99 Chromosome_6A_CT_converted 11507376 11 141M = 11507417 182 ATATATGTATTTTTTTTGATAAATGTTTTTGAAATAATTGTAAATATTAGAGATAAAGTATGTAAAAATAAGGGTATTTGTATAGTGTGAAAAGAAATGAAATTTATTGAAATAAAATTTAAATATATTGAAATAAAATGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII AS:i:-12 XS:i:-41 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:5A86T48 YS:i:-24 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:36507:1042_2:N:0:CTGTCACT+AATATTAA/2 147 Chromosome_6A_CT_converted 11507417 11 141M = 11507376 -182 AAATATTAGAGATAAAGTATGTAAAAATAAGGGTATTTGTATAGTGTGAAAAGAAATGAAATTTATTGAAATAAAATTTAAATATATTGAAATAAAATGAAATTTATTGATATGAAATGAATTTAATTGGAATAAAATTTT IIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII AS:i:-24 XS:i:-36 XN:i:0 XM:i:4 XO:i:0 XG:i:0 NM:i:4 MD:Z:51T86A0G0A0 YS:i:-12 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.8 (4840076 sequences in total) Input files are Qui1_R1.fq.gz.temp.8_C_to_T.fastq and Qui1_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:28029:1042_1:N:0:CTGTCACT+ANTATTAA/1 99 Chromosome_4A_CT_converted 54205037 42 141M = 54205086 190 GTTGAGTGGATAATTGTTTTGTGGGTTTTTTGGTAAGTTATGGTTTTTAATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:28029:1042_2:N:0:CTGTCACT+ANTATTAA/2 147 Chromosome_4A_CT_converted 54205086 42 141M = 54205037 -190 ATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTTAGTATATTAATTATATGTAGTTTGTGTTATTTAGTATTTTGTTGATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:138A1G0 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:44468:1042_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 TTTGGTTGGGAATGTTATATTTTTTTATTAAAATTATGTGGGATGTAAAAGTATATTTAATATGTGAGGGGGTTATTTAAAGTTATTAAAAGTAGATTAGTTATTGTTTTTGGGATTAAAAAGTATTGTTATTTGTTATGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:44468:1042_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 AAAATAATTTATTTACTACAAAATTACTCTTACTTATAATAAACATATATACAATTAACTTAAAACTTACAATAATAAAAATTTATCAATTACTTAAAAAAAATCAACTCTACAATATAATAACAAAAATTTAATAACATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.1 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.1_C_to_T.fastq and Qui1_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:36507:1042_1:N:0:CTGTCACT+AATATTAA/1 77 * 0 0 * * 0 0 ATATATGTATTTTTTTTGATAAATGTTTTTGAAATAATTGTAAATATTAGAGATAAAGTATGTAAAAATAAGGGTATTTGTATAGTGTGAAAAGAAATGAAATTTATTGAAATAAAATTTAAATATATTGAAATAAAATGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:36507:1042_2:N:0:CTGTCACT+AATATTAA/2 141 * 0 0 * * 0 0 AAAATTTTATTCCAATTAAATTCATTTCATATCAATAAATTTCATTTTATTTCAATATATTTAAATTTTATTTCAATAAATTTCATTTCTTTTCACACTATACAAATACCCTTATTTTTACATACTTTATCTCTAATATTT IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:28029:1042_1:N:0:CTGTCACT+ANTATTAA/1 77 * 0 0 * * 0 0 GTTGAGTGGATAATTGTTTTGTGGGTTTTTTGGTAAGTTATGGTTTTTAATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:28029:1042_2:N:0:CTGTCACT+ANTATTAA/2 141 * 0 0 * * 0 0 AAAATCAACAAAATACTAAATAACACAAACTACATATAATTAATATACTAACAATATAATCCACCACAAACAAAAATTAAATATTAAAATCTACAAACATACAATCCTAACTATTTCATCCATACTTCACCCATACAATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:44468:1042_1:N:0:CTGTCACT+AATATTAA/1 83 Chromosome_5A_GA_converted 34785702 42 69M1I71M = 34785437 -405 ACATAACAAATAACAATACTTTTTAATCCCAAAAACAATAACTAATCTACTTTTAATAACTTTAAATAACCCCCTCACATATTAAATATACTTTTACATCCCACATAATTTTAATAAAAAAATATAACATTCCCAACCAAA IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-8 XN:i:0 XM:i:0 XO:i:1 XG:i:1 NM:i:1 MD:Z:140 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:44468:1042_2:N:0:CTGTCACT+AATATTAA/2 163 Chromosome_5A_GA_converted 34785437 42 141M = 34785702 405 AAAATAATTTATTTACTACAAAATTACTCTTACTTATAATAAACATATATACAATTAACTTAAAACTTACAATAATAAAAATTTATCAATTACTTAAAAAAAATCAACTCTACAATATAATAACAAAAATTTAATAACATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:123T17 YS:i:-8 YT:Z:CP >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:28013:1042_1:N:0:CTGTCACT+ANTATTAA/1 77 * 0 0 * * 0 0 GTTGAGTGGATAATTGTTTTGTGGGTTTTTTGGTAAGTTATGGTTTTTAATATTGTATGGGTGAAGTATGGATGAAATAGTTAGGATTGTATGTTTGTAGATTTTAATATTTAATTTTTGTTTGTGGTGGATTATATTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:28013:1042_2:N:0:CTGTCACT+ANTATTAA/2 141 * 0 0 * * 0 0 AAAATCAACAAAATACTAAATAACACAAACTACATATAATTAATATACTAACAATATAATCCACCACAAACAAAAATTAAATATTAAAATCTACAAACATACAATCCTAACTATTTCATCCATACTTCACCCATACAATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.6 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.6_C_to_T.fastq and Qui1_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.5 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.5_C_to_T.fastq and Qui1_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Reading in the sequence files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.7 and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.3 and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.3 Reading in the sequence files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.2 and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.8 and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.8 Found first alignment: LH00129:489:23JFWNLT4:8:1101:27042:1042_1:N:0:CTGTCACT+ANTATTAA/1 99 Chromosome_4A_CT_converted 21285240 42 141M = 21285515 414 ATGTTTATATTTTTTTTGGAATTTATTATTATAAAATTTGTATATGAAGGGGTTAGTAATAAAGTTAATGATATAAATTTGATTTAAAAAGGTTATTGTTATTAGTTTATTTTTATTAAGAATAAATTAAAAGTTTGTGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-11 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:27042:1042_2:N:0:CTGTCACT+ANTATTAA/2 147 Chromosome_4A_CT_converted 21285515 42 1M2I138M = 21285240 -414 GTTTTTTTTTTTTTTTTTTTTTAATGTTGTATTAAGGGTATTATAGGTTGATGGTGAATAATTTGATATTTTTGGTTTATTGATATTATTGATGTAGAAAGTGGAGAAAGATTTAGGATTTTTAGATTGGTTGAAGATTTT *9*9*9*II9II9IIII9IIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-11 XN:i:0 XM:i:0 XO:i:1 XG:i:2 NM:i:2 MD:Z:139 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Qui1_R2.fq.gz.temp.4 (4840077 sequences in total) Input files are Qui1_R1.fq.gz.temp.4_C_to_T.fastq and Qui1_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:30844:1042_1:N:0:CTGTCACT+ANTATTAA/1 99 Chromosome_7A_CT_converted 29788832 6 141M = 29788865 174 ATTAATTAATTTTATAAGTTATAATTAATGATAATATATTTTTTAAAAATAAGAATGAAAATGTATATTGTAAATATTAATATGTGGTATAGTAAAGATTTGATGAAGATGTATTTTTTAAAATGTATGTGATTTGAAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIII AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:30844:1042_2:N:0:CTGTCACT+ANTATTAA/2 147 Chromosome_7A_CT_converted 29788865 6 141M = 29788832 -174 ATATATTTTTTAAAAATAAGAATGAAAATGTATATTGTAAATATTAATATGTGGTATAGTAAAGATTTGATGAAGATGTATTTTTTAAAATGTATGTGATTTGAAATATATTAAATTGAAGGGGGTAAGAAATATGTTATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:31038:1042_1:N:0:CTGTCACT+ANTATTAA/1 77 * 0 0 * * 0 0 TATTGTATATGAGAGTTTTTTAAAGGGAAATAATTTAAATGTATTTTGTATATTAAATTAAAGTTTTATTGTTTAGATGTATTGAATTTTATATTTTTTATAATTTTTTTTAGATATTATATTTTTTGTAAAATATTGTTT III99IIII9IIIIIIIIIIII9II*IIII9IIIIIIIIIIIIII9III9III9I9IIIIIIIIIIIIIIIIII9I9IIIIIIIIIIIIIIIII*IIII9II9II9IIIII9IIIIIIIIII9I9III*9IIII999IIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:31038:1042_2:N:0:CTGTCACT+ANTATTAA/2 141 * 0 0 * * 0 0 ACTCACAAATAAATAAATTCTATATTCAACAATAAAACATTAAACTTTCTATTCATTACAATTTCTTTAACCTTTCTATAAACTATCTCTTTATTAACATTCTAAACAATATTTTACAAAAAATATAATATCTAAAAAAAA IIIIIIIIIIIIIIII9I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:29404:1042_1:N:0:CTGTCACT+ANTATTAA/1 77 * 0 0 * * 0 0 TAAATTTTGATTTAGATGTTGATTAGAATATAGAGTTTGAAGTATATTAAAGTTTTGGGATTTGGTTGTATTTAATTGTTTATAGGTTTTGTTTATAATAGTTTTTTATGGAAGTTATATTTAAGTTTGTTATATAATATA IIIIIIIIIIIIIIII9II9IIIIII9IIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:29404:1042_2:N:0:CTGTCACT+ANTATTAA/2 141 * 0 0 * * 0 0 AAACCTACCATTACATAAACAAAACAACAAACCAAAAATCACATAACTTACATAACCAATAAAAATAAAACAAACTACTACCTAATCAATAATTAATAAACTATTAATTTATCAATAAACCACAAATATAAAAAACAATTT IIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIII9IIIII9IIIIII99IIIII9IIIIIII9IIIIIIIIII9IIIIII9IIIIIIIIII9IIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:27042:1042_1:N:0:CTGTCACT+ANTATTAA/1 77 * 0 0 * * 0 0 ATGTTTATATTTTTTTTGGAATTTATTATTATAAAATTTGTATATGAAGGGGTTAGTAATAAAGTTAATGATATAAATTTGATTTAAAAAGGTTATTGTTATTAGTTTATTTTTATTAAGAATAAATTAAAAGTTTGTGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:27042:1042_2:N:0:CTGTCACT+ANTATTAA/2 141 * 0 0 * * 0 0 AAAATCTTCAACCAATCTAAAAATCCTAAATCTTTCTCCACTTTCTACATCAATAATATCAATAAACCAAAAATATCAAATTATTCACCATCAACCTATAATACCCTTAATACAACATTAAAAAAAAAAAAAAAAAAAAAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIII9IIII9II9II*9*9*9* YT:Z:UP >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:31038:1042_1:N:0:CTGTCACT+ANTATTAA/1 83 Chromosome_2A_GA_converted 42905550 42 141M = 42905447 -244 AAACAATATTTTACAAAAAATATAATATCTAAAAAAAATTATAAAAAATATAAAATTCAATACATCTAAACAATAAAACTTTAATTTAATATACAAAATACATTTAAATTATTTCCCTTTAAAAAACTCTCATATACAATA IIII999IIII9*III9I9IIIIIIIIII9IIIII9II9II9IIII*IIIIIIIIIIIIIIIII9I9IIIIIIIIIIIIIIIIII9I9III9III9IIIIIIIIIIIIII9IIII*II9IIIIIIIIIIII9IIII99III AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:31038:1042_2:N:0:CTGTCACT+ANTATTAA/2 163 Chromosome_2A_GA_converted 42905447 42 141M = 42905550 244 ACTCACAAATAAATAAATTCTATATTCAACAATAAAACATTAAACTTTCTATTCATTACAATTTCTTTAACCTTTCTATAAACTATCTCTTTATTAACATTCTAAACAATATTTTACAAAAAATATAATATCTAAAAAAAA IIIIIIIIIIIIIIII9I9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:44T96 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:30844:1042_1:N:0:CTGTCACT+ANTATTAA/1 83 Chromosome_7A_GA_converted 68737996 1 141M = 68737963 -174 TATTTCAAATCACATACATTTTAAAAAATACATCTTCATCAAATCTTTACTATACCACATATTAATATTTACAATATACATTTTCATTCTTATTTTTAAAAAATATATTATCATTAATTATAACTTATAAAATTAATTAAT IIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:30844:1042_2:N:0:CTGTCACT+ANTATTAA/2 163 Chromosome_7A_GA_converted 68737963 1 141M = 68737996 174 AATAACATATTTCTTACCCCCTTCAATTTAATATATTTCAAATCACATACATTTTAAAAAATACATCTTCATCAAATCTTTACTATACCACATATTAATATTTACAATATACATTTTCATTCTTATTTTTAAAAAATATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.1 and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.1 Found first alignment: LH00129:489:23JFWNLT4:8:1101:29404:1042_1:N:0:CTGTCACT+ANTATTAA/1 83 Chromosome_5A_GA_converted 70826254 42 141M = 70826065 -330 TATATTATATAACAAACTTAAATATAACTTCCATAAAAAACTATTATAAACAAAACCTATAAACAATTAAATACAACCAAATCCCAAAACTTTAATATACTTCAAACTCTATATTCTAATCAACATCTAAATCAAAATTTA IIIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIII9IIIIII9II9IIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29404:1042_2:N:0:CTGTCACT+ANTATTAA/2 163 Chromosome_5A_GA_converted 70826065 42 141M = 70826254 330 AAACCTACCATTACATAAACAAAACAACAAACCAAAAATCACATAACTTACATAACCAATAAAAATAAAACAAACTACTACCTAATCAATAATTAATAAACTATTAATTTATCAATAAACCACAAATATAAAAAACAATTT IIIIIIIIIIIIIIIII*IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII9IIII9IIIII9IIIIII99IIIII9IIIIIII9IIIIIIIIII9IIIIII9IIIIIIIIII9IIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:2C138 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Qui1_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.6 and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.5 and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.4 and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.4 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1107:32163:19244_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973136 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1117:20942:19174_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1157:50430:27567_1:N:0:CTGTCACT+AATATTAA Chromosome_5A 2 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1174:44815:7754_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973127 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1240:24623:2653_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973119 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1260:35860:4713_1:N:0:CTGTCACT+AATATTAA Chromosome_1A 100680820 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1260:35868:4699_1:N:0:CTGTCACT+AATATTAA Chromosome_1A 100680820 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1270:29631:15307_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973128 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1285:17115:18740_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1351:29914:16329_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973126 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1394:39856:27273_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973124 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1404:52177:3522_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973154 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1479:33036:10865_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973151 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1462:24550:9898_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1467:7343:10612_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973126 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2155:5708:8987_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973117 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2131:32600:12266_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973121 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2165:25610:9688_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973121 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2159:1849:9141_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973134 Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2181:3969:7852_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2174:18393:21598_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973116 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2183:17827:15713_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973133 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2222:12213:26362_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973131 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2220:5417:17619_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973117 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2248:2561:10458_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2284:32009:28786_1:N:0:CTGTCACT+AATATTAA Chromosome_8A 1 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2292:2294:28856_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2325:28822:1182_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973121 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2310:8030:11495_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973159 Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2345:48836:26628_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973119 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2359:33837:26488_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2376:8774:18053_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973115 Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2407:28611:4685_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2391:35067:13317_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973137 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2451:51563:23111_1:N:0:CTGTCACT+AATATTAA Chromosome_3A 1 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2460:50608:8314_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973139 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2423:32001:4671_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973130 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2443:17698:11958_1:N:0:CTGTCACT+AATATTAA Chromosome_8A 1 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1974506 (40.79%) aligned concordantly 0 times 1079810 (22.31%) aligned concordantly exactly 1 time 1785761 (36.90%) aligned concordantly >1 times 59.21% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1974932 (40.80%) aligned concordantly 0 times 1079156 (22.30%) aligned concordantly exactly 1 time 1785989 (36.90%) aligned concordantly >1 times 59.20% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 3252312 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 800783 Sequence pairs did not map uniquely: 786982 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1626834 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1625474 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 146317109 Total methylated C's in CpG context: 3503268 Total methylated C's in CHG context: 190884 Total methylated C's in CHH context: 840607 Total methylated C's in Unknown context: 20952 Total unmethylated C's in CpG context: 14687480 Total unmethylated C's in CHG context: 24859341 Total unmethylated C's in CHH context: 102235529 Total unmethylated C's in Unknown context: 161464 C methylated in CpG context: 19.3% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.5% Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2461:4139:28184_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973127 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1974629 (40.80%) aligned concordantly 0 times 1079443 (22.30%) aligned concordantly exactly 1 time 1786005 (36.90%) aligned concordantly >1 times 59.20% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1973686 (40.78%) aligned concordantly 0 times 1079440 (22.30%) aligned concordantly exactly 1 time 1786951 (36.92%) aligned concordantly >1 times 59.22% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 3251185 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 800464 Sequence pairs did not map uniquely: 788428 Sequence pairs which were discarded because genomic sequence could not be extracted: 6 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1625264 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1625915 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 146232949 Total methylated C's in CpG context: 3499211 Total methylated C's in CHG context: 190517 Total methylated C's in CHH context: 840771 Total methylated C's in Unknown context: 20750 Total unmethylated C's in CpG context: 14674600 Total unmethylated C's in CHG context: 24835293 Total unmethylated C's in CHH context: 102192557 Total unmethylated C's in Unknown context: 161368 C methylated in CpG context: 19.3% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.4% 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1975860 (40.82%) aligned concordantly 0 times 1079285 (22.30%) aligned concordantly exactly 1 time 1784932 (36.88%) aligned concordantly >1 times 59.18% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1975893 (40.82%) aligned concordantly 0 times 1079284 (22.30%) aligned concordantly exactly 1 time 1784900 (36.88%) aligned concordantly >1 times 59.18% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 3253023 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 801016 Sequence pairs did not map uniquely: 786038 Sequence pairs which were discarded because genomic sequence could not be extracted: 7 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1626680 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1626336 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 146333949 Total methylated C's in CpG context: 3508497 Total methylated C's in CHG context: 191760 Total methylated C's in CHH context: 840692 Total methylated C's in Unknown context: 20940 Total unmethylated C's in CpG context: 14692053 Total unmethylated C's in CHG context: 24862569 Total unmethylated C's in CHH context: 102238378 Total unmethylated C's in Unknown context: 160107 C methylated in CpG context: 19.3% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.6% Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2470:21549:27147_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973142 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1976081 (40.83%) aligned concordantly 0 times 1079917 (22.31%) aligned concordantly exactly 1 time 1784079 (36.86%) aligned concordantly >1 times 59.17% overall alignment rate 4840076 reads; of these: 4840076 (100.00%) were paired; of these: 1975028 (40.81%) aligned concordantly 0 times 1079761 (22.31%) aligned concordantly exactly 1 time 1785287 (36.89%) aligned concordantly >1 times 59.19% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1973866 (40.78%) aligned concordantly 0 times 1081108 (22.34%) aligned concordantly exactly 1 time 1785103 (36.88%) aligned concordantly >1 times 59.22% overall alignment rate 4840076 reads; of these: 4840076 (100.00%) were paired; of these: 1974566 (40.80%) aligned concordantly 0 times 1080152 (22.32%) aligned concordantly exactly 1 time 1785358 (36.89%) aligned concordantly >1 times 59.20% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 3249514 Mapping efficiency: 67.1% Sequence pairs with no alignments under any condition: 801808 Sequence pairs did not map uniquely: 788755 Sequence pairs which were discarded because genomic sequence could not be extracted: 7 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1624790 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1624717 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 146151846 Total methylated C's in CpG context: 3509686 Total methylated C's in CHG context: 189977 Total methylated C's in CHH context: 840199 Total methylated C's in Unknown context: 20765 Total unmethylated C's in CpG context: 14664146 Total unmethylated C's in CHG context: 24823960 Total unmethylated C's in CHH context: 102123878 Total unmethylated C's in Unknown context: 159984 C methylated in CpG context: 19.3% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.5% Processed 4840076 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840076 Number of paired-end alignments with a unique best hit: 3251687 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 801058 Sequence pairs did not map uniquely: 787331 Sequence pairs which were discarded because genomic sequence could not be extracted: 5 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1624462 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1627220 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 146253592 Total methylated C's in CpG context: 3502836 Total methylated C's in CHG context: 189660 Total methylated C's in CHH context: 844167 Total methylated C's in Unknown context: 20975 Total unmethylated C's in CpG context: 14674480 Total unmethylated C's in CHG context: 24831688 Total unmethylated C's in CHH context: 102210761 Total unmethylated C's in Unknown context: 160699 C methylated in CpG context: 19.3% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.5% 4840076 reads; of these: 4840076 (100.00%) were paired; of these: 1975232 (40.81%) aligned concordantly 0 times 1079001 (22.29%) aligned concordantly exactly 1 time 1785843 (36.90%) aligned concordantly >1 times 59.19% overall alignment rate 4840076 reads; of these: 4840076 (100.00%) were paired; of these: 1975557 (40.82%) aligned concordantly 0 times 1079875 (22.31%) aligned concordantly exactly 1 time 1784644 (36.87%) aligned concordantly >1 times 59.18% overall alignment rate Processed 4840076 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840076 Number of paired-end alignments with a unique best hit: 3251883 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 801213 Sequence pairs did not map uniquely: 786980 Sequence pairs which were discarded because genomic sequence could not be extracted: 5 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1625623 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1626255 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 146275025 Total methylated C's in CpG context: 3512536 Total methylated C's in CHG context: 190871 Total methylated C's in CHH context: 841651 Total methylated C's in Unknown context: 20881 Total unmethylated C's in CpG context: 14676631 Total unmethylated C's in CHG context: 24843614 Total unmethylated C's in CHH context: 102209722 Total unmethylated C's in Unknown context: 161132 C methylated in CpG context: 19.3% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.5% Now waiting for all child processes to complete Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2495:32179:8062_1:N:0:CTGTCACT+AATATTAA Chromosome_4A 93973121 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1974746 (40.80%) aligned concordantly 0 times 1080973 (22.33%) aligned concordantly exactly 1 time 1784358 (36.87%) aligned concordantly >1 times 59.20% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1976419 (40.83%) aligned concordantly 0 times 1078961 (22.29%) aligned concordantly exactly 1 time 1784697 (36.87%) aligned concordantly >1 times 59.17% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 3253046 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 801100 Sequence pairs did not map uniquely: 785931 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1625242 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1627801 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 146354910 Total methylated C's in CpG context: 3512439 Total methylated C's in CHG context: 190652 Total methylated C's in CHH context: 842087 Total methylated C's in Unknown context: 21046 Total unmethylated C's in CpG context: 14671706 Total unmethylated C's in CHG context: 24857459 Total unmethylated C's in CHH context: 102280567 Total unmethylated C's in Unknown context: 160400 C methylated in CpG context: 19.3% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.6% 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1974017 (40.78%) aligned concordantly 0 times 1079472 (22.30%) aligned concordantly exactly 1 time 1786588 (36.91%) aligned concordantly >1 times 59.22% overall alignment rate 4840077 reads; of these: 4840077 (100.00%) were paired; of these: 1974937 (40.80%) aligned concordantly 0 times 1078746 (22.29%) aligned concordantly exactly 1 time 1786394 (36.91%) aligned concordantly >1 times 59.20% overall alignment rate Processed 4840077 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4840077 Number of paired-end alignments with a unique best hit: 3250351 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 801362 Sequence pairs did not map uniquely: 788364 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1625285 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1625062 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 146189865 Total methylated C's in CpG context: 3508827 Total methylated C's in CHG context: 189680 Total methylated C's in CHH context: 841948 Total methylated C's in Unknown context: 20818 Total unmethylated C's in CpG context: 14668070 Total unmethylated C's in CHG context: 24833753 Total unmethylated C's in CHH context: 102147587 Total unmethylated C's in Unknown context: 160118 C methylated in CpG context: 19.3% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.5% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 19360304. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.1 /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.1 /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.2 /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.2 /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.3 /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.3 /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.4 /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.4 /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.5 /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.5 /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.6 /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.6 /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.7 /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.7 /tmp/13-wgbs-Qui1-2994480/Qui1_R1.fq.gz.temp.8 /tmp/13-wgbs-Qui1-2994480/Qui1_R2.fq.gz.temp.8 Now merging BAM files Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.2_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.3_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.4_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.5_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.6_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.7_bismark_bt2_pe.bam Qui1_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Qui1_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Qui1_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1_bismark_bt2_PE_report.txt Now merging temporary reports Qui1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Qui1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Qui1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 38720614 Number of paired-end alignments with a unique best hit: 26013001 Mapping efficiency: 67.2% Sequence pairs with no alignments under any condition: 6408804 Sequence pairs did not map uniquely: 6298809 Sequence pairs which were discarded because genomic sequence could not be extracted: 41 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 13004180 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 13008780 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1170109245 Total methylated C's in CpG context: 28057300 Total methylated C's in CHG context: 1524001 Total methylated C's in CHH context: 6732122 Total methylated C's in Unknown context: 167127 Total unmethylated C's in CpG context: 117409166 Total unmethylated C's in CHG context: 198747677 Total unmethylated C's in CHH context: 817638979 Total unmethylated C's in Unknown context: 1285272 C methylated in CpG context: 19.3% C methylated in CHG context: 0.8% C methylated in CHH context: 0.8% C methylated in Unknown context (CN or CHN): 11.5% Deleting temporary report files... Qui1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Qui1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 57m 47s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs-hapa/bismark/Qui1_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs-hapa/bismark/Qui1_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs-hapa/bismark/Qui1_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Qui1_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs-hapa/bismark/Qui1_pe.bam: 26012960 Total number duplicated alignments removed: 1824185 (7.01%) Duplicated alignments were found at: 1707203 different position(s) Total count of deduplicated leftover sequences: 24188775 (92.99% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_1A LN:100680956 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_3A LN:93095432 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_5A LN:90413844 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_7A LN:74165749 skipping header line: @SQ SN:Chromosome_8A LN:54853936 skipping header line: @SQ SN:Chromosome_9A LN:66796497 skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui1-2994480 --output_dir output/13-wgbs-hapa/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Qui1_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui1_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui1_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_1A LN:100680956 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_3A LN:93095432 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_5A LN:90413844 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_7A LN:74165749 skipping SAM header line: @SQ SN:Chromosome_8A LN:54853936 skipping SAM header line: @SQ SN:Chromosome_9A LN:66796497 skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Qui1_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Qui1_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Qui1-2994480 --output_dir output/13-wgbs-hapa/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Qui1_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Qui1_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 23500000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24000000 Processed lines: 24000000 Finished processing child process. Exiting.. Processed lines: 24000000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Processed lines: 24000000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.8 Processed 24188775 lines in total Total number of methylation call strings processed: 48377550 Final Cytosine Methylation Report ================================= Total number of C's analysed: 799475338 Total methylated C's in CpG context: 19116900 Total methylated C's in CHG context: 982532 Total methylated C's in CHH context: 4381161 Total C to T conversions in CpG context: 80358495 Total C to T conversions in CHG context: 135711621 Total C to T conversions in CHH context: 558924629 C methylated in CpG context: 19.2% C methylated in non-CpG context: 0.8% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui1_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui1_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui1_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Qui1_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Qui1_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Qui1_pe.deduplicated.txt.gz Writing bedGraph to file: Qui1_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Qui1_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Now writing methylation information for file >>CpG_context_Qui1_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Qui1_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp Sorting input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Qui1_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs-hapa/methylation/Qui1_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Qui1.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Qui1.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1507170 different covered positions) Writing cytosine report for chromosome Chromosome_1A (stored 3531845 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3298035 different covered positions) Writing cytosine report for chromosome Chromosome_3A (stored 3135518 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 3163442 different covered positions) Writing cytosine report for chromosome Chromosome_5A (stored 2986249 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2765446 different covered positions) Writing cytosine report for chromosome Chromosome_7A (stored 2556090 different covered positions) Writing cytosine report for chromosome Chromosome_8A (stored 2010466 different covered positions) Writing cytosine report for last chromosome Chromosome_9A (stored 2349579 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Qui1.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Qui1.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs-hapa/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome-hapa/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome-hapa/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Processed 41500000 lines Processed 42000000 lines Processed 42500000 lines Processed 43000000 lines Processed 43500000 lines Processed 44000000 lines Processed 44500000 lines Processed 45000000 lines Processed 45500000 lines Processed 46000000 lines Processed 46500000 lines Processed 47000000 lines Processed 47500000 lines Processed 48000000 lines Printing nucleotide stats to >> output/13-wgbs-hapa/dedup/Qui1_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1986675842 33.89 253281200 32.09 7.844 C 954336584 16.28 141394985 17.92 6.749 G 1042619345 17.79 141251970 17.90 7.381 T 1877755732 32.04 253281001 32.09 7.414 AA 714367821 12.28 86162409 10.92 8.291 AC 321131181 5.52 45489259 5.76 7.059 AG 318906127 5.48 41639512 5.28 7.659 AT 618609418 10.63 79989139 10.14 7.734 CA 387711660 6.66 54159510 6.86 7.159 CC 168579745 2.90 28259664 3.58 5.965 CG 117937237 2.03 17208692 2.18 6.853 CT 272728237 4.69 41766898 5.29 6.530 GA 350356754 6.02 45250237 5.73 7.743 GC 155916153 2.68 22357630 2.83 6.974 GG 191901770 3.30 28206624 3.57 6.803 GT 336821419 5.79 45437311 5.76 7.413 TA 519661439 8.93 67706051 8.58 7.675 TC 301762564 5.19 45288269 5.74 6.663 TG 406386315 6.98 54196921 6.87 7.498 TT 636503661 10.94 86086811 10.91 7.394 [Sat Oct 10 10:03:06 PDT 2026] Qui1 done