[Sat Oct 10 07:51:45 PDT 2026] Pum1 (Pum/Pumalin) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 39015744 total bases: 5891377344 Q20 bases: 5823139956(98.8417%) Q30 bases: 5644454765(95.8087%) Q40 bases: 5644454765(95.8087%) Read2 before filtering: total reads: 39015744 total bases: 5891377344 Q20 bases: 5813962251(98.686%) Q30 bases: 5624985072(95.4783%) Q40 bases: 5624985072(95.4783%) Read1 after filtering: total reads: 38376265 total bases: 5313370562 Q20 bases: 5267614019(99.1388%) Q30 bases: 5129892116(96.5469%) Q40 bases: 5129892116(96.5469%) Read2 after filtering: total reads: 38376265 total bases: 5315163692 Q20 bases: 5265592874(99.0674%) Q30 bases: 5114235027(96.2197%) Q40 bases: 5114235027(96.2197%) Filtering result: reads passed filter: 76752530 reads failed due to low quality: 613466 reads failed due to too many N: 1516 reads failed due to too short: 663976 reads with adapter trimmed: 7483418 bases trimmed due to adapters: 168889299 Duplication rate: 5.8064% Insert size peak (evaluated by paired-end reads): 226 JSON report: output/13-wgbs-hapa/fastp/Pum1.fastp.json HTML report: output/13-wgbs-hapa/fastp/Pum1.fastp.html fastp -i /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/PUM1 (paired)_R1.fastq.gz -I /mmfs1/gscratch/scrubbed/sr320/chil-wgbs/PUM1 (paired)_R2.fastq.gz -o output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz -O output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz --detect_adapter_for_pe --trim_poly_g --trim_front1 10 --trim_front2 10 --length_required 50 --thread 16 --json output/13-wgbs-hapa/fastp/Pum1.fastp.json --html output/13-wgbs-hapa/fastp/Pum1.fastp.html fastp v1.0.1, time used: 74 seconds Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools' Reference genome folder provided is data/13-wgbs-genome-hapa/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/)' FastQ format assumed (by default) Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil'): output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/ Using temp directory: /tmp/13-wgbs-Pum1-2880440 Temporary files will be written into the directory: /tmp/13-wgbs-Pum1-2880440/ Summary of all aligner options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Running Bismark Parallel version. Number of parallel instances to be spawned: 8 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz and output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 2 (sequences written out: 4797033) Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz for PID: 2880821 and offset 8 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.2< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz<) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.8< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 5 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.5< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 6 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.6< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 4 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.4< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 1 (sequences written out: 4797034) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.1< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 7 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.7< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz for PID: 0 and offset 3 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.3< as new in-file 1 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz<) Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 2 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.2< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.2 to /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.2_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 5 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.5< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.5 to /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.5_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 4 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.4< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.4 to /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.4_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz for PID: 2880821 and offset 8 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.8< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.8 to /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.8_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 1 (sequences written out: 4797034) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.1< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.1 to /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.1_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 6 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.6< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.6 to /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.6_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 7 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.7< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.7 to /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.7_C_to_T.fastq Finished subdividing output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz for PID: 0 and offset 3 (sequences written out: 4797033) Using the subset file >/tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.3< as new in-file 2 (instead of >output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz<) Input files are in FastQ format Writing a C -> T converted version of the input file Pum1_R1.fq.gz.temp.3 to /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.3_C_to_T.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.2 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.2 to /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.2_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.5 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.5 to /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.5_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.4 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.4 to /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.4_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.8 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.8 to /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.8_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.1 (4797034 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.1 to /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.1_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.6 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.6 to /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.6_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.7 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.7 to /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.7_G_to_A.fastq Created C -> T converted version of the FastQ file Pum1_R1.fq.gz.temp.3 (4797033 sequences in total) Writing a G -> A converted version of the input file Pum1_R2.fq.gz.temp.3 to /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.3_G_to_A.fastq Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.2 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.2_C_to_T.fastq and Pum1_R2.fq.gz.temp.2_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.4 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.4_C_to_T.fastq and Pum1_R2.fq.gz.temp.4_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.8 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.8_C_to_T.fastq and Pum1_R2.fq.gz.temp.8_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.5 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.5_C_to_T.fastq and Pum1_R2.fq.gz.temp.5_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.1 (4797034 sequences in total) Input files are Pum1_R1.fq.gz.temp.1_C_to_T.fastq and Pum1_R2.fq.gz.temp.1_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.6 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.6_C_to_T.fastq and Pum1_R2.fq.gz.temp.6_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.7 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.7_C_to_T.fastq and Pum1_R2.fq.gz.temp.7_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:13993:1056_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_1A_CT_converted 90406522 0 54M3I15M1D69M = 90406565 182 AATTGTAAAAGAATTAAATAATAGGATTTGTTTATGAAATTGATAGGGTAATAGATTATTTTTTATTAAATAGGATAGAATTTAGGTGATTTAAATAAGTGTTAAAAATGAAGATGATTTTAGGGAAGAAAATATATTAGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-28 XS:i:-28 XN:i:0 XM:i:1 XO:i:2 XG:i:4 NM:i:5 MD:Z:69^T35G33 YS:i:-34 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:13993:1056_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_1A_CT_converted 90406565 0 11M3I15M1D112M = 90406522 -182 TAGGGTAATAGATTATTTTTTATTAAATAGGATAGAATTTAGGTGATTTAAATAAGTGTTAAAAATGAAGATGATTTTAGGGAAGAAAATATATTAGATTATTTAATTGATTTTTATATTAGATTTATAGAGAATTTAGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-34 XS:i:-34 XN:i:0 XM:i:2 XO:i:2 XG:i:4 NM:i:6 MD:Z:26^T35G74A1 YS:i:-28 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.8_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:13863:1056_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TTGTTAAAATATTTTGTTTGAAGTATTATTTTATTATTGAAAAAGTGATATAAGTTTTTAAATTATAATTTATGTGAGGTGATTAAAGGAGTTATTAAATAAAATTTTAGTGTAATGAGTTATTTTAATATTTGTATGGTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:13863:1056_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAAACTTCTTACACAACATATTAATTAATAAATTAAATATTTTTTCACAAAATTTATCTAAATTTTCTTCAAAATTAAAAACACCATACAAATATTAAAATAACTCATTACACTAAAATTTTATTTAATAACTCCTTTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.7_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:24954:1042_1:N:0:TGAGTACT+GNCAATAA/1 77 * 0 0 * * 0 0 TTTATTTAGAGAAAAATTTAATTTTTAAATTTAAAATATGTATAGTTTATTTAGTGAATAAAAATTGTATTAGAGTTTTGTGGGGATTAAAATATTAAATAATGTGTGAAGTGTTTAAAGTTAAAATTTTGTTTTAGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:24954:1042_2:N:0:TGAGTACT+GNCAATAA/2 141 * 0 0 * * 0 0 TTATCAACAAAAAATCAAATTATAACTACTTTAATAAAACTAAAACAAAATTTTAACTTTAAACACTTCACACATTATTTAATATTTTAATCCCCACAAAACTCTAATACAATTTTTATTCACTAAATAAACTATACATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:46781:1042_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_8A_CT_converted 9509138 35 141M = 9509213 216 TATTAATTTTTTGATTTTATAAATTAGATAGTTATAAATATTTTAGTATTATTTAATTAAAAAGAAGTGTATGTATATGTGTGTGTAAATTGGTAATTTTGATAATGTAAATTAGTTAAGGGTTTTAATATTTATTTATGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-40 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:46781:1042_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_8A_CT_converted 9509213 35 141M = 9509138 -216 TATGTGTGTGTAAATTGGTAATTTTGATAATGTAAATTAGTTAAGGGTTTTAATATTTATTTATGATATGAATATTAAGTTATTTTAATGAATAATAAAAAAGTTAGGTTGATTTTAAAGTTTGTGAATAAATGTTGTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-48 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.4_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:29938:1042_1:N:0:TGAGTACT+GNCAATAA/1 99 Chromosome_9A_CT_converted 24565631 1 141M = 24565665 175 TTTATTTGAGTTATTTTGGTTTATATTAGAAGAATTTATATATATTTGTATGTAAAATTATAGTTTTTATTATGGTTTTAATTTATTTTTGGAGGATATGGTTTTTGTAAATTTGAATTTATATTATGTTAGAAAGTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIII AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:59G81 YS:i:-12 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29938:1042_2:N:0:TGAGTACT+GNCAATAA/2 147 Chromosome_9A_CT_converted 24565665 1 141M = 24565631 -175 TTTATATATATTTGTATGTAAAATTATAGTTTTTATTATGGTTTTAATTTATTTTTGGAGGATATGGTTTTTGTAAATTTGAATTTATATTATGTTAGAAAGTTTTTAAGTAAATGTGAATTTTTTTGGTTTAATGGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-12 XS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:25G82T32 YS:i:-6 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:12326:1056_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_2A_CT_converted 92910652 42 141M = 92910759 248 AATTTAATAAATAAAGATAAAAGTTTGAGATATTTGTTAATAAGTGTTAATGATGATTATTTTTTAATGGTTTGGTTGTGATTATTTTTGGTATAAGGAATGGTATTGATTTTTTTTAAAAAAAAAGAAATTGTTTTGTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:26A114 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:12326:1056_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_2A_CT_converted 92910759 42 141M = 92910652 -248 GATTTTTTTTAAAAAAAAAGAAATTGTTTTGTTATTTAAAAAGAAAAAGTAAGATTATAAGTTTAATTAAAATAAGTTGATATAGTGGTGATAAATTTGATAATAAATTTTTTAGTAAGTTATATTTTGAATTTAATAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.6_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:10142:1056_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 ATTGGGAAATTTTTTTATTGGTGTAAGTGGGATTTGAATTTGTGTTGATAGAGTTGAGAGGTTGTGTGATTTTGAGTGTAATGTTTTAATTATTTGGTTATGGAGGTTTTATATGAGAAGATATTAGTAGTATTGTTATAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:10142:1056_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAAAACATCAAATTTTTTTTAACTCTCTAACCCTCATTATAACCCCATCCCTACCAAACAAAATCATAACTTAACCAATTTTAAATCCATACAATATAAAAATACATTTATAACAATACTACAAATATCTTCTCATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.5_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Created G -> A converted version of the FastQ file Pum1_R2.fq.gz.temp.3 (4797033 sequences in total) Input files are Pum1_R1.fq.gz.temp.3_C_to_T.fastq and Pum1_R2.fq.gz.temp.3_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ with the specified options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:39516:1042_1:N:0:TGAGTACT+GACAATAA/1 99 Chromosome_1A_CT_converted 34148108 42 141M = 34148163 196 TATGTTTATTTATTTTGTAATGTTATTGAATTTAAAAAAAAATATTTATGAATAAATAAAAATTTTTGTATGGTATGAAAATAAATTTTAAATAGTATAAGTTTTGATGTGATAAAGTAGGGTTTATAGGGTTTGTAGATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:39516:1042_2:N:0:TGAGTACT+GACAATAA/2 147 Chromosome_1A_CT_converted 34148163 42 141M = 34148108 -196 ATAAAAATTTTTGTATGGTATGAAAATAAATTTTAAATAGTATAAGTTTTGATGTGATAAAGTAGGGTTTATAGGGTTTGTAGATTTTATTTTTTATGTTAAAAAGTAGGTATTTTTTTTAATTTTTGTTTTAAAATTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.3_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00129:489:23JFWNLT4:8:1101:12326:1056_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 AATTTAATAAATAAAGATAAAAGTTTGAGATATTTGTTAATAAGTGTTAATGATGATTATTTTTTAATGGTTTGGTTGTGATTATTTTTGGTATAAGGAATGGTATTGATTTTTTTTAAAAAAAAAGAAATTGTTTTGTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:12326:1056_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AATTATTAAATTCAAAATATAACTTACTAAAAAATTTATTATCAAATTTATCACCACTATATCAACTTATTTTAATTAAACTTATAATCTTACTTTTTCTTTTTAAATAACAAAACAATTTCTTTTTTTTTAAAAAAAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Found first alignment: LH00129:489:23JFWNLT4:8:1101:10142:1056_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 ATTGGGAAATTTTTTTATTGGTGTAAGTGGGATTTGAATTTGTGTTGATAGAGTTGAGAGGTTGTGTGATTTTGAGTGTAATGTTTTAATTATTTGGTTATGGAGGTTTTATATGAGAAGATATTAGTAGTATTGTTATAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:10142:1056_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAAAACATCAAATTTTTTTTAACTCTCTAACCCTCATTATAACCCCATCCCTACCAAACAAAATCATAACTTAACCAATTTTAAATCCATACAATATAAAAATACATTTATAACAATACTACAAATATCTTCTCATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.6_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:13993:1056_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_7A_GA_converted 43418951 6 141M = 43418908 -184 TCTAATATATTTTCTTCCCTAAAATCATCTTCATTTTTAACACTTATTTAAATCACCTAAATTCTATCCTATTTAATAAAAAATAATCTATTACCCTATCAATTTCATAAACAAATCCTATTATTTAATTCTTTTACAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-8 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:-6 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:13993:1056_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_7A_GA_converted 43418908 6 141M = 43418951 184 AACTAAATTCTCTATAAATCTAATATAAAAATCAATTAAATAATCTAATATATTTTCTTCCCTAAAATCATCTTCATTTTTAACACTTATTTAAATCACCTAAATTCTATCCTATTTAATAAAAAATAATCTATTACCCTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-14 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:1T139 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.5_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.8_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:29938:1042_1:N:0:TGAGTACT+GNCAATAA/1 83 Chromosome_9A_GA_converted 16641539 6 104M2D37M = 16641505 -177 AAAAACTTTCTAACATAATATAAATTCAAATTTACAAAAACCATATCCTCCAAAAATAAATTAAAACCATAATAAAAACTATAATTTTACATACAAATATATATAAATTCTTCTAATATAAACCAAAATAACTCAAATAAA IIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-29 XS:i:-29 XN:i:0 XM:i:3 XO:i:1 XG:i:2 NM:i:5 MD:Z:45A35C22^AA3A33 YS:i:-18 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:29938:1042_2:N:0:TGAGTACT+GNCAATAA/2 163 Chromosome_9A_GA_converted 16641505 6 141M = 16641539 177 AAAACCATTAAACCAAAAAAATTCACATTTACTTAAAAACTTTCTAACATAATATAAATTCAAATTTACAAAAACCATATCCTCCAAAAATAAATTAAAACCATAATAAAAACTATAATTTTACATACAAATATATATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-18 XS:i:-24 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:32A46A35C25 YS:i:-29 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:24954:1042_1:N:0:TGAGTACT+GNCAATAA/1 83 Chromosome_7A_GA_converted 47256879 2 126M2D15M = 47256844 -178 AAAACTAAAACAAAATTTTAACTTTAAACACTTCACACATTATTTAATATTTTAATCCCCACAAAACTCTAATACAATTTTTATTCACTAAATAAACTATACATATTTTAAATTTAAAAATTAAATTTTTCTCTAAATAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-71 XS:i:-82 XN:i:0 XM:i:10 XO:i:1 XG:i:2 NM:i:12 MD:Z:25C5A1T16A5T1T24C20T17T3^TA4A10 YS:i:-60 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:24954:1042_2:N:0:TGAGTACT+GNCAATAA/2 163 Chromosome_7A_GA_converted 47256844 2 141M = 47256879 178 TTATCAACAAAAAATCAAATTATAACTACTTTAATAAAACTAAAACAAAATTTTAACTTTAAACACTTCACACATTATTTAATATTTTAATCCCCACAAAACTCTAATACAATTTTTATTCACTAAATAAACTATACATAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII AS:i:-60 XS:i:-60 XN:i:0 XM:i:10 XO:i:0 XG:i:0 NM:i:10 MD:Z:21C8C29C5A1T16A5T1T24C20T1 YS:i:-71 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:46781:1042_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_5A_GA_converted 46316143 0 127M1I3M1D10M = 46316068 -216 TCATAAATAAATATTAAAACCCTTAACTAATTTACATTATCAAAATTACCAATTTACACACACATATACATACACTTCTTTTTAATTAAATAATACTAAAATATTTATAACTATCTAATTTATAAAATCAAAAAATTAATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-28 XS:i:-34 XN:i:0 XM:i:2 XO:i:2 XG:i:2 NM:i:4 MD:Z:101C14T13^T10 YS:i:-30 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:46781:1042_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_5A_GA_converted 46316068 0 141M = 46316143 216 ATTACAACATTTATTCACAAACTTTAAAATCAACCTAACTTTTTTATTATTCATTAAAATAACTTAATATTCATATCATAAATAAATATTAAAACCCTTAACTAATTTACATTATCAAAATTACCAATTTACACACACATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-30 XS:i:-18 XN:i:0 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:7A0T5A3T14T107 YS:i:-28 YT:Z:CP Found first alignment: LH00129:489:23JFWNLT4:8:1101:13863:1056_1:N:0:TGAGTACT+GACAATAA/1 83 Chromosome_4A_GA_converted 6500079 42 141M = 6499998 -222 CACCATACAAATATTAAAATAACTCATTACACTAAAATTTTATTTAATAACTCCTTTAATCACCTCACATAAATTATAATTTAAAAACTTATATCACTTTTTCAATAATAAAATAATACTTCAAACAAAATATTTTAACAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP LH00129:489:23JFWNLT4:8:1101:13863:1056_2:N:0:TGAGTACT+GACAATAA/2 163 Chromosome_4A_GA_converted 6499998 42 141M = 6500079 222 AAAACTTCTTACACAACATATTAATTAATAAATTAAATATTTTTTCACAAAATTTATCTAAATTTTCTTCAAAATTAAAAACACCATACAAATATTAAAATAACTCATTACACTAAAATTTTATTTAATAACTCCTTTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.4_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.2_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam <<< >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.7_bismark_bt2_pe.bam <<< Found first alignment: LH00129:489:23JFWNLT4:8:1101:39516:1042_1:N:0:TGAGTACT+GACAATAA/1 77 * 0 0 * * 0 0 TATGTTTATTTATTTTGTAATGTTATTGAATTTAAAAAAAAATATTTATGAATAAATAAAAATTTTTGTATGGTATGAAAATAAATTTTAAATAGTATAAGTTTTGATGTGATAAAGTAGGGTTTATAGGGTTTGTAGATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00129:489:23JFWNLT4:8:1101:39516:1042_2:N:0:TGAGTACT+GACAATAA/2 141 * 0 0 * * 0 0 AAAAATTTTAAAACAAAAATTAAAAAAAATACCTACTTTTTAACATAAAAAATAAAATCTACAAACCCTATAAACCCTACTTTATCACATCAAAACTTATACTATTTAAAATTTATTTTCATACCATACAAAAATTTTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to Pum1_R1.fq.gz.temp.3_bismark_bt2_pe.bam <<< Reading in the sequence files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.5 and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.5 Reading in the sequence files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.7 and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.7 Reading in the sequence files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.6 and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.6 Reading in the sequence files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.8 and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.8 Reading in the sequence files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.2 and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.2 Reading in the sequence files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.4 and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.4 Reading in the sequence files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.1 and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.1 Reading in the sequence files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.3 and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.3 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1101:44233:3943_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973120 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1121:50317:9127_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973123 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1134:28749:18067_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973135 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1139:4818:22467_1:N:0:TGAGTACT+GACAATAA Chromosome_10A 41401119 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1142:15732:29403_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973114 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1151:3281:2205_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973131 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1212:44710:25143_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973121 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1210:22002:2037_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973122 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1229:29024:10080_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973152 Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1276:41410:18922_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973208 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1393:2222:27413_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973117 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1407:6105:6843_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973128 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1407:6089:6843_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973128 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1418:46482:7221_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973122 Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:1461:29768:18740_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973136 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2168:39978:4951_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973140 Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2244:43877:26558_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2282:10425:27890_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973134 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2258:50438:6647_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973124 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2320:5547:7418_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973135 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2332:13062:19594_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973138 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2340:23159:28955_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973122 Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2415:47987:7362_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973125 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2454:12553:2345_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973131 Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2488:48488:25662_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973124 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2054402 (42.83%) aligned concordantly 0 times 1043990 (21.76%) aligned concordantly exactly 1 time 1698641 (35.41%) aligned concordantly >1 times 57.17% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2053333 (42.80%) aligned concordantly 0 times 1044558 (21.78%) aligned concordantly exactly 1 time 1699142 (35.42%) aligned concordantly >1 times 57.20% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.4_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.4_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 3150588 Mapping efficiency: 65.7% Sequence pairs with no alignments under any condition: 905119 Sequence pairs did not map uniquely: 741326 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1573646 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1576938 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 139150603 Total methylated C's in CpG context: 3343439 Total methylated C's in CHG context: 143606 Total methylated C's in CHH context: 634401 Total methylated C's in Unknown context: 17049 Total unmethylated C's in CpG context: 13511665 Total unmethylated C's in CHG context: 23608057 Total unmethylated C's in CHH context: 97909435 Total unmethylated C's in Unknown context: 167147 C methylated in CpG context: 19.8% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.3% 4797034 reads; of these: 4797034 (100.00%) were paired; of these: 2052191 (42.78%) aligned concordantly 0 times 1046153 (21.81%) aligned concordantly exactly 1 time 1698690 (35.41%) aligned concordantly >1 times 57.22% overall alignment rate 4797034 reads; of these: 4797034 (100.00%) were paired; of these: 2053117 (42.80%) aligned concordantly 0 times 1044900 (21.78%) aligned concordantly exactly 1 time 1699017 (35.42%) aligned concordantly >1 times 57.20% overall alignment rate Processed 4797034 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.1_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.1_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797034 Number of paired-end alignments with a unique best hit: 3153358 Mapping efficiency: 65.7% Sequence pairs with no alignments under any condition: 902831 Sequence pairs did not map uniquely: 740845 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1574621 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1578733 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 139288258 Total methylated C's in CpG context: 3356804 Total methylated C's in CHG context: 143611 Total methylated C's in CHH context: 635792 Total methylated C's in Unknown context: 16930 Total unmethylated C's in CpG context: 13520895 Total unmethylated C's in CHG context: 23627594 Total unmethylated C's in CHH context: 98003562 Total unmethylated C's in Unknown context: 167607 C methylated in CpG context: 19.9% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.2% Chromosomal sequence could not be extracted for LH00129:489:23JFWNLT4:8:2486:8621:28744_1:N:0:TGAGTACT+GACAATAA Chromosome_4A 93973129 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2052489 (42.79%) aligned concordantly 0 times 1044579 (21.78%) aligned concordantly exactly 1 time 1699965 (35.44%) aligned concordantly >1 times 57.21% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2051702 (42.77%) aligned concordantly 0 times 1046769 (21.82%) aligned concordantly exactly 1 time 1698562 (35.41%) aligned concordantly >1 times 57.23% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.5_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.5_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 3153265 Mapping efficiency: 65.7% Sequence pairs with no alignments under any condition: 902320 Sequence pairs did not map uniquely: 741448 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1575454 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1577811 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 139285612 Total methylated C's in CpG context: 3353619 Total methylated C's in CHG context: 143795 Total methylated C's in CHH context: 634148 Total methylated C's in Unknown context: 17090 Total unmethylated C's in CpG context: 13536684 Total unmethylated C's in CHG context: 23621564 Total unmethylated C's in CHH context: 97995802 Total unmethylated C's in Unknown context: 167968 C methylated in CpG context: 19.9% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.2% 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2056763 (42.88%) aligned concordantly 0 times 1042578 (21.73%) aligned concordantly exactly 1 time 1697692 (35.39%) aligned concordantly >1 times 57.12% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2050817 (42.75%) aligned concordantly 0 times 1047403 (21.83%) aligned concordantly exactly 1 time 1698813 (35.41%) aligned concordantly >1 times 57.25% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.6_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.6_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 3151092 Mapping efficiency: 65.7% Sequence pairs with no alignments under any condition: 904328 Sequence pairs did not map uniquely: 741613 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1571127 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1579962 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 139174128 Total methylated C's in CpG context: 3347576 Total methylated C's in CHG context: 142649 Total methylated C's in CHH context: 635513 Total methylated C's in Unknown context: 17043 Total unmethylated C's in CpG context: 13536789 Total unmethylated C's in CHG context: 23610877 Total unmethylated C's in CHH context: 97900724 Total unmethylated C's in Unknown context: 168169 C methylated in CpG context: 19.8% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.2% 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2049912 (42.73%) aligned concordantly 0 times 1046081 (21.81%) aligned concordantly exactly 1 time 1701040 (35.46%) aligned concordantly >1 times 57.27% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2052800 (42.79%) aligned concordantly 0 times 1044017 (21.76%) aligned concordantly exactly 1 time 1700216 (35.44%) aligned concordantly >1 times 57.21% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2051630 (42.77%) aligned concordantly 0 times 1044851 (21.78%) aligned concordantly exactly 1 time 1700552 (35.45%) aligned concordantly >1 times 57.23% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.3_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.3_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 3152133 Mapping efficiency: 65.7% Sequence pairs with no alignments under any condition: 903072 Sequence pairs did not map uniquely: 741828 Sequence pairs which were discarded because genomic sequence could not be extracted: 4 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1574896 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1577233 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 139234919 Total methylated C's in CpG context: 3358316 Total methylated C's in CHG context: 143082 Total methylated C's in CHH context: 635353 Total methylated C's in Unknown context: 17044 Total unmethylated C's in CpG context: 13507544 Total unmethylated C's in CHG context: 23618387 Total unmethylated C's in CHH context: 97972237 Total unmethylated C's in Unknown context: 167267 C methylated in CpG context: 19.9% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.2% 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2051918 (42.77%) aligned concordantly 0 times 1043312 (21.75%) aligned concordantly exactly 1 time 1701803 (35.48%) aligned concordantly >1 times 57.23% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.8_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.8_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 3152868 Mapping efficiency: 65.7% Sequence pairs with no alignments under any condition: 901333 Sequence pairs did not map uniquely: 742832 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1573252 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1579613 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 139230792 Total methylated C's in CpG context: 3350464 Total methylated C's in CHG context: 144049 Total methylated C's in CHH context: 634073 Total methylated C's in Unknown context: 16766 Total unmethylated C's in CpG context: 13522149 Total unmethylated C's in CHG context: 23615901 Total unmethylated C's in CHH context: 97964156 Total unmethylated C's in Unknown context: 166654 C methylated in CpG context: 19.9% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.1% Now waiting for all child processes to complete 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2053863 (42.82%) aligned concordantly 0 times 1044339 (21.77%) aligned concordantly exactly 1 time 1698831 (35.41%) aligned concordantly >1 times 57.18% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2052325 (42.78%) aligned concordantly 0 times 1042812 (21.74%) aligned concordantly exactly 1 time 1701896 (35.48%) aligned concordantly >1 times 57.22% overall alignment rate 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2050041 (42.74%) aligned concordantly 0 times 1045184 (21.79%) aligned concordantly exactly 1 time 1701808 (35.48%) aligned concordantly >1 times 57.26% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.7_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.7_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 3152470 Mapping efficiency: 65.7% Sequence pairs with no alignments under any condition: 902717 Sequence pairs did not map uniquely: 741846 Sequence pairs which were discarded because genomic sequence could not be extracted: 5 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1573280 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1579185 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 139234021 Total methylated C's in CpG context: 3353235 Total methylated C's in CHG context: 143513 Total methylated C's in CHH context: 635988 Total methylated C's in Unknown context: 16784 Total unmethylated C's in CpG context: 13506098 Total unmethylated C's in CHG context: 23616323 Total unmethylated C's in CHH context: 97978864 Total unmethylated C's in Unknown context: 166379 C methylated in CpG context: 19.9% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.2% 4797033 reads; of these: 4797033 (100.00%) were paired; of these: 2052531 (42.79%) aligned concordantly 0 times 1046054 (21.81%) aligned concordantly exactly 1 time 1698448 (35.41%) aligned concordantly >1 times 57.21% overall alignment rate Processed 4797033 sequences in total Successfully deleted the temporary files /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.2_C_to_T.fastq and /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.2_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 4797033 Number of paired-end alignments with a unique best hit: 3149765 Mapping efficiency: 65.7% Sequence pairs with no alignments under any condition: 903111 Sequence pairs did not map uniquely: 744157 Sequence pairs which were discarded because genomic sequence could not be extracted: 3 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 1572105 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 1577657 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 139132017 Total methylated C's in CpG context: 3344632 Total methylated C's in CHG context: 142962 Total methylated C's in CHH context: 633030 Total methylated C's in Unknown context: 16691 Total unmethylated C's in CpG context: 13512824 Total unmethylated C's in CHG context: 23598221 Total unmethylated C's in CHH context: 97900348 Total unmethylated C's in Unknown context: 167537 C methylated in CpG context: 19.8% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.1% All child processes successfully finished. at /mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/bismark line 599, line 19188132. Right, cleaning up now... Deleting temporary sequence files... /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.1 /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.1 /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.2 /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.2 /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.3 /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.3 /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.4 /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.4 /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.5 /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.5 /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.6 /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.6 /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.7 /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.7 /tmp/13-wgbs-Pum1-2880440/Pum1_R1.fq.gz.temp.8 /tmp/13-wgbs-Pum1-2880440/Pum1_R2.fq.gz.temp.8 Now merging BAM files Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.2_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.3_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.4_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.5_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.6_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.7_bismark_bt2_pe.bam Pum1_R1.fq.gz.temp.8_bismark_bt2_pe.bam into >>> Pum1_R1_bismark_bt2_pe.bam <<< (using --threads 4) Merging from file >> Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.2_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.3_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.4_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.5_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.6_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.7_bismark_bt2_pe.bam << Merging from file >> Pum1_R1.fq.gz.temp.8_bismark_bt2_pe.bam << Deleting temporary BAM files... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1.fq.gz.temp.2_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1.fq.gz.temp.3_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1.fq.gz.temp.4_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1.fq.gz.temp.5_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1.fq.gz.temp.6_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1.fq.gz.temp.7_bismark_bt2_pe.bam /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1.fq.gz.temp.8_bismark_bt2_pe.bam Writing report to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1_bismark_bt2_PE_report.txt Now merging temporary reports Pum1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt into >>> /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1_bismark_bt2_PE_report.txt <<< Merging from file >> Pum1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt << Merging from file >> Pum1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt << Printing a final merged alignment report for all individual sub-reports Final Alignment report ====================== Sequence pairs analysed in total: 38376265 Number of paired-end alignments with a unique best hit: 25215539 Mapping efficiency: 65.7% Sequence pairs with no alignments under any condition: 7224831 Sequence pairs did not map uniquely: 5935895 Sequence pairs which were discarded because genomic sequence could not be extracted: 26 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 12588381 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 12627132 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1113730350 Total methylated C's in CpG context: 26808085 Total methylated C's in CHG context: 1147267 Total methylated C's in CHH context: 5078298 Total methylated C's in Unknown context: 135397 Total unmethylated C's in CpG context: 108154648 Total unmethylated C's in CHG context: 188916924 Total unmethylated C's in CHH context: 783625128 Total unmethylated C's in Unknown context: 1338728 C methylated in CpG context: 19.9% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in Unknown context (CN or CHN): 9.2% Deleting temporary report files... Pum1_R1.fq.gz.temp.1_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.2_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.3_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.4_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.5_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.6_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.7_bismark_bt2_PE_report.txt Pum1_R1.fq.gz.temp.8_bismark_bt2_PE_report.txt Bismark completed in 0d 0h 52m 3s ==================== Bismark run complete ==================== Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/dedup/ Processing paired-end Bismark output file(s) (SAM format): output/13-wgbs-hapa/bismark/Pum1_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>output/13-wgbs-hapa/bismark/Pum1_pe.bam<< for signs of file truncation... Now testing Bismark result file output/13-wgbs-hapa/bismark/Pum1_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: Pum1_pe.deduplicated.bam Total number of alignments analysed in output/13-wgbs-hapa/bismark/Pum1_pe.bam: 25215513 Total number duplicated alignments removed: 1768282 (7.01%) Duplicated alignments were found at: 1641860 different position(s) Total count of deduplicated leftover sequences: 23447231 (92.99% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:Chromosome_1A LN:100680956 skipping header line: @SQ SN:Chromosome_2A LN:98156180 skipping header line: @SQ SN:Chromosome_3A LN:93095432 skipping header line: @SQ SN:Chromosome_4A LN:93973257 skipping header line: @SQ SN:Chromosome_5A LN:90413844 skipping header line: @SQ SN:Chromosome_6A LN:76092957 skipping header line: @SQ SN:Chromosome_7A LN:74165749 skipping header line: @SQ SN:Chromosome_8A LN:54853936 skipping header line: @SQ SN:Chromosome_9A LN:66796497 skipping header line: @SQ SN:Chromosome_10A LN:41401248 skipping header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Pum1-2880440 --output_dir output/13-wgbs-hapa/bismark" skipping header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Pum1_pe.bam *** Bismark methylation extractor version v0.25.1 *** Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 8 First 5 bp will be disregarded when processing the methylation call string of Read 2 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output path specified as: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '40G'. Temporary directory used for sorting is the output directory Checking file >>output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Pum1_pe.deduplicated.txt.gz Writing result file containing methylation information for C in any other context to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Pum1_pe.deduplicated.txt.gz Now reading in Bismark result file output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam Now reading in Bismark result file output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:Chromosome_1A LN:100680956 skipping SAM header line: @SQ SN:Chromosome_2A LN:98156180 skipping SAM header line: @SQ SN:Chromosome_3A LN:93095432 skipping SAM header line: @SQ SN:Chromosome_4A LN:93973257 skipping SAM header line: @SQ SN:Chromosome_5A LN:90413844 skipping SAM header line: @SQ SN:Chromosome_6A LN:76092957 skipping SAM header line: @SQ SN:Chromosome_7A LN:74165749 skipping SAM header line: @SQ SN:Chromosome_8A LN:54853936 skipping SAM header line: @SQ SN:Chromosome_9A LN:66796497 skipping SAM header line: @SQ SN:Chromosome_10A LN:41401248 skipping SAM header line: @PG ID:Bismark VN:v0.25.1 CL:"bismark --genome data/13-wgbs-genome-hapa -1 output/13-wgbs-hapa/trimmed/Pum1_R1.fq.gz -2 output/13-wgbs-hapa/trimmed/Pum1_R2.fq.gz --score_min L,0,-0.6 --parallel 8 -p 2 --temp_dir /tmp/13-wgbs-Pum1-2880440 --output_dir output/13-wgbs-hapa/bismark" skipping SAM header line: @PG ID:samtools PN:samtools PP:Bismark VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bSh - skipping SAM header line: @PG ID:samtools.1 PN:samtools PP:samtools VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/bismark/Pum1_R1.fq.gz.temp.1_bismark_bt2_pe.bam skipping SAM header line: @PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view --threads 4 -bSh - skipping SAM header line: @PG ID:samtools.3 PN:samtools PP:samtools.2 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h --threads 1 output/13-wgbs-hapa/bismark/Pum1_pe.bam skipping SAM header line: @PG ID:samtools.4 PN:samtools PP:samtools.3 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -bS --threads 1 - skipping SAM header line: @PG ID:samtools.5 PN:samtools PP:samtools.4 VN:1.22.1 CL:/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools view -h output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 500000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1000000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 1500000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2000000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 2500000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3000000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 3500000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4000000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 4500000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5000000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 5500000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6000000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 6500000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7000000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 7500000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8000000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 8500000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9000000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 9500000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10000000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 10500000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11000000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 11500000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12000000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 12500000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13000000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 13500000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14000000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 14500000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15000000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 15500000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16000000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 16500000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17000000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 17500000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18000000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 18500000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19000000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 19500000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20000000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 20500000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21000000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 21500000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22000000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 22500000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Processed lines: 23000000 Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. All child process successfully finished. Merging individual splitting reports into overall report: '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt' Merging from these individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.1 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.2 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.3 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.4 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.5 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.6 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.7 /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.8 Processed 23447231 lines in total Total number of methylation call strings processed: 46894462 Final Cytosine Methylation Report ================================= Total number of C's analysed: 827325367 Total methylated C's in CpG context: 19871818 Total methylated C's in CHG context: 696228 Total methylated C's in CHH context: 3123844 Total C to T conversions in CpG context: 80574743 Total C to T conversions in CHG context: 140416628 Total C to T conversions in CHH context: 582642106 C methylated in CpG context: 19.8% C methylated in non-CpG context: 0.5% Merging individual M-bias reports into overall M-bias statistics from these 8 individual files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.1.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.2.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.3.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.4.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.5.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.6.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.7.mbias /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated_splitting_report.txt.8.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 141 Maximum read length of Read 2: 136 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Pum1_pe.deduplicated.txt.gz contains data -> kept /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Pum1_pe.deduplicated.txt.gz contains data -> kept Using these input files: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Pum1_pe.deduplicated.txt.gz /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/Non_CpG_context_Pum1_pe.deduplicated.txt.gz Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: Pum1_pe.deduplicated.bedGraph.gz output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 40G Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/CpG_context_Pum1_pe.deduplicated.txt.gz Writing bedGraph to file: Pum1_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: Pum1_pe.deduplicated.bismark.cov.gz Changed directory to /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Now writing methylation information for file >>CpG_context_Pum1_pe.deduplicated.txt.gz<< to individual files for each chromosome Finished writing out individual chromosome files for CpG_context_Pum1_pe.deduplicated.txt.gz Collecting temporary chromosome file information... Processing the following input file(s): CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_10A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_1A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_2A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_3A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_4A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_5A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_6A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_7A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_8A.methXtractor.temp Sorting input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp by positions (using -S of 40G) Successfully deleted the temporary input file CpG_context_Pum1_pe.deduplicated.txt.gz.chrChromosome_9A.methXtractor.temp Finished BedGraph conversion ... Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/ Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: output/13-wgbs-hapa/methylation/Pum1_pe.deduplicated.bismark.cov.gz Output directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/< Coverage threshold 0 (all positions will be reported, default) CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 1-based (default) GZIP compression: yes Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== Adding context-specific methylation summaries >>> Writing genome-wide cytosine report to: Pum1.CpG_report.txt.gz <<< >>> Writing all cytosine context summary file to: Pum1.cytosine_context_summary.txt <<< Storing all covered cytosine positions for chromosome: Chromosome_10A Writing cytosine report for chromosome Chromosome_10A (stored 1439316 different covered positions) Writing cytosine report for chromosome Chromosome_1A (stored 3428133 different covered positions) Writing cytosine report for chromosome Chromosome_2A (stored 3159865 different covered positions) Writing cytosine report for chromosome Chromosome_3A (stored 2976800 different covered positions) Writing cytosine report for chromosome Chromosome_4A (stored 3073901 different covered positions) Writing cytosine report for chromosome Chromosome_5A (stored 2857228 different covered positions) Writing cytosine report for chromosome Chromosome_6A (stored 2627332 different covered positions) Writing cytosine report for chromosome Chromosome_7A (stored 2462291 different covered positions) Writing cytosine report for chromosome Chromosome_8A (stored 1856390 different covered positions) Writing cytosine report for last chromosome Chromosome_9A (stored 2272153 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 10 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... All chromosomes in the genome were covered by at least some reads. coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>Pum1.CpG_report.txt.gz<<, in output directory '/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/output/13-wgbs-hapa/methylation/') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to Pum1.CpG_report.merged_CpG_evidence.cov.gz <<< CpG merging complete. Good luck finding DMRs with bsseq! [bam_sort_core] merging from 1 files and 8 in-memory blocks... Summary of parameters for nucleotide coverage report: ===================================================== Output directory: >output/13-wgbs-hapa/dedup/< Parent directory: >/mmfs1/gscratch/scrubbed/sr320/github/project-ostrea-chil/< Genome directory: >data/13-wgbs-genome-hapa/< Samtools installation: >/mmfs1/gscratch/srlab/sr320/miniforge3/envs/myflow/bin/samtools< Now reading in and storing sequence information of the genome specified in: data/13-wgbs-genome-hapa/ chr Chromosome_1A (100680956 bp) chr Chromosome_2A (98156180 bp) chr Chromosome_3A (93095432 bp) chr Chromosome_4A (93973257 bp) chr Chromosome_5A (90413844 bp) chr Chromosome_6A (76092957 bp) chr Chromosome_7A (74165749 bp) chr Chromosome_8A (54853936 bp) chr Chromosome_9A (66796497 bp) chr Chromosome_10A (41401248 bp) Stored sequence information of 10 chromosomes/scaffolds in total ================================================================== Mono- and di-nucleotide coverage will now be written into a report ================================================================== Detected file 'genomic_nucleotide_frequencies.txt' in the genome folder data/13-wgbs-genome-hapa/ already. Using nucleotide frequencies contained therein ... ============================================================================================================================================================================================ Calculating read frequencies from file 'output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.bam' ========================================================================================== Determined the file to be paired-end Processed 500000 lines Processed 1000000 lines Processed 1500000 lines Processed 2000000 lines Processed 2500000 lines Processed 3000000 lines Processed 3500000 lines Processed 4000000 lines Processed 4500000 lines Processed 5000000 lines Processed 5500000 lines Processed 6000000 lines Processed 6500000 lines Processed 7000000 lines Processed 7500000 lines Processed 8000000 lines Processed 8500000 lines Processed 9000000 lines Processed 9500000 lines Processed 10000000 lines Processed 10500000 lines Processed 11000000 lines Processed 11500000 lines Processed 12000000 lines Processed 12500000 lines Processed 13000000 lines Processed 13500000 lines Processed 14000000 lines Processed 14500000 lines Processed 15000000 lines Processed 15500000 lines Processed 16000000 lines Processed 16500000 lines Processed 17000000 lines Processed 17500000 lines Processed 18000000 lines Processed 18500000 lines Processed 19000000 lines Processed 19500000 lines Processed 20000000 lines Processed 20500000 lines Processed 21000000 lines Processed 21500000 lines Processed 22000000 lines Processed 22500000 lines Processed 23000000 lines Processed 23500000 lines Processed 24000000 lines Processed 24500000 lines Processed 25000000 lines Processed 25500000 lines Processed 26000000 lines Processed 26500000 lines Processed 27000000 lines Processed 27500000 lines Processed 28000000 lines Processed 28500000 lines Processed 29000000 lines Processed 29500000 lines Processed 30000000 lines Processed 30500000 lines Processed 31000000 lines Processed 31500000 lines Processed 32000000 lines Processed 32500000 lines Processed 33000000 lines Processed 33500000 lines Processed 34000000 lines Processed 34500000 lines Processed 35000000 lines Processed 35500000 lines Processed 36000000 lines Processed 36500000 lines Processed 37000000 lines Processed 37500000 lines Processed 38000000 lines Processed 38500000 lines Processed 39000000 lines Processed 39500000 lines Processed 40000000 lines Processed 40500000 lines Processed 41000000 lines Processed 41500000 lines Processed 42000000 lines Processed 42500000 lines Processed 43000000 lines Processed 43500000 lines Processed 44000000 lines Processed 44500000 lines Processed 45000000 lines Processed 45500000 lines Processed 46000000 lines Processed 46500000 lines Printing nucleotide stats to >> output/13-wgbs-hapa/dedup/Pum1_pe.deduplicated.nucleotide_stats.txt << Final Stage: Calculating averages ================================= (di-)nucleotide count sample percent sample count genomic percent genomic coverage A 1938589483 34.51 253281200 32.09 7.654 C 896586028 15.96 141394985 17.92 6.341 G 991709676 17.65 141251970 17.90 7.021 T 1791141379 31.88 253281001 32.09 7.072 AA 707671573 12.69 86162409 10.92 8.213 AC 307259049 5.51 45489259 5.76 6.755 AG 310148757 5.56 41639512 5.28 7.448 AT 600107629 10.76 79989139 10.14 7.502 CA 370680477 6.65 54159510 6.86 6.844 CC 155158605 2.78 28259664 3.58 5.490 CG 108186515 1.94 17208692 2.18 6.287 CT 255722229 4.58 41766898 5.29 6.123 GA 339962857 6.09 45250237 5.73 7.513 GC 144841286 2.60 22357630 2.83 6.478 GG 180237119 3.23 28206624 3.57 6.390 GT 319617119 5.73 45437311 5.76 7.034 TA 506122612 9.07 67706051 8.58 7.475 TC 282860617 5.07 45288269 5.74 6.246 TG 386047836 6.92 54196921 6.87 7.123 TT 603172334 10.81 86086811 10.91 7.007 [Sat Oct 10 09:48:12 PDT 2026] Pum1 done