Bowtie 2 seems to be working fine (tested command '/home/shared/bowtie2-2.4.4-linux-x86_64/bowtie2 --version' [2.4.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools' Reference genome folder provided is /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/22-genome-prep/ (absolute path is '/home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/22-genome-prep/)' FastQ format assumed (by default) Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 12 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/code'): /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/25.1-93M-cov-recovery/reads/93M_R1.fastp-trim.fq.gz /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/25.1-93M-cov-recovery/reads/93M_R2.fastp-trim.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Output will be written into the directory: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/23-bismark-align/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 12 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/code Now reading in and storing sequence information of the genome specified in: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/22-genome-prep/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/25.1-93M-cov-recovery/reads/93M_R1.fastp-trim.fq.gz and /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/25.1-93M-cov-recovery/reads/93M_R2.fastp-trim.fq.gz Input files are in FastQ format Writing a C -> T converted version of the input file 93M_R1.fastp-trim.fq.gz to 93M_R1.fastp-trim.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file 93M_R1.fastp-trim.fq.gz to 93M_R1.fastp-trim.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file 93M_R1.fastp-trim.fq.gz (91219204 sequences in total) Writing a C -> T converted version of the input file 93M_R2.fastp-trim.fq.gz to 93M_R2.fastp-trim.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file 93M_R2.fastp-trim.fq.gz to 93M_R2.fastp-trim.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file 93M_R2.fastp-trim.fq.gz (91219204 sequences in total) Input files are 93M_R1.fastp-trim.fq.gz_C_to_T.fastq and 93M_R1.fastp-trim.fq.gz_G_to_A.fastq and 93M_R2.fastp-trim.fq.gz_C_to_T.fastq and 93M_R2.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/22-genome-prep/ with the specified options: -q --score-min L,0,-0.6 -p 12 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from 93M_R1.fastp-trim.fq.gz_C_to_T.fastq and 93M_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 12 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00469:254:22HGFVLT4:2:1101:1736:1014_1:N:0:CGGTTGTT+GTGGTATG/1 77 * 0 0 * * 0 0 TTGGTTTGTTATTTTTAATGAATTGTATGATTAGAGTGGAGTTATTAGAATTATTTTATGTGGATTTTTTTTGGTGTTATTGTTAATTTTTTTTTGTAATTGAGTTTAATGTTTTTGTGATTTTGTATATA IIIIIIIIII-IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII-IIIIIIIIIII99IIIIIIIIIIIIIIIIIIIII- YT:Z:UP LH00469:254:22HGFVLT4:2:1101:1736:1014_2:N:0:CGGTTGTT+GTGGTATG/2 141 * 0 0 * * 0 0 ATTATAAATACCCTTAAAAAACATCCCTAAAAAACTCTAAAACTCCTATAATTATATATACAAAATCACAAAAACATTAAACTCAATTACAAAAAAAAATTAACAATAACACCAAAAAAAATCCACATAAA IIIIIIIIIIIIIIII-IIIII9IIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIII-IIIIIIIIII9IIIIIIIII9IIIIII9IIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2GAgenome (reading in sequences from 93M_R1.fastp-trim.fq.gz_G_to_A.fastq and 93M_R2.fastp-trim.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.6 -p 12 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00469:254:22HGFVLT4:2:1101:1736:1014_1:N:0:CGGTTGTT+GTGGTATG/1 77 * 0 0 * * 0 0 TTAATTTATTATTTTTAATAAATTATACAATTAAAATAAAATTATTAAAATTATTTTATATAAATTTTTTTTAATATTATTATTAATTTTTTTTTATAATTAAATTTAATATTTTTATAATTTTATATATA IIIIIIIIII-IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII-IIIIIIIIIII99IIIIIIIIIIIIIIIIIIIII- YT:Z:UP LH00469:254:22HGFVLT4:2:1101:1736:1014_2:N:0:CGGTTGTT+GTGGTATG/2 141 * 0 0 * * 0 0 ATTATAAATATTTTTAAAAAATATTTTTAAAAAATTTTAAAATTTTTATAATTATATATATAAAATTATAAAAATATTAAATTTAATTATAAAAAAAAATTAATAATAATATTAAAAAAAATTTATATAAA IIIIIIIIIIIIIIII-IIIII9IIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIII-IIIIIIIIII9IIIIIIIII9IIIIII9IIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2CTgenome (reading in sequences from 93M_R1.fastp-trim.fq.gz_G_to_A.fastq and 93M_R2.fastp-trim.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.6 -p 12 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00469:254:22HGFVLT4:2:1101:1736:1014_1:N:0:CGGTTGTT+GTGGTATG/1 77 * 0 0 * * 0 0 TTAATTTATTATTTTTAATAAATTATACAATTAAAATAAAATTATTAAAATTATTTTATATAAATTTTTTTTAATATTATTATTAATTTTTTTTTATAATTAAATTTAATATTTTTATAATTTTATATATA IIIIIIIIII-IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII-IIIIIIIIIII99IIIIIIIIIIIIIIIIIIIII- YT:Z:UP LH00469:254:22HGFVLT4:2:1101:1736:1014_2:N:0:CGGTTGTT+GTGGTATG/2 141 * 0 0 * * 0 0 ATTATAAATATTTTTAAAAAATATTTTTAAAAAATTTTAAAATTTTTATAATTATATATATAAAATTATAAAAATATTAAATTTAATTATAAAAAAAAATTAATAATAATATTAAAAAAAATTTATATAAA IIIIIIIIIIIIIIII-IIIII9IIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIII-IIIIIIIIII9IIIIIIIII9IIIIII9IIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from 93M_R1.fastp-trim.fq.gz_C_to_T.fastq and 93M_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 12 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00469:254:22HGFVLT4:2:1101:1736:1014_1:N:0:CGGTTGTT+GTGGTATG/1 77 * 0 0 * * 0 0 TTGGTTTGTTATTTTTAATGAATTGTATGATTAGAGTGGAGTTATTAGAATTATTTTATGTGGATTTTTTTTGGTGTTATTGTTAATTTTTTTTTGTAATTGAGTTTAATGTTTTTGTGATTTTGTATATA IIIIIIIIII-IIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIII-IIIIIIIIIII99IIIIIIIIIIIIIIIIIIIII- YT:Z:UP LH00469:254:22HGFVLT4:2:1101:1736:1014_2:N:0:CGGTTGTT+GTGGTATG/2 141 * 0 0 * * 0 0 ATTATAAATACCCTTAAAAAACATCCCTAAAAAACTCTAAAACTCCTATAATTATATATACAAAATCACAAAAACATTAAACTCAATTACAAAAAAAAATTAACAATAACACCAAAAAAAATCCACATAAA IIIIIIIIIIIIIIII-IIIII9IIIII99IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIII9IIIIIIIIIIIIIIIII-IIIIIIIIII9IIIIIIIII9IIIIII9IIII YT:Z:UP >>> Writing bisulfite mapping results to 93M_pe.bam <<< Reading in the sequence files /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/25.1-93M-cov-recovery/reads/93M_R1.fastp-trim.fq.gz and /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/25.1-93M-cov-recovery/reads/93M_R2.fastp-trim.fq.gz Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1117:14878:22558_1:N:0:CGGTTGTT+GTGGTATG NW_026963309.1 2 Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1141:3857:22390_1:N:0:CGGTTGTT+GTGGTATG NW_026963533.1 25109 Processed 5000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1157:48477:6225_1:N:0:CGGTTGTT+GTGGTATG NW_026963382.1 58133 Processed 6000000 sequence pairs so far Processed 7000000 sequence pairs so far Processed 8000000 sequence pairs so far Processed 9000000 sequence pairs so far Processed 10000000 sequence pairs so far Processed 11000000 sequence pairs so far Processed 12000000 sequence pairs so far Processed 13000000 sequence pairs so far Processed 14000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1245:37755:20975_1:N:0:CGGTTGTT+GTGGTATG NW_026963743.1 1 Processed 15000000 sequence pairs so far Processed 16000000 sequence pairs so far Processed 17000000 sequence pairs so far Processed 18000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1284:27729:13565_1:N:0:CGGTTGTT+GTGGTATG NW_026963706.1 1 Processed 19000000 sequence pairs so far Processed 20000000 sequence pairs so far Processed 21000000 sequence pairs so far Processed 22000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1320:45669:11954_1:N:0:AGGTTGTT+GTGGTATG NW_026963308.1 2 Processed 23000000 sequence pairs so far Processed 24000000 sequence pairs so far Processed 25000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1348:35570:22880_1:N:0:CGGTTGTT+GTGGTATG NW_026963322.1 898871 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1351:16270:16114_1:N:0:CGGTTGTT+GTGGTATG NW_026963705.1 1 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1352:17905:4684_1:N:0:CGGTTGTT+GTGGTATG NW_026963443.1 1 Processed 26000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1359:12005:23749_1:N:0:CGGTTGTT+GTGGTATG NW_026963322.1 898871 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1360:3719:20107_1:N:0:TGGTTGTT+GTGGTATG NW_026963299.1 2 Processed 27000000 sequence pairs so far Processed 28000000 sequence pairs so far Processed 29000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1389:3711:8438_1:N:0:TGGTTGTT+GTGGTATG NW_026963743.1 1 Processed 30000000 sequence pairs so far Processed 31000000 sequence pairs so far Processed 32000000 sequence pairs so far Processed 33000000 sequence pairs so far Processed 34000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1440:38079:18258_1:N:0:CGGTTGTT+GTGGTATG NW_026963716.1 2 Processed 35000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1451:25196:1756_1:N:0:AGGTTGTT+GTGGTATG NW_026963415.1 3 Processed 36000000 sequence pairs so far Processed 37000000 sequence pairs so far Processed 38000000 sequence pairs so far Processed 39000000 sequence pairs so far Processed 40000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2107:36598:11408_1:N:0:CGGTTGTT+GTGGTATG NW_026963377.1 1 Processed 41000000 sequence pairs so far Processed 42000000 sequence pairs so far Processed 43000000 sequence pairs so far Processed 44000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2145:35958:15120_1:N:0:AGGTTGTT+GTGGTATG NW_026963319.1 249881 Processed 45000000 sequence pairs so far Processed 46000000 sequence pairs so far Processed 47000000 sequence pairs so far Processed 48000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2189:26555:10918_1:N:0:CGGTTGTT+GTGGTATG NW_026963725.1 2 Processed 49000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2197:25519:16773_1:N:0:CGGTTGTT+GTGGTATG NW_026963415.1 2 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2197:24613:22936_1:N:0:CGGTTGTT+GTGGTATG NW_026963365.1 61315 Processed 50000000 sequence pairs so far Processed 51000000 sequence pairs so far Processed 52000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2226:34769:5693_1:N:0:CGGTTGTT+GTGGTATG NW_026963309.1 2 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2230:4002:7065_1:N:0:CGGTTGTT+GTGGTATG NW_026963299.1 1 Processed 53000000 sequence pairs so far Processed 54000000 sequence pairs so far Processed 55000000 sequence pairs so far Processed 56000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2272:19208:8452_1:N:0:CGGTTGTT+GTGGTATG NW_026963743.1 1 Processed 57000000 sequence pairs so far Processed 58000000 sequence pairs so far Processed 59000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2310:36792:28217_1:N:0:CGGTTGTT+GTGGTATG NW_026963730.1 26746 Processed 60000000 sequence pairs so far Processed 61000000 sequence pairs so far Processed 62000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2332:43517:25682_1:N:0:CGGTTGTT+GTGGTATG NW_026963743.1 1 Processed 63000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2348:7498:27068_1:N:0:CGGTTGTT+GTGGTATG NW_026963299.1 2 Processed 64000000 sequence pairs so far Processed 65000000 sequence pairs so far Processed 66000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2374:36541:28904_1:N:0:CGGTTGTT+GTGGTATG NW_026963415.1 1 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2374:36549:28918_1:N:0:CGGTTGTT+GTGGTATG NW_026963415.1 1 Processed 67000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2394:35780:27727_1:N:0:CGGTTGTT+GTGGTATG NW_026963307.1 124870 Processed 68000000 sequence pairs so far Processed 69000000 sequence pairs so far Processed 70000000 sequence pairs so far Processed 71000000 sequence pairs so far Processed 72000000 sequence pairs so far Processed 73000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2463:46414:4306_1:N:0:CGGTTGTT+GTGGTATG NW_026963784.1 24900 Processed 74000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2474:18787:3353_1:N:0:CGGTTGTT+GTGGTATG NW_026963415.1 1 Processed 75000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2484:34146:6127_1:N:0:CGGTTGTT+GTGGTATG NW_026963415.1 2 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2484:34154:6141_1:N:0:CGGTTGTT+GTGGTATG NW_026963415.1 2 Processed 76000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2490:47506:7598_1:N:0:CGGTTGTT+GTGGTATG NW_026963312.1 1 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2495:13794:14405_1:N:0:CGGTTGTT+GTGGTATG NW_026963743.1 1 Processed 77000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:1105:29986:13131_1:N:0:CGGTTGTT+GTGGTATG NW_026963730.1 26747 Processed 78000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:1192:36598:28021_1:N:0:CGGTTGTT+GTGGTATG NW_026963415.1 1 Processed 79000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:1202:38953:21816_1:N:0:CGGTTGTT+GTGGTATG NW_026963767.1 1 Processed 80000000 sequence pairs so far Processed 81000000 sequence pairs so far Processed 82000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:1371:10039:4992_1:N:0:CGGTTGTT+GTGGTATG NW_026963309.1 1 Processed 83000000 sequence pairs so far Processed 84000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:2131:4520:19364_1:N:0:CGGTTGTT+GTGGTATG NC_086377.1 88128928 Processed 85000000 sequence pairs so far Processed 86000000 sequence pairs so far Processed 87000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:2276:19167:1210_1:N:0:CGGTTGTT+GTGGTATG NW_026963677.1 25152 Processed 88000000 sequence pairs so far Processed 89000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:2419:48412:29534_1:N:0:CGGTTGTT+GTGGTATG NW_026963372.1 501114 Processed 90000000 sequence pairs so far Processed 91000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:2494:2432:11548_1:N:0:CGGTTGTT+GTGGTATG NW_026963500.1 2 91219204 reads; of these: 91219204 (100.00%) were paired; of these: 90973954 (99.73%) aligned concordantly 0 times 114620 (0.13%) aligned concordantly exactly 1 time 130630 (0.14%) aligned concordantly >1 times 0.27% overall alignment rate 91219204 reads; of these: 91219204 (100.00%) were paired; of these: 47368171 (51.93%) aligned concordantly 0 times 16975905 (18.61%) aligned concordantly exactly 1 time 26875128 (29.46%) aligned concordantly >1 times 48.07% overall alignment rate 91219204 reads; of these: 91219204 (100.00%) were paired; of these: 90966979 (99.72%) aligned concordantly 0 times 117796 (0.13%) aligned concordantly exactly 1 time 134429 (0.15%) aligned concordantly >1 times 0.28% overall alignment rate 91219204 reads; of these: 91219204 (100.00%) were paired; of these: 47333068 (51.89%) aligned concordantly 0 times 16991337 (18.63%) aligned concordantly exactly 1 time 26894799 (29.48%) aligned concordantly >1 times 48.11% overall alignment rate Processed 91219204 sequences in total Failed to close filehandle AMBIG_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2641, line 364876816. Failed to close filehandle AMBIG_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2642, line 364876816. Failed to close filehandle UNMAPPED_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2643, line 364876816. Failed to close filehandle UNMAPPED_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2644, line 364876816. Successfully deleted the temporary files 93M_R1.fastp-trim.fq.gz_C_to_T.fastq, 93M_R1.fastp-trim.fq.gz_G_to_A.fastq, 93M_R2.fastp-trim.fq.gz_C_to_T.fastq and 93M_R2.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 91219204 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1894232195 Total methylated C's in CpG context: 25469289 Total methylated C's in CHG context: 2701527 Total methylated C's in CHH context: 13793830 Total methylated C's in Unknown context: 249763 Total unmethylated C's in CpG context: 196109623 Total unmethylated C's in CHG context: 303121205 Total unmethylated C's in CHH context: 1353036721 Total unmethylated C's in Unknown context: 5704557 C methylated in CpG context: 11.5% C methylated in CHG context: 0.9% C methylated in CHH context: 1.0% C methylated in unknown context (CN or CHN): 4.2% Bismark completed in 0d 23h 13m 16s ==================== Bismark run complete ====================