SUMMARISING RUN PARAMETERS ========================= Input filename: SRR6995998.fastq.gz Trimming mode: single-end Trim Galore version: 2.3.0 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence(s): 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_1] 'CGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_2] (user-specified) Maximum trimming error rate: 0.1 Minimum required adapter overlap (stringency): 1 bp Minimum required sequence length single-end: 20 bp Output file will be GZIP compressed Trim Galore 2.3.0 — adapter trimming built in This is cutadapt 4.0 (compatible; for MultiQC backwards compatibility) Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC SRR6995998.fastq.gz Processing reads on 1 core in single-end mode ... === Summary === Total reads processed: 24,792,684 Reads with adapters: 19,028,308 (76.7%) Reads written (passing filters): 24,792,684 (100.0%) Total basepairs processed: 2,504,061,084 bp Quality-trimmed: 162,739,913 bp (6.5%) Total written (filtered): 2,032,975,529 bp (81.2%) === Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 13416900 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Overview of removed sequences length count expect max.err error counts 1 7486492 6198171.0 0 7486492 2 556110 1549542.8 0 556110 3 215204 387385.7 0 215204 4 143385 96846.4 0 143385 5 117335 24211.6 0 117335 6 111101 6052.9 0 111101 7 108116 1513.2 0 108116 8 85776 378.3 0 85776 9 91284 94.6 0 91284 10 88196 23.6 1 88196 11 62520 5.9 1 62520 12 73869 1.5 1 73869 13 63114 0.4 1 63114 14 58843 0.1 1 58843 15 58817 0.0 1 58817 16 54757 0.0 1 54757 17 57823 0.0 1 57823 18 57926 0.0 1 57926 19 27654 0.0 1 27654 20 40056 0.0 2 40056 21 37344 0.0 2 37344 22 33588 0.0 2 33588 23 30235 0.0 2 30235 24 29560 0.0 2 29560 25 27800 0.0 2 27800 26 23926 0.0 2 23926 27 23450 0.0 2 23450 28 24696 0.0 2 24696 29 19777 0.0 2 19777 30 20592 0.0 3 20592 31 13079 0.0 3 13079 32 18177 0.0 3 18177 33 18339 0.0 3 18339 34 14306 0.0 3 14306 35 11227 0.0 3 11227 36 11279 0.0 3 11279 37 11388 0.0 3 11388 38 9163 0.0 3 9163 39 7681 0.0 3 7681 40 8693 0.0 4 8693 41 9369 0.0 4 9369 42 9918 0.0 4 9918 43 6814 0.0 4 6814 44 7187 0.0 4 7187 45 6154 0.0 4 6154 46 5259 0.0 4 5259 47 4355 0.0 4 4355 48 4096 0.0 4 4096 49 3610 0.0 4 3610 50 4397 0.0 5 4397 51 6602 0.0 5 6602 52 5854 0.0 5 5854 53 3856 0.0 5 3856 54 4510 0.0 5 4510 55 4316 0.0 5 4316 56 6306 0.0 5 6306 57 9206 0.0 5 9206 58 10172 0.0 5 10172 59 6145 0.0 5 6145 60 10450 0.0 6 10450 61 13798 0.0 6 13798 62 34753 0.0 6 34753 63 58675 0.0 6 58675 64 20016 0.0 6 20016 65 25770 0.0 6 25770 66 54782 0.0 6 54782 67 178049 0.0 6 178049 68 391246 0.0 6 391246 69 1269821 0.0 6 1269821 70 627796 0.0 7 627796 71 233406 0.0 7 233406 72 81970 0.0 7 81970 73 24147 0.0 7 24147 74 12636 0.0 7 12636 75 7304 0.0 7 7304 76 5793 0.0 7 5793 77 7128 0.0 7 7128 78 7080 0.0 7 7080 79 6696 0.0 7 6696 80 6002 0.0 8 6002 81 5461 0.0 8 5461 82 5230 0.0 8 5230 83 4956 0.0 8 4956 84 4961 0.0 8 4961 85 4812 0.0 8 4812 86 5084 0.0 8 5084 87 5512 0.0 8 5512 88 5143 0.0 8 5143 89 5350 0.0 8 5350 90 5622 0.0 9 5622 91 5963 0.0 9 5963 92 6391 0.0 9 6391 93 6677 0.0 9 6677 94 7356 0.0 9 7356 95 8012 0.0 9 8012 96 9046 0.0 9 9046 97 10207 0.0 9 10207 98 11218 0.0 9 11218 99 13312 0.0 9 13312 100 26518 0.0 10 26518 101 111947 0.0 10 111947 === Adapter 2 === Sequence: CGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 30; Trimmed: 5611408 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-30 bp: 3 Overview of removed sequences length count expect max.err error counts 1 4771978 6198171.0 0 4771978 2 385430 1549542.8 0 385430 3 69715 387385.7 0 69715 4 6478 96846.4 0 6478 5 3849 24211.6 0 3849 6 824 6052.9 0 824 7 239 1513.2 0 239 8 105 378.3 0 105 9 123 94.6 0 123 10 157 23.6 1 157 11 91 5.9 1 91 12 57 1.5 1 57 13 94 0.4 1 94 14 67 0.1 1 67 15 52 0.0 1 52 16 53 0.0 1 53 17 26 0.0 1 26 18 47 0.0 1 47 19 85 0.0 1 85 20 116 0.0 2 116 21 183 0.0 2 183 22 269 0.0 2 269 23 404 0.0 2 404 24 505 0.0 2 505 25 708 0.0 2 708 26 493 0.0 2 493 27 138 0.0 2 138 28 183 0.0 2 183 29 177 0.0 2 177 30 264 0.0 3 264 31 106 0.0 3 106 32 160 0.0 3 160 33 157 0.0 3 157 34 161 0.0 3 161 35 256 0.0 3 256 36 249 0.0 3 249 37 260 0.0 3 260 38 441 0.0 3 441 39 529 0.0 3 529 40 432 0.0 4 432 41 769 0.0 4 769 42 608 0.0 4 608 43 454 0.0 4 454 44 475 0.0 4 475 45 620 0.0 4 620 46 560 0.0 4 560 47 713 0.0 4 713 48 1277 0.0 4 1277 49 1166 0.0 4 1166 50 564 0.0 5 564 51 736 0.0 5 736 52 619 0.0 5 619 53 1725 0.0 5 1725 54 1426 0.0 5 1426 55 2371 0.0 5 2371 56 1928 0.0 5 1928 57 3756 0.0 5 3756 58 5620 0.0 5 5620 59 9191 0.0 5 9191 60 8312 0.0 6 8312 61 3516 0.0 6 3516 62 7678 0.0 6 7678 63 11352 0.0 6 11352 64 37658 0.0 6 37658 65 40227 0.0 6 40227 66 113910 0.0 6 113910 67 32095 0.0 6 32095 68 20655 0.0 6 20655 69 9461 0.0 6 9461 70 4372 0.0 7 4372 71 2481 0.0 7 2481 72 1534 0.0 7 1534 73 1116 0.0 7 1116 74 852 0.0 7 852 75 661 0.0 7 661 76 413 0.0 7 413 77 452 0.0 7 452 78 487 0.0 7 487 79 506 0.0 7 506 80 494 0.0 8 494 81 488 0.0 8 488 82 449 0.0 8 449 83 451 0.0 8 451 84 504 0.0 8 504 85 535 0.0 8 535 86 652 0.0 8 652 87 668 0.0 8 668 88 543 0.0 8 543 89 605 0.0 8 605 90 681 0.0 9 681 91 745 0.0 9 745 92 768 0.0 9 768 93 837 0.0 9 837 94 919 0.0 9 919 95 1052 0.0 9 1052 96 1162 0.0 9 1162 97 1375 0.0 9 1375 98 2000 0.0 9 2000 99 1607 0.0 9 1607 100 3294 0.0 10 3294 101 13602 0.0 10 13602 RUN STATISTICS FOR INPUT FILE: SRR6995998.fastq.gz ============================================= 24792684 sequences processed in total Sequences removed because they became shorter than the length cutoff of 20 bp: 3857925 (15.6%) Sequences removed because they were longer than the upper length cutoff: 0 (0.0%) Sequences removed because of too many N bases: 0 (0.0%)