SUMMARISING RUN PARAMETERS ========================= Input filename: SRR6995997.fastq.gz Trimming mode: single-end Trim Galore version: 2.3.0 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence(s): 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_1] 'CGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_2] (user-specified) Maximum trimming error rate: 0.1 Minimum required adapter overlap (stringency): 1 bp Minimum required sequence length single-end: 20 bp Output file will be GZIP compressed Trim Galore 2.3.0 — adapter trimming built in This is cutadapt 4.0 (compatible; for MultiQC backwards compatibility) Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC SRR6995997.fastq.gz Processing reads on 1 core in single-end mode ... === Summary === Total reads processed: 17,327,210 Reads with adapters: 14,067,454 (81.2%) Reads written (passing filters): 17,327,210 (100.0%) Total basepairs processed: 1,750,048,210 bp Quality-trimmed: 185,921,084 bp (10.6%) Total written (filtered): 1,182,889,155 bp (67.6%) === Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 9977651 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Overview of removed sequences length count expect max.err error counts 1 3252026 4331802.5 0 3252026 2 449655 1082950.6 0 449655 3 172568 270737.7 0 172568 4 132079 67684.4 0 132079 5 111305 16921.1 0 111305 6 111456 4230.3 0 111456 7 118453 1057.6 0 118453 8 75329 264.4 0 75329 9 81858 66.1 0 81858 10 91307 16.5 1 91307 11 49323 4.1 1 49323 12 73628 1.0 1 73628 13 53609 0.3 1 53609 14 53562 0.1 1 53562 15 50759 0.0 1 50759 16 45152 0.0 1 45152 17 49020 0.0 1 49020 18 48805 0.0 1 48805 19 20362 0.0 1 20362 20 32875 0.0 2 32875 21 29023 0.0 2 29023 22 32581 0.0 2 32581 23 18936 0.0 2 18936 24 20836 0.0 2 20836 25 21577 0.0 2 21577 26 17855 0.0 2 17855 27 18897 0.0 2 18897 28 22186 0.0 2 22186 29 13481 0.0 2 13481 30 17066 0.0 3 17066 31 8888 0.0 3 8888 32 16088 0.0 3 16088 33 12222 0.0 3 12222 34 12439 0.0 3 12439 35 9040 0.0 3 9040 36 15582 0.0 3 15582 37 11827 0.0 3 11827 38 10325 0.0 3 10325 39 4430 0.0 3 4430 40 9519 0.0 4 9519 41 8180 0.0 4 8180 42 9447 0.0 4 9447 43 6580 0.0 4 6580 44 5530 0.0 4 5530 45 4661 0.0 4 4661 46 4700 0.0 4 4700 47 3956 0.0 4 3956 48 3840 0.0 4 3840 49 4285 0.0 4 4285 50 5322 0.0 5 5322 51 6241 0.0 5 6241 52 6212 0.0 5 6212 53 4584 0.0 5 4584 54 5092 0.0 5 5092 55 5077 0.0 5 5077 56 6469 0.0 5 6469 57 10072 0.0 5 10072 58 10268 0.0 5 10268 59 7094 0.0 5 7094 60 11779 0.0 6 11779 61 16382 0.0 6 16382 62 41551 0.0 6 41551 63 73734 0.0 6 73734 64 25625 0.0 6 25625 65 32587 0.0 6 32587 66 72657 0.0 6 72657 67 244688 0.0 6 244688 68 538898 0.0 6 538898 69 1756160 0.0 6 1756160 70 802236 0.0 7 802236 71 301482 0.0 7 301482 72 109475 0.0 7 109475 73 32612 0.0 7 32612 74 16673 0.0 7 16673 75 9564 0.0 7 9564 76 7558 0.0 7 7558 77 9633 0.0 7 9633 78 9647 0.0 7 9647 79 8936 0.0 7 8936 80 7841 0.0 8 7841 81 7131 0.0 8 7131 82 6969 0.0 8 6969 83 6711 0.0 8 6711 84 6367 0.0 8 6367 85 6459 0.0 8 6459 86 6596 0.0 8 6596 87 7189 0.0 8 7189 88 6928 0.0 8 6928 89 6865 0.0 8 6865 90 7448 0.0 9 7448 91 7508 0.0 9 7508 92 8086 0.0 9 8086 93 8513 0.0 9 8513 94 9509 0.0 9 9509 95 9793 0.0 9 9793 96 11536 0.0 9 11536 97 12688 0.0 9 12688 98 14017 0.0 9 14017 99 16416 0.0 9 16416 100 32960 0.0 10 32960 101 134705 0.0 10 134705 === Adapter 2 === Sequence: CGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 30; Trimmed: 4089803 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-30 bp: 3 Overview of removed sequences length count expect max.err error counts 1 3126854 4331802.5 0 3126854 2 459270 1082950.6 0 459270 3 74011 270737.7 0 74011 4 6487 67684.4 0 6487 5 3457 16921.1 0 3457 6 785 4230.3 0 785 7 260 1057.6 0 260 8 95 264.4 0 95 9 87 66.1 0 87 10 94 16.5 1 94 11 58 4.1 1 58 12 40 1.0 1 40 13 59 0.3 1 59 14 47 0.1 1 47 15 31 0.0 1 31 16 35 0.0 1 35 17 14 0.0 1 14 18 38 0.0 1 38 19 46 0.0 1 46 20 64 0.0 2 64 21 86 0.0 2 86 22 150 0.0 2 150 23 474 0.0 2 474 24 471 0.0 2 471 25 570 0.0 2 570 26 334 0.0 2 334 27 99 0.0 2 99 28 118 0.0 2 118 29 148 0.0 2 148 30 145 0.0 3 145 31 143 0.0 3 143 32 175 0.0 3 175 33 344 0.0 3 344 34 215 0.0 3 215 35 103 0.0 3 103 36 177 0.0 3 177 37 166 0.0 3 166 38 296 0.0 3 296 39 297 0.0 3 297 40 254 0.0 4 254 41 381 0.0 4 381 42 349 0.0 4 349 43 227 0.0 4 227 44 300 0.0 4 300 45 362 0.0 4 362 46 320 0.0 4 320 47 560 0.0 4 560 48 931 0.0 4 931 49 1194 0.0 4 1194 50 514 0.0 5 514 51 662 0.0 5 662 52 581 0.0 5 581 53 1576 0.0 5 1576 54 1302 0.0 5 1302 55 2240 0.0 5 2240 56 1683 0.0 5 1683 57 3279 0.0 5 3279 58 5477 0.0 5 5477 59 9576 0.0 5 9576 60 8856 0.0 6 8856 61 3587 0.0 6 3587 62 6965 0.0 6 6965 63 10354 0.0 6 10354 64 38377 0.0 6 38377 65 47284 0.0 6 47284 66 141388 0.0 6 141388 67 36210 0.0 6 36210 68 23528 0.0 6 23528 69 10753 0.0 6 10753 70 6885 0.0 7 6885 71 3048 0.0 7 3048 72 1850 0.0 7 1850 73 1372 0.0 7 1372 74 1027 0.0 7 1027 75 825 0.0 7 825 76 492 0.0 7 492 77 502 0.0 7 502 78 517 0.0 7 517 79 565 0.0 7 565 80 590 0.0 8 590 81 573 0.0 8 573 82 553 0.0 8 553 83 649 0.0 8 649 84 589 0.0 8 589 85 648 0.0 8 648 86 683 0.0 8 683 87 745 0.0 8 745 88 731 0.0 8 731 89 702 0.0 8 702 90 797 0.0 9 797 91 834 0.0 9 834 92 912 0.0 9 912 93 962 0.0 9 962 94 1085 0.0 9 1085 95 1155 0.0 9 1155 96 1331 0.0 9 1331 97 1554 0.0 9 1554 98 2187 0.0 9 2187 99 1707 0.0 9 1707 100 3516 0.0 10 3516 101 14804 0.0 10 14804 RUN STATISTICS FOR INPUT FILE: SRR6995997.fastq.gz ============================================= 17327210 sequences processed in total Sequences removed because they became shorter than the length cutoff of 20 bp: 5005578 (28.9%) Sequences removed because they were longer than the upper length cutoff: 0 (0.0%) Sequences removed because of too many N bases: 0 (0.0%)