SUMMARISING RUN PARAMETERS ========================= Input filename: SRR6995996.fastq.gz Trimming mode: single-end Trim Galore version: 2.3.0 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence(s): 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_1] 'CGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_2] (user-specified) Maximum trimming error rate: 0.1 Minimum required adapter overlap (stringency): 1 bp Minimum required sequence length single-end: 20 bp Output file will be GZIP compressed Trim Galore 2.3.0 — adapter trimming built in This is cutadapt 4.0 (compatible; for MultiQC backwards compatibility) Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC SRR6995996.fastq.gz Processing reads on 1 core in single-end mode ... === Summary === Total reads processed: 33,409,414 Reads with adapters: 24,776,890 (74.2%) Reads written (passing filters): 33,409,414 (100.0%) Total basepairs processed: 3,374,350,814 bp Quality-trimmed: 220,159,975 bp (6.5%) Total written (filtered): 2,764,429,417 bp (81.9%) === Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 17376713 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Overview of removed sequences length count expect max.err error counts 1 9511604 8352353.5 0 9511604 2 854146 2088088.4 0 854146 3 321485 522022.1 0 321485 4 208468 130505.5 0 208468 5 155787 32626.4 0 155787 6 149530 8156.6 0 149530 7 150206 2039.1 0 150206 8 111825 509.8 0 111825 9 120865 127.4 0 120865 10 119949 31.9 1 119949 11 82378 8.0 1 82378 12 101651 2.0 1 101651 13 82550 0.5 1 82550 14 79643 0.1 1 79643 15 79716 0.0 1 79716 16 70589 0.0 1 70589 17 77161 0.0 1 77161 18 76378 0.0 1 76378 19 37656 0.0 1 37656 20 52739 0.0 2 52739 21 48377 0.0 2 48377 22 50793 0.0 2 50793 23 35072 0.0 2 35072 24 35173 0.0 2 35173 25 35651 0.0 2 35651 26 29053 0.0 2 29053 27 30615 0.0 2 30615 28 35054 0.0 2 35054 29 21892 0.0 2 21892 30 27129 0.0 3 27129 31 13006 0.0 3 13006 32 22567 0.0 3 22567 33 21811 0.0 3 21811 34 20137 0.0 3 20137 35 15103 0.0 3 15103 36 12496 0.0 3 12496 37 14795 0.0 3 14795 38 14952 0.0 3 14952 39 11073 0.0 3 11073 40 12985 0.0 4 12985 41 11309 0.0 4 11309 42 11654 0.0 4 11654 43 8555 0.0 4 8555 44 8605 0.0 4 8605 45 7567 0.0 4 7567 46 6497 0.0 4 6497 47 6195 0.0 4 6195 48 5302 0.0 4 5302 49 4862 0.0 4 4862 50 6489 0.0 5 6489 51 8922 0.0 5 8922 52 8353 0.0 5 8353 53 5735 0.0 5 5735 54 6756 0.0 5 6756 55 6426 0.0 5 6426 56 8400 0.0 5 8400 57 12846 0.0 5 12846 58 13900 0.0 5 13900 59 9494 0.0 5 9494 60 15948 0.0 6 15948 61 21282 0.0 6 21282 62 51992 0.0 6 51992 63 91354 0.0 6 91354 64 29311 0.0 6 29311 65 36969 0.0 6 36969 66 78577 0.0 6 78577 67 252354 0.0 6 252354 68 532520 0.0 6 532520 69 1555991 0.0 6 1555991 70 752046 0.0 7 752046 71 297947 0.0 7 297947 72 111007 0.0 7 111007 73 33617 0.0 7 33617 74 17420 0.0 7 17420 75 9858 0.0 7 9858 76 8024 0.0 7 8024 77 10452 0.0 7 10452 78 10122 0.0 7 10122 79 9470 0.0 7 9470 80 8146 0.0 8 8146 81 7328 0.0 8 7328 82 7039 0.0 8 7039 83 6367 0.0 8 6367 84 6031 0.0 8 6031 85 6159 0.0 8 6159 86 6514 0.0 8 6514 87 6958 0.0 8 6958 88 6535 0.0 8 6535 89 6596 0.0 8 6596 90 7087 0.0 9 7087 91 7480 0.0 9 7480 92 7790 0.0 9 7790 93 8247 0.0 9 8247 94 8897 0.0 9 8897 95 9814 0.0 9 9814 96 11237 0.0 9 11237 97 12507 0.0 9 12507 98 13970 0.0 9 13970 99 16260 0.0 9 16260 100 32934 0.0 10 32934 101 136629 0.0 10 136629 === Adapter 2 === Sequence: CGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 30; Trimmed: 7400177 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-30 bp: 3 Overview of removed sequences length count expect max.err error counts 1 6131004 8352353.5 0 6131004 2 723009 2088088.4 0 723009 3 126430 522022.1 0 126430 4 13151 130505.5 0 13151 5 6662 32626.4 0 6662 6 1466 8156.6 0 1466 7 444 2039.1 0 444 8 149 509.8 0 149 9 179 127.4 0 179 10 168 31.9 1 168 11 110 8.0 1 110 12 86 2.0 1 86 13 84 0.5 1 84 14 94 0.1 1 94 15 65 0.0 1 65 16 75 0.0 1 75 17 48 0.0 1 48 18 106 0.0 1 106 19 91 0.0 1 91 20 152 0.0 2 152 21 179 0.0 2 179 22 250 0.0 2 250 23 627 0.0 2 627 24 720 0.0 2 720 25 877 0.0 2 877 26 574 0.0 2 574 27 158 0.0 2 158 28 280 0.0 2 280 29 324 0.0 2 324 30 276 0.0 3 276 31 283 0.0 3 283 32 245 0.0 3 245 33 239 0.0 3 239 34 441 0.0 3 441 35 407 0.0 3 407 36 379 0.0 3 379 37 341 0.0 3 341 38 461 0.0 3 461 39 523 0.0 3 523 40 450 0.0 4 450 41 864 0.0 4 864 42 810 0.0 4 810 43 483 0.0 4 483 44 487 0.0 4 487 45 684 0.0 4 684 46 653 0.0 4 653 47 936 0.0 4 936 48 1615 0.0 4 1615 49 1574 0.0 4 1574 50 662 0.0 5 662 51 899 0.0 5 899 52 709 0.0 5 709 53 2051 0.0 5 2051 54 1718 0.0 5 1718 55 2906 0.0 5 2906 56 2116 0.0 5 2116 57 4011 0.0 5 4011 58 6542 0.0 5 6542 59 11697 0.0 5 11697 60 10604 0.0 6 10604 61 3913 0.0 6 3913 62 7115 0.0 6 7115 63 11025 0.0 6 11025 64 35388 0.0 6 35388 65 42645 0.0 6 42645 66 120953 0.0 6 120953 67 33122 0.0 6 33122 68 21011 0.0 6 21011 69 10158 0.0 6 10158 70 6612 0.0 7 6612 71 2898 0.0 7 2898 72 1769 0.0 7 1769 73 1309 0.0 7 1309 74 1028 0.0 7 1028 75 732 0.0 7 732 76 458 0.0 7 458 77 500 0.0 7 500 78 542 0.0 7 542 79 514 0.0 7 514 80 571 0.0 8 571 81 511 0.0 8 511 82 521 0.0 8 521 83 495 0.0 8 495 84 510 0.0 8 510 85 599 0.0 8 599 86 617 0.0 8 617 87 632 0.0 8 632 88 643 0.0 8 643 89 634 0.0 8 634 90 694 0.0 9 694 91 786 0.0 9 786 92 854 0.0 9 854 93 918 0.0 9 918 94 954 0.0 9 954 95 1045 0.0 9 1045 96 1239 0.0 9 1239 97 1438 0.0 9 1438 98 2124 0.0 9 2124 99 1674 0.0 9 1674 100 3341 0.0 10 3341 101 14057 0.0 10 14057 RUN STATISTICS FOR INPUT FILE: SRR6995996.fastq.gz ============================================= 33409414 sequences processed in total Sequences removed because they became shorter than the length cutoff of 20 bp: 4885495 (14.6%) Sequences removed because they were longer than the upper length cutoff: 0 (0.0%) Sequences removed because of too many N bases: 0 (0.0%)