SUMMARISING RUN PARAMETERS ========================= Input filename: SRR6995995.fastq.gz Trimming mode: single-end Trim Galore version: 2.3.0 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence(s): 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_1] 'CGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_2] (user-specified) Maximum trimming error rate: 0.1 Minimum required adapter overlap (stringency): 1 bp Minimum required sequence length single-end: 20 bp Output file will be GZIP compressed Trim Galore 2.3.0 — adapter trimming built in This is cutadapt 4.0 (compatible; for MultiQC backwards compatibility) Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC SRR6995995.fastq.gz Processing reads on 1 core in single-end mode ... === Summary === Total reads processed: 39,780,221 Reads with adapters: 31,777,024 (79.9%) Reads written (passing filters): 39,780,221 (100.0%) Total basepairs processed: 4,017,802,321 bp Quality-trimmed: 316,184,920 bp (7.9%) Total written (filtered): 3,031,368,786 bp (75.4%) === Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 23284278 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Overview of removed sequences length count expect max.err error counts 1 9885198 9945055.2 0 9885198 2 906583 2486263.8 0 906583 3 448730 621566.0 0 448730 4 348682 155391.5 0 348682 5 305027 38847.9 0 305027 6 286626 9712.0 0 286626 7 280758 2428.0 0 280758 8 223039 607.0 0 223039 9 239670 151.7 0 239670 10 226886 37.9 1 226886 11 163610 9.5 1 163610 12 191510 2.4 1 191510 13 161605 0.6 1 161605 14 154050 0.1 1 154050 15 154568 0.0 1 154568 16 135096 0.0 1 135096 17 148185 0.0 1 148185 18 139549 0.0 1 139549 19 77067 0.0 1 77067 20 100514 0.0 2 100514 21 92509 0.0 2 92509 22 92047 0.0 2 92047 23 71725 0.0 2 71725 24 71623 0.0 2 71623 25 69812 0.0 2 69812 26 58527 0.0 2 58527 27 59794 0.0 2 59794 28 68784 0.0 2 68784 29 44332 0.0 2 44332 30 56176 0.0 3 56176 31 27036 0.0 3 27036 32 45492 0.0 3 45492 33 40641 0.0 3 40641 34 34679 0.0 3 34679 35 33062 0.0 3 33062 36 30596 0.0 3 30596 37 25725 0.0 3 25725 38 23106 0.0 3 23106 39 19625 0.0 3 19625 40 19912 0.0 4 19912 41 18890 0.0 4 18890 42 19791 0.0 4 19791 43 16285 0.0 4 16285 44 17782 0.0 4 17782 45 15921 0.0 4 15921 46 13140 0.0 4 13140 47 11820 0.0 4 11820 48 11217 0.0 4 11217 49 10766 0.0 4 10766 50 11395 0.0 5 11395 51 17262 0.0 5 17262 52 15757 0.0 5 15757 53 10375 0.0 5 10375 54 11992 0.0 5 11992 55 11030 0.0 5 11030 56 15734 0.0 5 15734 57 23107 0.0 5 23107 58 25324 0.0 5 25324 59 14950 0.0 5 14950 60 24193 0.0 6 24193 61 30818 0.0 6 30818 62 92690 0.0 6 92690 63 131772 0.0 6 131772 64 37716 0.0 6 37716 65 48790 0.0 6 48790 66 108300 0.0 6 108300 67 362882 0.0 6 362882 68 825193 0.0 6 825193 69 2679481 0.0 6 2679481 70 1537802 0.0 7 1537802 71 573697 0.0 7 573697 72 205701 0.0 7 205701 73 60416 0.0 7 60416 74 29971 0.0 7 29971 75 17108 0.0 7 17108 76 13669 0.0 7 13669 77 18026 0.0 7 18026 78 17496 0.0 7 17496 79 16248 0.0 7 16248 80 14376 0.0 8 14376 81 12409 0.0 8 12409 82 11967 0.0 8 11967 83 11048 0.0 8 11048 84 10729 0.0 8 10729 85 10992 0.0 8 10992 86 11379 0.0 8 11379 87 12130 0.0 8 12130 88 11558 0.0 8 11558 89 11831 0.0 8 11831 90 12583 0.0 9 12583 91 13227 0.0 9 13227 92 13983 0.0 9 13983 93 14638 0.0 9 14638 94 16073 0.0 9 16073 95 17365 0.0 9 17365 96 20085 0.0 9 20085 97 22148 0.0 9 22148 98 24750 0.0 9 24750 99 28465 0.0 9 28465 100 57898 0.0 10 57898 101 237981 0.0 10 237981 === Adapter 2 === Sequence: CGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 30; Trimmed: 8492746 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-30 bp: 3 Overview of removed sequences length count expect max.err error counts 1 6930389 9945055.2 0 6930389 2 797808 2486263.8 0 797808 3 100905 621566.0 0 100905 4 12257 155391.5 0 12257 5 7094 38847.9 0 7094 6 1237 9712.0 0 1237 7 435 2428.0 0 435 8 137 607.0 0 137 9 140 151.7 0 140 10 142 37.9 1 142 11 100 9.5 1 100 12 88 2.4 1 88 13 118 0.6 1 118 14 87 0.1 1 87 15 67 0.0 1 67 16 82 0.0 1 82 17 45 0.0 1 45 18 54 0.0 1 54 19 83 0.0 1 83 20 136 0.0 2 136 21 210 0.0 2 210 22 298 0.0 2 298 23 822 0.0 2 822 24 932 0.0 2 932 25 1057 0.0 2 1057 26 755 0.0 2 755 27 182 0.0 2 182 28 263 0.0 2 263 29 345 0.0 2 345 30 408 0.0 3 408 31 245 0.0 3 245 32 351 0.0 3 351 33 316 0.0 3 316 34 281 0.0 3 281 35 315 0.0 3 315 36 275 0.0 3 275 37 312 0.0 3 312 38 453 0.0 3 453 39 755 0.0 3 755 40 660 0.0 4 660 41 1422 0.0 4 1422 42 1081 0.0 4 1081 43 646 0.0 4 646 44 795 0.0 4 795 45 1081 0.0 4 1081 46 895 0.0 4 895 47 1132 0.0 4 1132 48 2398 0.0 4 2398 49 2888 0.0 4 2888 50 1138 0.0 5 1138 51 1475 0.0 5 1475 52 1193 0.0 5 1193 53 3500 0.0 5 3500 54 2798 0.0 5 2798 55 4722 0.0 5 4722 56 3137 0.0 5 3137 57 6053 0.0 5 6053 58 9204 0.0 5 9204 59 17166 0.0 5 17166 60 12923 0.0 6 12923 61 4589 0.0 6 4589 62 9290 0.0 6 9290 63 14976 0.0 6 14976 64 54543 0.0 6 54543 65 68466 0.0 6 68466 66 199741 0.0 6 199741 67 62312 0.0 6 62312 68 40320 0.0 6 40320 69 18475 0.0 6 18475 70 11165 0.0 7 11165 71 4885 0.0 7 4885 72 2938 0.0 7 2938 73 2086 0.0 7 2086 74 1603 0.0 7 1603 75 1248 0.0 7 1248 76 739 0.0 7 739 77 841 0.0 7 841 78 920 0.0 7 920 79 865 0.0 7 865 80 910 0.0 8 910 81 829 0.0 8 829 82 849 0.0 8 849 83 815 0.0 8 815 84 897 0.0 8 897 85 863 0.0 8 863 86 1022 0.0 8 1022 87 1108 0.0 8 1108 88 1120 0.0 8 1120 89 1153 0.0 8 1153 90 1225 0.0 9 1225 91 1263 0.0 9 1263 92 1374 0.0 9 1374 93 1425 0.0 9 1425 94 1673 0.0 9 1673 95 1756 0.0 9 1756 96 1901 0.0 9 1901 97 2324 0.0 9 2324 98 3336 0.0 9 3336 99 2690 0.0 9 2690 100 5262 0.0 10 5262 101 22663 0.0 10 22663 RUN STATISTICS FOR INPUT FILE: SRR6995995.fastq.gz ============================================= 39780221 sequences processed in total Sequences removed because they became shorter than the length cutoff of 20 bp: 8339270 (21.0%) Sequences removed because they were longer than the upper length cutoff: 0 (0.0%) Sequences removed because of too many N bases: 0 (0.0%)