SUMMARISING RUN PARAMETERS ========================= Input filename: SRR6995994.fastq.gz Trimming mode: single-end Trim Galore version: 2.3.0 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence(s): 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_1] 'CGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_2] (user-specified) Maximum trimming error rate: 0.1 Minimum required adapter overlap (stringency): 1 bp Minimum required sequence length single-end: 20 bp Output file will be GZIP compressed Trim Galore 2.3.0 — adapter trimming built in This is cutadapt 4.0 (compatible; for MultiQC backwards compatibility) Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC SRR6995994.fastq.gz Processing reads on 1 core in single-end mode ... === Summary === Total reads processed: 9,188,940 Reads with adapters: 8,607,160 (93.7%) Reads written (passing filters): 9,188,940 (100.0%) Total basepairs processed: 928,082,940 bp Quality-trimmed: 208,253,890 bp (22.4%) Total written (filtered): 251,737,671 bp (27.1%) === Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 7439952 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Overview of removed sequences length count expect max.err error counts 1 347934 2297235.0 0 347934 2 125307 574308.8 0 125307 3 45297 143577.2 0 45297 4 40566 35894.3 0 40566 5 36746 8973.6 0 36746 6 40795 2243.4 0 40795 7 47574 560.8 0 47574 8 28252 140.2 0 28252 9 33695 35.1 0 33695 10 40547 8.8 1 40547 11 20912 2.2 1 20912 12 38464 0.5 1 38464 13 27295 0.1 1 27295 14 29768 0.0 1 29768 15 30445 0.0 1 30445 16 33557 0.0 1 33557 17 31075 0.0 1 31075 18 36248 0.0 1 36248 19 16267 0.0 1 16267 20 27107 0.0 2 27107 21 26911 0.0 2 26911 22 29189 0.0 2 29189 23 19910 0.0 2 19910 24 23461 0.0 2 23461 25 26693 0.0 2 26693 26 20628 0.0 2 20628 27 24206 0.0 2 24206 28 29395 0.0 2 29395 29 20660 0.0 2 20660 30 26282 0.0 3 26282 31 11838 0.0 3 11838 32 25359 0.0 3 25359 33 21055 0.0 3 21055 34 22811 0.0 3 22811 35 17850 0.0 3 17850 36 20524 0.0 3 20524 37 17720 0.0 3 17720 38 14725 0.0 3 14725 39 28328 0.0 3 28328 40 20944 0.0 4 20944 41 22551 0.0 4 22551 42 19911 0.0 4 19911 43 16323 0.0 4 16323 44 19157 0.0 4 19157 45 17065 0.0 4 17065 46 13603 0.0 4 13603 47 11823 0.0 4 11823 48 10787 0.0 4 10787 49 10449 0.0 4 10449 50 10791 0.0 5 10791 51 16404 0.0 5 16404 52 15229 0.0 5 15229 53 10085 0.0 5 10085 54 10747 0.0 5 10747 55 9561 0.0 5 9561 56 14401 0.0 5 14401 57 19383 0.0 5 19383 58 20471 0.0 5 20471 59 11855 0.0 5 11855 60 18716 0.0 6 18716 61 24039 0.0 6 24039 62 72662 0.0 6 72662 63 99768 0.0 6 99768 64 27713 0.0 6 27713 65 35364 0.0 6 35364 66 79764 0.0 6 79764 67 263320 0.0 6 263320 68 615433 0.0 6 615433 69 2019856 0.0 6 2019856 70 1183447 0.0 7 1183447 71 460639 0.0 7 460639 72 165385 0.0 7 165385 73 47645 0.0 7 47645 74 23096 0.0 7 23096 75 12982 0.0 7 12982 76 10596 0.0 7 10596 77 14072 0.0 7 14072 78 13616 0.0 7 13616 79 12458 0.0 7 12458 80 10898 0.0 8 10898 81 9525 0.0 8 9525 82 9000 0.0 8 9000 83 8158 0.0 8 8158 84 7965 0.0 8 7965 85 8036 0.0 8 8036 86 8417 0.0 8 8417 87 8856 0.0 8 8856 88 8481 0.0 8 8481 89 8698 0.0 8 8698 90 9063 0.0 9 9063 91 9542 0.0 9 9542 92 10159 0.0 9 10159 93 10725 0.0 9 10725 94 11784 0.0 9 11784 95 12510 0.0 9 12510 96 14251 0.0 9 14251 97 16124 0.0 9 16124 98 17814 0.0 9 17814 99 20616 0.0 9 20616 100 41429 0.0 10 41429 101 170394 0.0 10 170394 === Adapter 2 === Sequence: CGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 30; Trimmed: 1167208 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-30 bp: 3 Overview of removed sequences length count expect max.err error counts 1 504853 2297235.0 0 504853 2 140389 574308.8 0 140389 3 36452 143577.2 0 36452 4 2216 35894.3 0 2216 5 1247 8973.6 0 1247 6 218 2243.4 0 218 7 62 560.8 0 62 8 30 140.2 0 30 9 35 35.1 0 35 10 33 8.8 1 33 11 41 2.2 1 41 12 32 0.5 1 32 13 46 0.1 1 46 14 35 0.0 1 35 15 59 0.0 1 59 16 57 0.0 1 57 17 30 0.0 1 30 18 36 0.0 1 36 19 62 0.0 1 62 20 99 0.0 2 99 21 130 0.0 2 130 22 188 0.0 2 188 23 549 0.0 2 549 24 517 0.0 2 517 25 651 0.0 2 651 26 447 0.0 2 447 27 122 0.0 2 122 28 128 0.0 2 128 29 185 0.0 2 185 30 213 0.0 3 213 31 208 0.0 3 208 32 140 0.0 3 140 33 206 0.0 3 206 34 228 0.0 3 228 35 211 0.0 3 211 36 542 0.0 3 542 37 468 0.0 3 468 38 712 0.0 3 712 39 782 0.0 3 782 40 688 0.0 4 688 41 1722 0.0 4 1722 42 1097 0.0 4 1097 43 626 0.0 4 626 44 727 0.0 4 727 45 900 0.0 4 900 46 760 0.0 4 760 47 970 0.0 4 970 48 2299 0.0 4 2299 49 2522 0.0 4 2522 50 878 0.0 5 878 51 1170 0.0 5 1170 52 934 0.0 5 934 53 2865 0.0 5 2865 54 2145 0.0 5 2145 55 3781 0.0 5 3781 56 2216 0.0 5 2216 57 4339 0.0 5 4339 58 6984 0.0 5 6984 59 13439 0.0 5 13439 60 9614 0.0 6 9614 61 3274 0.0 6 3274 62 6316 0.0 6 6316 63 10139 0.0 6 10139 64 36345 0.0 6 36345 65 49514 0.0 6 49514 66 150199 0.0 6 150199 67 47741 0.0 6 47741 68 32474 0.0 6 32474 69 14839 0.0 6 14839 70 9148 0.0 7 9148 71 3903 0.0 7 3903 72 2306 0.0 7 2306 73 1639 0.0 7 1639 74 1296 0.0 7 1296 75 990 0.0 7 990 76 558 0.0 7 558 77 643 0.0 7 643 78 686 0.0 7 686 79 622 0.0 7 622 80 601 0.0 8 601 81 679 0.0 8 679 82 651 0.0 8 651 83 628 0.0 8 628 84 681 0.0 8 681 85 666 0.0 8 666 86 722 0.0 8 722 87 774 0.0 8 774 88 858 0.0 8 858 89 809 0.0 8 809 90 872 0.0 9 872 91 918 0.0 9 918 92 1040 0.0 9 1040 93 1079 0.0 9 1079 94 1195 0.0 9 1195 95 1278 0.0 9 1278 96 1399 0.0 9 1399 97 1705 0.0 9 1705 98 2418 0.0 9 2418 99 1936 0.0 9 1936 100 3929 0.0 10 3929 101 16403 0.0 10 16403 RUN STATISTICS FOR INPUT FILE: SRR6995994.fastq.gz ============================================= 9188940 sequences processed in total Sequences removed because they became shorter than the length cutoff of 20 bp: 6353595 (69.1%) Sequences removed because they were longer than the upper length cutoff: 0 (0.0%) Sequences removed because of too many N bases: 0 (0.0%)