SUMMARISING RUN PARAMETERS ========================= Input filename: SRR6995993.fastq.gz Trimming mode: single-end Trim Galore version: 2.3.0 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence(s): 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_1] 'CGGAAGAGCACACGTCTGAACTCCAGTCAC' [adapter_2] (user-specified) Maximum trimming error rate: 0.1 Minimum required adapter overlap (stringency): 1 bp Minimum required sequence length single-end: 20 bp Output file will be GZIP compressed Trim Galore 2.3.0 — adapter trimming built in This is cutadapt 4.0 (compatible; for MultiQC backwards compatibility) Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC SRR6995993.fastq.gz Processing reads on 1 core in single-end mode ... === Summary === Total reads processed: 25,752,634 Reads with adapters: 20,647,416 (80.2%) Reads written (passing filters): 25,752,634 (100.0%) Total basepairs processed: 2,601,016,034 bp Quality-trimmed: 168,252,428 bp (6.5%) Total written (filtered): 2,070,178,483 bp (79.6%) === Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 15188714 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Overview of removed sequences length count expect max.err error counts 1 6840739 6438158.5 0 6840739 2 530677 1609539.6 0 530677 3 289871 402384.9 0 289871 4 245414 100596.2 0 245414 5 222181 25149.1 0 222181 6 220611 6287.3 0 220611 7 227506 1571.8 0 227506 8 175902 393.0 0 175902 9 191513 98.2 0 191513 10 196172 24.6 1 196172 11 135292 6.1 1 135292 12 171830 1.5 1 171830 13 142247 0.4 1 142247 14 139284 0.1 1 139284 15 139967 0.0 1 139967 16 127430 0.0 1 127430 17 140656 0.0 1 140656 18 145278 0.0 1 145278 19 61655 0.0 1 61655 20 96917 0.0 2 96917 21 89989 0.0 2 89989 22 85396 0.0 2 85396 23 72523 0.0 2 72523 24 72821 0.0 2 72821 25 65365 0.0 2 65365 26 57306 0.0 2 57306 27 54620 0.0 2 54620 28 59734 0.0 2 59734 29 41312 0.0 2 41312 30 49189 0.0 3 49189 31 24051 0.0 3 24051 32 37710 0.0 3 37710 33 27254 0.0 3 27254 34 30437 0.0 3 30437 35 22886 0.0 3 22886 36 23895 0.0 3 23895 37 19167 0.0 3 19167 38 16416 0.0 3 16416 39 14228 0.0 3 14228 40 12203 0.0 4 12203 41 11025 0.0 4 11025 42 11521 0.0 4 11521 43 9016 0.0 4 9016 44 7892 0.0 4 7892 45 7317 0.0 4 7317 46 6619 0.0 4 6619 47 5116 0.0 4 5116 48 4547 0.0 4 4547 49 4816 0.0 4 4816 50 5410 0.0 5 5410 51 6318 0.0 5 6318 52 6050 0.0 5 6050 53 4495 0.0 5 4495 54 4513 0.0 5 4513 55 4647 0.0 5 4647 56 5950 0.0 5 5950 57 8704 0.0 5 8704 58 9025 0.0 5 9025 59 6348 0.0 5 6348 60 9994 0.0 6 9994 61 13741 0.0 6 13741 62 33871 0.0 6 33871 63 67054 0.0 6 67054 64 22889 0.0 6 22889 65 29156 0.0 6 29156 66 63733 0.0 6 63733 67 211691 0.0 6 211691 68 459702 0.0 6 459702 69 1464926 0.0 6 1464926 70 644065 0.0 7 644065 71 245045 0.0 7 245045 72 89873 0.0 7 89873 73 27596 0.0 7 27596 74 13882 0.0 7 13882 75 8056 0.0 7 8056 76 6363 0.0 7 6363 77 8172 0.0 7 8172 78 8082 0.0 7 8082 79 7352 0.0 7 7352 80 6814 0.0 8 6814 81 6296 0.0 8 6296 82 5932 0.0 8 5932 83 5649 0.0 8 5649 84 5509 0.0 8 5509 85 5684 0.0 8 5684 86 5846 0.0 8 5846 87 6287 0.0 8 6287 88 6080 0.0 8 6080 89 5947 0.0 8 5947 90 6550 0.0 9 6550 91 6879 0.0 9 6879 92 7339 0.0 9 7339 93 7632 0.0 9 7632 94 8212 0.0 9 8212 95 8981 0.0 9 8981 96 10318 0.0 9 10318 97 11326 0.0 9 11326 98 12605 0.0 9 12605 99 14595 0.0 9 14595 100 29743 0.0 10 29743 101 122274 0.0 10 122274 === Adapter 2 === Sequence: CGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 30; Trimmed: 5458702 times. No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-30 bp: 3 Overview of removed sequences length count expect max.err error counts 1 4561156 6438158.5 0 4561156 2 505818 1609539.6 0 505818 3 56794 402384.9 0 56794 4 7031 100596.2 0 7031 5 4090 25149.1 0 4090 6 571 6287.3 0 571 7 268 1571.8 0 268 8 107 393.0 0 107 9 80 98.2 0 80 10 67 24.6 1 67 11 85 6.1 1 85 12 49 1.5 1 49 13 90 0.4 1 90 14 65 0.1 1 65 15 40 0.0 1 40 16 40 0.0 1 40 17 21 0.0 1 21 18 40 0.0 1 40 19 65 0.0 1 65 20 101 0.0 2 101 21 129 0.0 2 129 22 202 0.0 2 202 23 445 0.0 2 445 24 443 0.0 2 443 25 591 0.0 2 591 26 398 0.0 2 398 27 104 0.0 2 104 28 124 0.0 2 124 29 164 0.0 2 164 30 181 0.0 3 181 31 159 0.0 3 159 32 97 0.0 3 97 33 198 0.0 3 198 34 130 0.0 3 130 35 108 0.0 3 108 36 89 0.0 3 89 37 123 0.0 3 123 38 145 0.0 3 145 39 200 0.0 3 200 40 191 0.0 4 191 41 325 0.0 4 325 42 334 0.0 4 334 43 177 0.0 4 177 44 221 0.0 4 221 45 285 0.0 4 285 46 241 0.0 4 241 47 397 0.0 4 397 48 702 0.0 4 702 49 877 0.0 4 877 50 524 0.0 5 524 51 485 0.0 5 485 52 447 0.0 5 447 53 1183 0.0 5 1183 54 1066 0.0 5 1066 55 1779 0.0 5 1779 56 1275 0.0 5 1275 57 2469 0.0 5 2469 58 4157 0.0 5 4157 59 7478 0.0 5 7478 60 7241 0.0 6 7241 61 2922 0.0 6 2922 62 5259 0.0 6 5259 63 7887 0.0 6 7887 64 28601 0.0 6 28601 65 36210 0.0 6 36210 66 108457 0.0 6 108457 67 28099 0.0 6 28099 68 17959 0.0 6 17959 69 8227 0.0 6 8227 70 5141 0.0 7 5141 71 2233 0.0 7 2233 72 1393 0.0 7 1393 73 1003 0.0 7 1003 74 864 0.0 7 864 75 603 0.0 7 603 76 393 0.0 7 393 77 397 0.0 7 397 78 433 0.0 7 433 79 417 0.0 7 417 80 468 0.0 8 468 81 437 0.0 8 437 82 455 0.0 8 455 83 511 0.0 8 511 84 494 0.0 8 494 85 502 0.0 8 502 86 521 0.0 8 521 87 595 0.0 8 595 88 533 0.0 8 533 89 610 0.0 8 610 90 623 0.0 9 623 91 697 0.0 9 697 92 696 0.0 9 696 93 808 0.0 9 808 94 821 0.0 9 821 95 913 0.0 9 913 96 1068 0.0 9 1068 97 1253 0.0 9 1253 98 1778 0.0 9 1778 99 1409 0.0 9 1409 100 2816 0.0 10 2816 101 11734 0.0 10 11734 RUN STATISTICS FOR INPUT FILE: SRR6995993.fastq.gz ============================================= 25752634 sequences processed in total Sequences removed because they became shorter than the length cutoff of 20 bp: 4174194 (16.2%) Sequences removed because they were longer than the upper length cutoff: 0 (0.0%) Sequences removed because of too many N bases: 0 (0.0%)