You are an expert in bioinformatics, sequencing technologies, genomics data analysis, and adjacent fields. You are given findings from a MultiQC report, generated by a bioinformatics workflow. MultiQC supports various bioinformatics tools that output QC metrics, and aggregates those metrics into a single report. It outputs a "General Statistics" table with key metrics for each sample across all tools. That table is followed by more detailed sections from specific tools, that can include tables, as well as plots of different types (bar plot, line plot, scatter plot, heatmap, etc.) You are given data from such a report. Your task is to analyse the data, and give 1-2 bullet points of a very short and concise overall summary for the results. Don't waste words: mention only the important QC issues. If there are no issues, just say so. Just print one or two bullet points, nothing else. Please do not add any extra headers to the response. Use markdown to format your reponse for readability. Use directives with pre-defined classes .text-green, .text-red, and .text-yellow to highlight severity, e.g. :span[39.2%]{.text-red}. Highlight any mentioned sample names or sample named prefixes or suffixes with a sample directive, and make sure to use the same color classes for severity, e.g. :sample[A1001.2003]{.text-yellow} or :sample[A1001]{.text-yellow}. Do not put multiple sample names inside one directive. You must use only multiples of 4 spaces to indent nested lists. Two examples of short summaries: - :span[11/13 samples]{.text-green} show consistent metrics within expected ranges. - :sample[A1001.2003]{.text-red} and :sample[A1001.2004]{.text-red} exhibit extremely high percentage of :span[duplicates]{.text-red} (:span[65.54%]{.text-red} and :span[83.14%]{.text-red}, respectively). - All samples show good quality metrics with :span[75.7-77.0%]{.text-green} CpG methylation and :span[76.3-86.0%]{.text-green} alignment rates - :sample[2wk]{.text-yellow} samples show slightly higher duplication (:span[11-15%]{.text-yellow}) compared to :sample[1wk]{.text-green} samples (:span[6-9%]{.text-green})' ---------------------- Tools used in the report: 1. Trim Galore Description:

Quality and adapter trimming for next-generation sequencing data, with special handling for RRBS libraries.

Links: https://github.com/FelixKrueger/TrimGalore ---------------------- 2. FastQC Description:

Quality control tool for high throughput sequencing data.

Links: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ ---------------------- ---------------------- Tool: Trim Galore Section: Filtered Reads Section description: Number of reads after trimming. Section help text: The passing bucket reflects reads that survived quality trimming, adapter trimming and N-content filtering (i.e. what made it into the trimmed output); the remaining buckets show which filter rejected the rest. Title: Trim Galore: Read Filtering Plot type: bar plot Values: Number of reads |Sample|Passed filters|Too short| |---|---|---| |SRR6995998|20,934,759|3,857,925| |SRR6995997|12,321,632|5,005,578| |SRR6995996|28,523,919|4,885,495| |SRR6995995|31,440,951|8,339,270| |SRR6995994|2,835,345|6,353,595| |SRR6995993|21,578,440|4,174,194| ---------------------- Tool: Trim Galore Section: Adapter Length Distribution Section description: Histogram of adapter match lengths per read. Section help text: Note that a tall left tail at 1 bp is normal: Trim Galore's default --stringency 1 accepts single-base overlaps, which represent random hits rather than real adapter contamination. Title: Trim Galore: Adapter Length Distribution Plot type: x/y line X axis: Adapter overlap length (bp) Y axis: Reads (count) Samples: SRR6995993, SRR6995993 (adapter_1), SRR6995993 (adapter_2), SRR6995994, SRR6995994 (adapter_1), SRR6995994 (adapter_2), SRR6995995, SRR6995995 (adapter_1), SRR6995995 (adapter_2), SRR6995996, SRR6995996 (adapter_1), SRR6995996 (adapter_2), SRR6995997, SRR6995997 (adapter_1), SRR6995997 (adapter_2), SRR6995998, SRR6995998 (adapter_1), SRR6995998 (adapter_2) X values are in bp SRR6995993 1: 7,645,997, 2: 534,343, 3: 291,109, 4: 245,902, 5: 222,809, 6: 221,201, 7: 227,983, 8: 176,189, 9: 191,705, 10: 196,403, 11: 135,410, 12: 172,032, 13: 142,443, 14: 139,453, 15: 140,261, 16: 127,613, 17: 141,045, 18: 145,508, 19: 61,757, 20: 97,023, 21: 90,106, 22: 85,550, 23: 72,642, 24: 72,920, 25: 65,492, 26: 57,563, 27: 54,733, 28: 59,928, 29: 41,393, 30: 49,108, 31: 23,838, 32: 37,226, 33: 26,212, 34: 29,751, 35: 22,545, 36: 23,175, 37: 18,672, 38: 16,053, 39: 13,969, 40: 11,682, 41: 10,476, 42: 10,739, 43: 8,515, 44: 7,287, 45: 6,867, 46: 6,170, 47: 4,626, 48: 4,038, 49: 4,377, 50: 4,703, 51: 5,286, 52: 5,055, 53: 3,891, 54: 3,728, 55: 3,839, 56: 4,944, 57: 7,121, 58: 7,219, 59: 5,116, 60: 7,817, 61: 10,532, 62: 26,665, 63: 53,960, 64: 17,759, 65: 22,284, 66: 49,172, 67: 173,170, 68: 380,144, 69: 1,270,585, 70: 552,214, 71: 201,199, 72: 72,347, 73: 21,280, 74: 11,117, 75: 6,492, 76: 5,119, 77: 6,705, 78: 6,642, 79: 6,064, 80: 5,659, 81: 5,193, 82: 4,999, 83: 4,639, 84: 4,373, 85: 4,621, 86: 4,757, 87: 5,135, 88: 4,925, 89: 4,758, 90: 5,314, 91: 5,626, 92: 5,942, 93: 6,196, 94: 6,672, 95: 7,356, 96: 8,416, 97: 9,216, 98: 10,374, 99: 11,835, 100: 23,941, 101: 99,608 SRR6995993 (adapter_1) 1: 6,840,739, 2: 530,677, 3: 289,871, 4: 245,414, 5: 222,181, 6: 220,611, 7: 227,506, 8: 175,902, 9: 191,513, 10: 196,172, 11: 135,292, 12: 171,830, 13: 142,247, 14: 139,284, 15: 139,967, 16: 127,430, 17: 140,656, 18: 145,278, 19: 61,655, 20: 96,917, 21: 89,989, 22: 85,396, 23: 72,523, 24: 72,821, 25: 65,365, 26: 57,306, 27: 54,620, 28: 59,734, 29: 41,312, 30: 49,189, 31: 24,051, 32: 37,710, 33: 27,254, 34: 30,437, 35: 22,886, 36: 23,895, 37: 19,167, 38: 16,416, 39: 14,228, 40: 12,203, 41: 11,025, 42: 11,521, 43: 9,016, 44: 7,892, 45: 7,317, 46: 6,619, 47: 5,116, 48: 4,547, 49: 4,816, 50: 5,410, 51: 6,318, 52: 6,050, 53: 4,495, 54: 4,513, 55: 4,647, 56: 5,950, 57: 8,704, 58: 9,025, 59: 6,348, 60: 9,994, 61: 13,741, 62: 33,871, 63: 67,054, 64: 22,889, 65: 29,156, 66: 63,733, 67: 211,691, 68: 459,702, 69: 1,464,926, 70: 644,065, 71: 245,045, 72: 89,873, 73: 27,596, 74: 13,882, 75: 8,056, 76: 6,363, 77: 8,172, 78: 8,082, 79: 7,352, 80: 6,814, 81: 6,296, 82: 5,932, 83: 5,649, 84: 5,509, 85: 5,684, 86: 5,846, 87: 6,287, 88: 6,080, 89: 5,947, 90: 6,550, 91: 6,879, 92: 7,339, 93: 7,632, 94: 8,212, 95: 8,981, 96: 10,318, 97: 11,326, 98: 12,605, 99: 14,595, 100: 29,743, 101: 122,274 SRR6995993 (adapter_2) 1: 4,561,156, 2: 505,818, 3: 56,794, 4: 7,031, 5: 4,090, 6: 571, 7: 268, 8: 107, 9: 80, 10: 67, 11: 85, 12: 49, 13: 90, 14: 65, 15: 40, 16: 40, 17: 21, 18: 40, 19: 65, 20: 101, 21: 129, 22: 202, 23: 445, 24: 443, 25: 591, 26: 398, 27: 104, 28: 124, 29: 164, 30: 181, 31: 159, 32: 97, 33: 198, 34: 130, 35: 108, 36: 89, 37: 123, 38: 145, 39: 200, 40: 191, 41: 325, 42: 334, 43: 177, 44: 221, 45: 285, 46: 241, 47: 397, 48: 702, 49: 877, 50: 524, 51: 485, 52: 447, 53: 1,183, 54: 1,066, 55: 1,779, 56: 1,275, 57: 2,469, 58: 4,157, 59: 7,478, 60: 7,241, 61: 2,922, 62: 5,259, 63: 7,887, 64: 28,601, 65: 36,210, 66: 108,457, 67: 28,099, 68: 17,959, 69: 8,227, 70: 5,141, 71: 2,233, 72: 1,393, 73: 1,003, 74: 864, 75: 603, 76: 393, 77: 397, 78: 433, 79: 417, 80: 468, 81: 437, 82: 455, 83: 511, 84: 494, 85: 502, 86: 521, 87: 595, 88: 533, 89: 610, 90: 623, 91: 697, 92: 696, 93: 808, 94: 821, 95: 913, 96: 1,068, 97: 1,253, 98: 1,778, 99: 1,409, 100: 2,816, 101: 11,734 SRR6995994 1: 1,492,673, 2: 128,606, 3: 46,575, 4: 41,159, 5: 37,536, 6: 41,569, 7: 48,187, 8: 28,646, 9: 34,008, 10: 40,831, 11: 21,065, 12: 38,704, 13: 27,571, 14: 29,986, 15: 30,811, 16: 33,796, 17: 31,481, 18: 36,540, 19: 16,404, 20: 27,251, 21: 27,037, 22: 29,373, 23: 20,042, 24: 23,565, 25: 26,835, 26: 20,970, 27: 24,430, 28: 29,629, 29: 20,776, 30: 26,214, 31: 11,647, 32: 24,787, 33: 19,825, 34: 22,065, 35: 17,506, 36: 19,797, 37: 16,920, 38: 14,304, 39: 26,209, 40: 19,198, 41: 20,520, 42: 18,071, 43: 14,907, 44: 16,886, 45: 15,612, 46: 12,394, 47: 10,591, 48: 9,609, 49: 9,522, 50: 9,294, 51: 13,903, 52: 13,239, 53: 8,979, 54: 9,200, 55: 8,072, 56: 12,312, 57: 16,342, 58: 16,992, 59: 9,771, 60: 15,041, 61: 18,860, 62: 60,094, 63: 81,473, 64: 21,614, 65: 27,266, 66: 62,431, 67: 216,122, 68: 512,942, 69: 1,759,487, 70: 1,030,923, 71: 385,489, 72: 136,008, 73: 37,320, 74: 18,790, 75: 10,622, 76: 8,751, 77: 11,809, 78: 11,503, 79: 10,575, 80: 9,203, 81: 8,005, 82: 7,640, 83: 6,731, 84: 6,624, 85: 6,531, 86: 6,911, 87: 7,263, 88: 6,993, 89: 7,121, 90: 7,430, 91: 7,861, 92: 8,386, 93: 8,863, 94: 9,659, 95: 10,322, 96: 11,715, 97: 13,349, 98: 14,698, 99: 16,886, 100: 33,928, 101: 140,413 SRR6995994 (adapter_1) 1: 347,934, 2: 125,307, 3: 45,297, 4: 40,566, 5: 36,746, 6: 40,795, 7: 47,574, 8: 28,252, 9: 33,695, 10: 40,547, 11: 20,912, 12: 38,464, 13: 27,295, 14: 29,768, 15: 30,445, 16: 33,557, 17: 31,075, 18: 36,248, 19: 16,267, 20: 27,107, 21: 26,911, 22: 29,189, 23: 19,910, 24: 23,461, 25: 26,693, 26: 20,628, 27: 24,206, 28: 29,395, 29: 20,660, 30: 26,282, 31: 11,838, 32: 25,359, 33: 21,055, 34: 22,811, 35: 17,850, 36: 20,524, 37: 17,720, 38: 14,725, 39: 28,328, 40: 20,944, 41: 22,551, 42: 19,911, 43: 16,323, 44: 19,157, 45: 17,065, 46: 13,603, 47: 11,823, 48: 10,787, 49: 10,449, 50: 10,791, 51: 16,404, 52: 15,229, 53: 10,085, 54: 10,747, 55: 9,561, 56: 14,401, 57: 19,383, 58: 20,471, 59: 11,855, 60: 18,716, 61: 24,039, 62: 72,662, 63: 99,768, 64: 27,713, 65: 35,364, 66: 79,764, 67: 263,320, 68: 615,433, 69: 2,019,856, 70: 1,183,447, 71: 460,639, 72: 165,385, 73: 47,645, 74: 23,096, 75: 12,982, 76: 10,596, 77: 14,072, 78: 13,616, 79: 12,458, 80: 10,898, 81: 9,525, 82: 9,000, 83: 8,158, 84: 7,965, 85: 8,036, 86: 8,417, 87: 8,856, 88: 8,481, 89: 8,698, 90: 9,063, 91: 9,542, 92: 10,159, 93: 10,725, 94: 11,784, 95: 12,510, 96: 14,251, 97: 16,124, 98: 17,814, 99: 20,616, 100: 41,429, 101: 170,394 SRR6995994 (adapter_2) 1: 504,853, 2: 140,389, 3: 36,452, 4: 2,216, 5: 1,247, 6: 218, 7: 62, 8: 30, 9: 35, 10: 33, 11: 41, 12: 32, 13: 46, 14: 35, 15: 59, 16: 57, 17: 30, 18: 36, 19: 62, 20: 99, 21: 130, 22: 188, 23: 549, 24: 517, 25: 651, 26: 447, 27: 122, 28: 128, 29: 185, 30: 213, 31: 208, 32: 140, 33: 206, 34: 228, 35: 211, 36: 542, 37: 468, 38: 712, 39: 782, 40: 688, 41: 1,722, 42: 1,097, 43: 626, 44: 727, 45: 900, 46: 760, 47: 970, 48: 2,299, 49: 2,522, 50: 878, 51: 1,170, 52: 934, 53: 2,865, 54: 2,145, 55: 3,781, 56: 2,216, 57: 4,339, 58: 6,984, 59: 13,439, 60: 9,614, 61: 3,274, 62: 6,316, 63: 10,139, 64: 36,345, 65: 49,514, 66: 150,199, 67: 47,741, 68: 32,474, 69: 14,839, 70: 9,148, 71: 3,903, 72: 2,306, 73: 1,639, 74: 1,296, 75: 990, 76: 558, 77: 643, 78: 686, 79: 622, 80: 601, 81: 679, 82: 651, 83: 628, 84: 681, 85: 666, 86: 722, 87: 774, 88: 858, 89: 809, 90: 872, 91: 918, 92: 1,040, 93: 1,079, 94: 1,195, 95: 1,278, 96: 1,399, 97: 1,705, 98: 2,418, 99: 1,936, 100: 3,929, 101: 16,403 SRR6995995 1: 11,462,116, 2: 913,639, 3: 452,031, 4: 350,618, 5: 306,933, 6: 287,673, 7: 281,622, 8: 223,594, 9: 240,111, 10: 227,277, 11: 163,863, 12: 191,866, 13: 162,016, 14: 154,332, 15: 155,092, 16: 135,444, 17: 148,906, 18: 139,969, 19: 77,237, 20: 100,751, 21: 92,710, 22: 92,332, 23: 71,942, 24: 71,831, 25: 70,031, 26: 59,001, 27: 60,092, 28: 69,170, 29: 44,476, 30: 56,054, 31: 26,700, 32: 44,622, 33: 37,960, 34: 33,786, 35: 32,078, 36: 29,446, 37: 24,823, 38: 22,225, 39: 18,967, 40: 18,640, 41: 17,506, 42: 18,111, 43: 14,856, 44: 15,499, 45: 14,325, 46: 11,856, 47: 10,329, 48: 9,714, 49: 9,605, 50: 9,484, 51: 14,034, 52: 13,280, 53: 8,932, 54: 9,882, 55: 9,119, 56: 13,038, 57: 18,891, 58: 20,514, 59: 11,921, 60: 19,122, 61: 23,840, 62: 75,716, 63: 106,484, 64: 28,951, 65: 37,257, 66: 83,778, 67: 294,897, 68: 680,706, 69: 2,318,979, 70: 1,329,345, 71: 473,970, 72: 166,570, 73: 46,778, 74: 24,045, 75: 13,890, 76: 11,132, 77: 15,031, 78: 14,608, 79: 13,595, 80: 11,887, 81: 10,350, 82: 10,109, 83: 9,110, 84: 8,688, 85: 8,905, 86: 9,256, 87: 9,870, 88: 9,386, 89: 9,536, 90: 10,143, 91: 10,789, 92: 11,390, 93: 11,919, 94: 13,136, 95: 14,072, 96: 16,424, 97: 18,075, 98: 20,232, 99: 23,227, 100: 46,740, 101: 194,022 SRR6995995 (adapter_1) 1: 9,885,198, 2: 906,583, 3: 448,730, 4: 348,682, 5: 305,027, 6: 286,626, 7: 280,758, 8: 223,039, 9: 239,670, 10: 226,886, 11: 163,610, 12: 191,510, 13: 161,605, 14: 154,050, 15: 154,568, 16: 135,096, 17: 148,185, 18: 139,549, 19: 77,067, 20: 100,514, 21: 92,509, 22: 92,047, 23: 71,725, 24: 71,623, 25: 69,812, 26: 58,527, 27: 59,794, 28: 68,784, 29: 44,332, 30: 56,176, 31: 27,036, 32: 45,492, 33: 40,641, 34: 34,679, 35: 33,062, 36: 30,596, 37: 25,725, 38: 23,106, 39: 19,625, 40: 19,912, 41: 18,890, 42: 19,791, 43: 16,285, 44: 17,782, 45: 15,921, 46: 13,140, 47: 11,820, 48: 11,217, 49: 10,766, 50: 11,395, 51: 17,262, 52: 15,757, 53: 10,375, 54: 11,992, 55: 11,030, 56: 15,734, 57: 23,107, 58: 25,324, 59: 14,950, 60: 24,193, 61: 30,818, 62: 92,690, 63: 131,772, 64: 37,716, 65: 48,790, 66: 108,300, 67: 362,882, 68: 825,193, 69: 2,679,481, 70: 1,537,802, 71: 573,697, 72: 205,701, 73: 60,416, 74: 29,971, 75: 17,108, 76: 13,669, 77: 18,026, 78: 17,496, 79: 16,248, 80: 14,376, 81: 12,409, 82: 11,967, 83: 11,048, 84: 10,729, 85: 10,992, 86: 11,379, 87: 12,130, 88: 11,558, 89: 11,831, 90: 12,583, 91: 13,227, 92: 13,983, 93: 14,638, 94: 16,073, 95: 17,365, 96: 20,085, 97: 22,148, 98: 24,750, 99: 28,465, 100: 57,898, 101: 237,981 SRR6995995 (adapter_2) 1: 6,930,389, 2: 797,808, 3: 100,905, 4: 12,257, 5: 7,094, 6: 1,237, 7: 435, 8: 137, 9: 140, 10: 142, 11: 100, 12: 88, 13: 118, 14: 87, 15: 67, 16: 82, 17: 45, 18: 54, 19: 83, 20: 136, 21: 210, 22: 298, 23: 822, 24: 932, 25: 1,057, 26: 755, 27: 182, 28: 263, 29: 345, 30: 408, 31: 245, 32: 351, 33: 316, 34: 281, 35: 315, 36: 275, 37: 312, 38: 453, 39: 755, 40: 660, 41: 1,422, 42: 1,081, 43: 646, 44: 795, 45: 1,081, 46: 895, 47: 1,132, 48: 2,398, 49: 2,888, 50: 1,138, 51: 1,475, 52: 1,193, 53: 3,500, 54: 2,798, 55: 4,722, 56: 3,137, 57: 6,053, 58: 9,204, 59: 17,166, 60: 12,923, 61: 4,589, 62: 9,290, 63: 14,976, 64: 54,543, 65: 68,466, 66: 199,741, 67: 62,312, 68: 40,320, 69: 18,475, 70: 11,165, 71: 4,885, 72: 2,938, 73: 2,086, 74: 1,603, 75: 1,248, 76: 739, 77: 841, 78: 920, 79: 865, 80: 910, 81: 829, 82: 849, 83: 815, 84: 897, 85: 863, 86: 1,022, 87: 1,108, 88: 1,120, 89: 1,153, 90: 1,225, 91: 1,263, 92: 1,374, 93: 1,425, 94: 1,673, 95: 1,756, 96: 1,901, 97: 2,324, 98: 3,336, 99: 2,690, 100: 5,262, 101: 22,663 SRR6995996 1: 10,442,109, 2: 858,546, 3: 323,061, 4: 208,999, 5: 156,468, 6: 150,095, 7: 150,683, 8: 112,087, 9: 121,113, 10: 120,183, 11: 82,513, 12: 101,876, 13: 82,802, 14: 79,808, 15: 80,044, 16: 70,782, 17: 77,593, 18: 76,669, 19: 37,746, 20: 52,871, 21: 48,510, 22: 50,987, 23: 35,225, 24: 35,323, 25: 35,800, 26: 29,366, 27: 30,804, 28: 35,277, 29: 22,003, 30: 27,014, 31: 12,785, 32: 21,700, 33: 20,186, 34: 19,001, 35: 14,386, 36: 11,967, 37: 13,575, 38: 13,727, 39: 10,169, 40: 11,801, 41: 10,037, 42: 10,199, 43: 7,545, 44: 7,278, 45: 6,505, 46: 5,769, 47: 5,357, 48: 4,426, 49: 4,041, 50: 5,250, 51: 7,084, 52: 6,642, 53: 4,818, 54: 5,451, 55: 5,173, 56: 6,834, 57: 10,395, 58: 11,081, 59: 7,370, 60: 12,415, 61: 16,006, 62: 40,675, 63: 71,680, 64: 22,344, 65: 27,767, 66: 60,311, 67: 205,204, 68: 445,144, 69: 1,354,225, 70: 645,223, 71: 244,033, 72: 91,071, 73: 26,535, 74: 13,931, 75: 8,024, 76: 6,493, 77: 8,718, 78: 8,528, 79: 8,007, 80: 6,845, 81: 6,103, 82: 5,921, 83: 5,230, 84: 4,955, 85: 4,970, 86: 5,269, 87: 5,662, 88: 5,293, 89: 5,353, 90: 5,769, 91: 6,086, 92: 6,382, 93: 6,697, 94: 7,313, 95: 8,005, 96: 9,214, 97: 10,205, 98: 11,439, 99: 13,235, 100: 26,743, 101: 111,504 SRR6995996 (adapter_1) 1: 9,511,604, 2: 854,146, 3: 321,485, 4: 208,468, 5: 155,787, 6: 149,530, 7: 150,206, 8: 111,825, 9: 120,865, 10: 119,949, 11: 82,378, 12: 101,651, 13: 82,550, 14: 79,643, 15: 79,716, 16: 70,589, 17: 77,161, 18: 76,378, 19: 37,656, 20: 52,739, 21: 48,377, 22: 50,793, 23: 35,072, 24: 35,173, 25: 35,651, 26: 29,053, 27: 30,615, 28: 35,054, 29: 21,892, 30: 27,129, 31: 13,006, 32: 22,567, 33: 21,811, 34: 20,137, 35: 15,103, 36: 12,496, 37: 14,795, 38: 14,952, 39: 11,073, 40: 12,985, 41: 11,309, 42: 11,654, 43: 8,555, 44: 8,605, 45: 7,567, 46: 6,497, 47: 6,195, 48: 5,302, 49: 4,862, 50: 6,489, 51: 8,922, 52: 8,353, 53: 5,735, 54: 6,756, 55: 6,426, 56: 8,400, 57: 12,846, 58: 13,900, 59: 9,494, 60: 15,948, 61: 21,282, 62: 51,992, 63: 91,354, 64: 29,311, 65: 36,969, 66: 78,577, 67: 252,354, 68: 532,520, 69: 1,555,991, 70: 752,046, 71: 297,947, 72: 111,007, 73: 33,617, 74: 17,420, 75: 9,858, 76: 8,024, 77: 10,452, 78: 10,122, 79: 9,470, 80: 8,146, 81: 7,328, 82: 7,039, 83: 6,367, 84: 6,031, 85: 6,159, 86: 6,514, 87: 6,958, 88: 6,535, 89: 6,596, 90: 7,087, 91: 7,480, 92: 7,790, 93: 8,247, 94: 8,897, 95: 9,814, 96: 11,237, 97: 12,507, 98: 13,970, 99: 16,260, 100: 32,934, 101: 136,629 SRR6995996 (adapter_2) 1: 6,131,004, 2: 723,009, 3: 126,430, 4: 13,151, 5: 6,662, 6: 1,466, 7: 444, 8: 149, 9: 179, 10: 168, 11: 110, 12: 86, 13: 84, 14: 94, 15: 65, 16: 75, 17: 48, 18: 106, 19: 91, 20: 152, 21: 179, 22: 250, 23: 627, 24: 720, 25: 877, 26: 574, 27: 158, 28: 280, 29: 324, 30: 276, 31: 283, 32: 245, 33: 239, 34: 441, 35: 407, 36: 379, 37: 341, 38: 461, 39: 523, 40: 450, 41: 864, 42: 810, 43: 483, 44: 487, 45: 684, 46: 653, 47: 936, 48: 1,615, 49: 1,574, 50: 662, 51: 899, 52: 709, 53: 2,051, 54: 1,718, 55: 2,906, 56: 2,116, 57: 4,011, 58: 6,542, 59: 11,697, 60: 10,604, 61: 3,913, 62: 7,115, 63: 11,025, 64: 35,388, 65: 42,645, 66: 120,953, 67: 33,122, 68: 21,011, 69: 10,158, 70: 6,612, 71: 2,898, 72: 1,769, 73: 1,309, 74: 1,028, 75: 732, 76: 458, 77: 500, 78: 542, 79: 514, 80: 571, 81: 511, 82: 521, 83: 495, 84: 510, 85: 599, 86: 617, 87: 632, 88: 643, 89: 634, 90: 694, 91: 786, 92: 854, 93: 918, 94: 954, 95: 1,045, 96: 1,239, 97: 1,438, 98: 2,124, 99: 1,674, 100: 3,341, 101: 14,057 SRR6995997 1: 4,187,128, 2: 454,110, 3: 173,889, 4: 132,573, 5: 112,014, 6: 112,058, 7: 118,966, 8: 75,644, 9: 82,129, 10: 91,564, 11: 49,447, 12: 73,848, 13: 53,814, 14: 53,730, 15: 51,034, 16: 45,353, 17: 49,374, 18: 49,029, 19: 20,435, 20: 32,995, 21: 29,134, 22: 32,739, 23: 19,037, 24: 20,929, 25: 21,697, 26: 18,162, 27: 19,066, 28: 22,397, 29: 13,558, 30: 17,020, 31: 8,745, 32: 15,653, 33: 11,417, 34: 11,991, 35: 8,569, 36: 14,385, 37: 11,073, 38: 10,006, 39: 4,029, 40: 8,814, 41: 7,363, 42: 8,430, 43: 5,950, 44: 4,902, 45: 4,218, 46: 4,228, 47: 3,518, 48: 3,325, 49: 3,797, 50: 4,608, 51: 5,145, 52: 5,285, 53: 3,976, 54: 4,261, 55: 4,223, 56: 5,447, 57: 8,441, 58: 8,451, 59: 5,743, 60: 9,461, 61: 12,875, 62: 34,181, 63: 60,381, 64: 20,274, 65: 25,392, 66: 57,509, 67: 203,400, 68: 453,625, 69: 1,544,776, 70: 698,697, 71: 251,909, 72: 90,054, 73: 25,843, 74: 13,665, 75: 7,903, 76: 6,205, 77: 8,054, 78: 8,209, 79: 7,543, 80: 6,613, 81: 6,031, 82: 5,950, 83: 5,664, 84: 5,314, 85: 5,354, 86: 5,455, 87: 5,923, 88: 5,717, 89: 5,679, 90: 6,154, 91: 6,256, 92: 6,729, 93: 7,069, 94: 7,863, 95: 8,101, 96: 9,594, 97: 10,511, 98: 11,586, 99: 13,572, 100: 27,213, 101: 111,889 SRR6995997 (adapter_1) 1: 3,252,026, 2: 449,655, 3: 172,568, 4: 132,079, 5: 111,305, 6: 111,456, 7: 118,453, 8: 75,329, 9: 81,858, 10: 91,307, 11: 49,323, 12: 73,628, 13: 53,609, 14: 53,562, 15: 50,759, 16: 45,152, 17: 49,020, 18: 48,805, 19: 20,362, 20: 32,875, 21: 29,023, 22: 32,581, 23: 18,936, 24: 20,836, 25: 21,577, 26: 17,855, 27: 18,897, 28: 22,186, 29: 13,481, 30: 17,066, 31: 8,888, 32: 16,088, 33: 12,222, 34: 12,439, 35: 9,040, 36: 15,582, 37: 11,827, 38: 10,325, 39: 4,430, 40: 9,519, 41: 8,180, 42: 9,447, 43: 6,580, 44: 5,530, 45: 4,661, 46: 4,700, 47: 3,956, 48: 3,840, 49: 4,285, 50: 5,322, 51: 6,241, 52: 6,212, 53: 4,584, 54: 5,092, 55: 5,077, 56: 6,469, 57: 10,072, 58: 10,268, 59: 7,094, 60: 11,779, 61: 16,382, 62: 41,551, 63: 73,734, 64: 25,625, 65: 32,587, 66: 72,657, 67: 244,688, 68: 538,898, 69: 1,756,160, 70: 802,236, 71: 301,482, 72: 109,475, 73: 32,612, 74: 16,673, 75: 9,564, 76: 7,558, 77: 9,633, 78: 9,647, 79: 8,936, 80: 7,841, 81: 7,131, 82: 6,969, 83: 6,711, 84: 6,367, 85: 6,459, 86: 6,596, 87: 7,189, 88: 6,928, 89: 6,865, 90: 7,448, 91: 7,508, 92: 8,086, 93: 8,513, 94: 9,509, 95: 9,793, 96: 11,536, 97: 12,688, 98: 14,017, 99: 16,416, 100: 32,960, 101: 134,705 SRR6995997 (adapter_2) 1: 3,126,854, 2: 459,270, 3: 74,011, 4: 6,487, 5: 3,457, 6: 785, 7: 260, 8: 95, 9: 87, 10: 94, 11: 58, 12: 40, 13: 59, 14: 47, 15: 31, 16: 35, 17: 14, 18: 38, 19: 46, 20: 64, 21: 86, 22: 150, 23: 474, 24: 471, 25: 570, 26: 334, 27: 99, 28: 118, 29: 148, 30: 145, 31: 143, 32: 175, 33: 344, 34: 215, 35: 103, 36: 177, 37: 166, 38: 296, 39: 297, 40: 254, 41: 381, 42: 349, 43: 227, 44: 300, 45: 362, 46: 320, 47: 560, 48: 931, 49: 1,194, 50: 514, 51: 662, 52: 581, 53: 1,576, 54: 1,302, 55: 2,240, 56: 1,683, 57: 3,279, 58: 5,477, 59: 9,576, 60: 8,856, 61: 3,587, 62: 6,965, 63: 10,354, 64: 38,377, 65: 47,284, 66: 141,388, 67: 36,210, 68: 23,528, 69: 10,753, 70: 6,885, 71: 3,048, 72: 1,850, 73: 1,372, 74: 1,027, 75: 825, 76: 492, 77: 502, 78: 517, 79: 565, 80: 590, 81: 573, 82: 553, 83: 649, 84: 589, 85: 648, 86: 683, 87: 745, 88: 731, 89: 702, 90: 797, 91: 834, 92: 912, 93: 962, 94: 1,085, 95: 1,155, 96: 1,331, 97: 1,554, 98: 2,187, 99: 1,707, 100: 3,516, 101: 14,804 SRR6995998 1: 8,285,474, 2: 559,423, 3: 216,339, 4: 143,815, 5: 117,955, 6: 111,642, 7: 108,539, 8: 86,050, 9: 91,514, 10: 88,442, 11: 62,621, 12: 74,035, 13: 63,319, 14: 58,987, 15: 59,087, 16: 54,950, 17: 58,145, 18: 58,154, 19: 27,758, 20: 40,176, 21: 37,434, 22: 33,764, 23: 30,330, 24: 29,671, 25: 27,942, 26: 24,150, 27: 23,623, 28: 24,890, 29: 19,908, 30: 20,481, 31: 12,881, 32: 17,651, 33: 16,804, 34: 13,945, 35: 10,732, 36: 10,850, 37: 10,956, 38: 8,624, 39: 7,255, 40: 7,963, 41: 8,308, 42: 8,795, 43: 6,030, 44: 6,198, 45: 5,385, 46: 4,677, 47: 3,677, 48: 3,427, 49: 3,112, 50: 3,612, 51: 5,269, 52: 4,671, 53: 3,185, 54: 3,635, 55: 3,449, 56: 5,069, 57: 7,323, 58: 8,100, 59: 4,760, 60: 7,878, 61: 10,080, 62: 26,619, 63: 44,903, 64: 14,567, 65: 18,393, 66: 41,240, 67: 143,012, 68: 320,547, 69: 1,097,234, 70: 537,460, 71: 189,884, 72: 67,045, 73: 18,902, 74: 10,057, 75: 5,895, 76: 4,722, 77: 5,866, 78: 5,886, 79: 5,530, 80: 4,979, 81: 4,520, 82: 4,444, 83: 4,037, 84: 4,010, 85: 3,861, 86: 4,035, 87: 4,454, 88: 4,119, 89: 4,299, 90: 4,533, 91: 4,826, 92: 5,105, 93: 5,408, 94: 5,949, 95: 6,449, 96: 7,261, 97: 8,223, 98: 9,141, 99: 10,761, 100: 21,249, 101: 90,379 SRR6995998 (adapter_1) 1: 7,486,492, 2: 556,110, 3: 215,204, 4: 143,385, 5: 117,335, 6: 111,101, 7: 108,116, 8: 85,776, 9: 91,284, 10: 88,196, 11: 62,520, 12: 73,869, 13: 63,114, 14: 58,843, 15: 58,817, 16: 54,757, 17: 57,823, 18: 57,926, 19: 27,654, 20: 40,056, 21: 37,344, 22: 33,588, 23: 30,235, 24: 29,560, 25: 27,800, 26: 23,926, 27: 23,450, 28: 24,696, 29: 19,777, 30: 20,592, 31: 13,079, 32: 18,177, 33: 18,339, 34: 14,306, 35: 11,227, 36: 11,279, 37: 11,388, 38: 9,163, 39: 7,681, 40: 8,693, 41: 9,369, 42: 9,918, 43: 6,814, 44: 7,187, 45: 6,154, 46: 5,259, 47: 4,355, 48: 4,096, 49: 3,610, 50: 4,397, 51: 6,602, 52: 5,854, 53: 3,856, 54: 4,510, 55: 4,316, 56: 6,306, 57: 9,206, 58: 10,172, 59: 6,145, 60: 10,450, 61: 13,798, 62: 34,753, 63: 58,675, 64: 20,016, 65: 25,770, 66: 54,782, 67: 178,049, 68: 391,246, 69: 1,269,821, 70: 627,796, 71: 233,406, 72: 81,970, 73: 24,147, 74: 12,636, 75: 7,304, 76: 5,793, 77: 7,128, 78: 7,080, 79: 6,696, 80: 6,002, 81: 5,461, 82: 5,230, 83: 4,956, 84: 4,961, 85: 4,812, 86: 5,084, 87: 5,512, 88: 5,143, 89: 5,350, 90: 5,622, 91: 5,963, 92: 6,391, 93: 6,677, 94: 7,356, 95: 8,012, 96: 9,046, 97: 10,207, 98: 11,218, 99: 13,312, 100: 26,518, 101: 111,947 SRR6995998 (adapter_2) 1: 4,771,978, 2: 385,430, 3: 69,715, 4: 6,478, 5: 3,849, 6: 824, 7: 239, 8: 105, 9: 123, 10: 157, 11: 91, 12: 57, 13: 94, 14: 67, 15: 52, 16: 53, 17: 26, 18: 47, 19: 85, 20: 116, 21: 183, 22: 269, 23: 404, 24: 505, 25: 708, 26: 493, 27: 138, 28: 183, 29: 177, 30: 264, 31: 106, 32: 160, 33: 157, 34: 161, 35: 256, 36: 249, 37: 260, 38: 441, 39: 529, 40: 432, 41: 769, 42: 608, 43: 454, 44: 475, 45: 620, 46: 560, 47: 713, 48: 1,277, 49: 1,166, 50: 564, 51: 736, 52: 619, 53: 1,725, 54: 1,426, 55: 2,371, 56: 1,928, 57: 3,756, 58: 5,620, 59: 9,191, 60: 8,312, 61: 3,516, 62: 7,678, 63: 11,352, 64: 37,658, 65: 40,227, 66: 113,910, 67: 32,095, 68: 20,655, 69: 9,461, 70: 4,372, 71: 2,481, 72: 1,534, 73: 1,116, 74: 852, 75: 661, 76: 413, 77: 452, 78: 487, 79: 506, 80: 494, 81: 488, 82: 449, 83: 451, 84: 504, 85: 535, 86: 652, 87: 668, 88: 543, 89: 605, 90: 681, 91: 745, 92: 768, 93: 837, 94: 919, 95: 1,052, 96: 1,162, 97: 1,375, 98: 2,000, 99: 1,607, 100: 3,294, 101: 13,602 ---------------------- Tool: FastQC Section: Sequence Counts Section description: Sequence counts for each sample. Duplicate read counts are an estimate only. Section help text: This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info). You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience: Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level. The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis. Title: FastQC: Sequence Counts Plot type: bar plot Values: Number of reads |Sample|Unique Reads|Duplicate Reads| |---|---|---| |SRR6995998|18,217,730|6,574,954| |SRR6995997|6,879,306|10,447,904| |SRR6995996|21,544,808|11,864,606| |SRR6995995|24,337,121|15,443,100| |SRR6995994|1,503,742|7,685,198| |SRR6995993|15,984,768|9,767,866| ---------------------- Tool: FastQC Section: Sequence Quality Histograms Section description: The mean quality value across each base position in the read. Section help text: To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports). Taken from the FastQC help: The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read. Title: FastQC: Mean Quality Scores Plot type: x/y line X axis: Position (bp) Y axis: Phred Score Samples: SRR6995993, SRR6995994, SRR6995995, SRR6995996, SRR6995997, SRR6995998 X values are in bp SRR6995993 1: 28, 2: 30, 3: 26, 4: 31, 5: 32, 6: 34, 7: 34, 8: 35, 9: 36, 10: 36, 12: 36, 14: 38, 16: 38, 18: 38, 20: 38, 22: 38, 24: 38, 26: 37, 28: 37, 30: 37, 32: 37, 34: 36, 36: 36, 38: 36, 40: 37, 42: 37, 44: 36, 46: 36, 48: 36, 50: 36, 52: 36, 54: 36, 56: 35, 58: 35, 60: 35, 62: 35, 64: 34, 66: 34, 68: 32, 70: 29, 72: 28, 74: 28, 76: 26, 78: 28, 80: 28, 82: 27, 84: 27, 86: 27, 88: 27, 90: 27, 92: 27, 94: 26, 96: 26, 98: 26, 100: 25 SRR6995994 1: 29, 2: 30, 3: 27, 4: 32, 5: 33, 6: 34, 7: 34, 8: 35, 9: 36, 10: 36, 12: 36, 14: 38, 16: 37, 18: 37, 20: 38, 22: 37, 24: 38, 26: 37, 28: 37, 30: 37, 32: 37, 34: 35, 36: 35, 38: 34, 40: 36, 42: 36, 44: 36, 46: 35, 48: 35, 50: 35, 52: 34, 54: 35, 56: 35, 58: 34, 60: 34, 62: 33, 64: 30, 66: 31, 68: 27, 70: 16, 72: 12, 74: 12, 76: 11, 78: 12, 80: 12, 82: 12, 84: 11, 86: 11, 88: 11, 90: 11, 92: 11, 94: 11, 96: 11, 98: 10, 100: 10 SRR6995995 1: 28, 2: 30, 3: 26, 4: 31, 5: 32, 6: 34, 7: 34, 8: 35, 9: 36, 10: 36, 12: 36, 14: 38, 16: 37, 18: 38, 20: 38, 22: 38, 24: 38, 26: 37, 28: 37, 30: 37, 32: 37, 34: 36, 36: 36, 38: 36, 40: 37, 42: 37, 44: 36, 46: 36, 48: 36, 50: 36, 52: 36, 54: 36, 56: 35, 58: 35, 60: 35, 62: 34, 64: 33, 66: 33, 68: 32, 70: 28, 72: 27, 74: 27, 76: 25, 78: 26, 80: 26, 82: 26, 84: 26, 86: 26, 88: 26, 90: 25, 92: 25, 94: 25, 96: 25, 98: 25, 100: 24 SRR6995996 1: 28, 2: 30, 3: 26, 4: 31, 5: 32, 6: 34, 7: 34, 8: 34, 9: 36, 10: 36, 12: 36, 14: 37, 16: 37, 18: 37, 20: 37, 22: 37, 24: 37, 26: 37, 28: 37, 30: 37, 32: 37, 34: 36, 36: 36, 38: 36, 40: 36, 42: 36, 44: 36, 46: 36, 48: 36, 50: 36, 52: 35, 54: 35, 56: 35, 58: 35, 60: 34, 62: 34, 64: 34, 66: 33, 68: 32, 70: 30, 72: 29, 74: 28, 76: 26, 78: 28, 80: 28, 82: 28, 84: 28, 86: 27, 88: 27, 90: 27, 92: 27, 94: 27, 96: 26, 98: 26, 100: 25 SRR6995997 1: 28, 2: 30, 3: 26, 4: 31, 5: 32, 6: 34, 7: 34, 8: 34, 9: 36, 10: 36, 12: 36, 14: 37, 16: 37, 18: 37, 20: 37, 22: 37, 24: 37, 26: 37, 28: 37, 30: 37, 32: 37, 34: 36, 36: 36, 38: 35, 40: 36, 42: 36, 44: 36, 46: 36, 48: 36, 50: 36, 52: 35, 54: 35, 56: 35, 58: 34, 60: 34, 62: 34, 64: 32, 66: 32, 68: 30, 70: 25, 72: 24, 74: 23, 76: 22, 78: 23, 80: 23, 82: 23, 84: 23, 86: 23, 88: 23, 90: 22, 92: 22, 94: 22, 96: 22, 98: 22, 100: 20 SRR6995998 1: 28, 2: 29, 3: 26, 4: 31, 5: 32, 6: 34, 7: 34, 8: 34, 9: 36, 10: 36, 12: 36, 14: 38, 16: 37, 18: 37, 20: 37, 22: 38, 24: 37, 26: 37, 28: 37, 30: 37, 32: 37, 34: 36, 36: 36, 38: 36, 40: 37, 42: 36, 44: 36, 46: 36, 48: 36, 50: 36, 52: 36, 54: 36, 56: 35, 58: 35, 60: 35, 62: 34, 64: 34, 66: 34, 68: 33, 70: 30, 72: 29, 74: 29, 76: 26, 78: 28, 80: 28, 82: 28, 84: 28, 86: 27, 88: 27, 90: 27, 92: 27, 94: 27, 96: 26, 98: 26, 100: 25 ---------------------- Tool: FastQC Section: Per Sequence Quality Scores Section description: The number of reads with average quality scores. Shows if a subset of reads has poor quality. Section help text: From the FastQC help: The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences. Title: FastQC: Per Sequence Quality Scores Plot type: x/y line X axis: Mean Sequence Quality (Phred Score) Y axis: Count Samples: SRR6995993, SRR6995994, SRR6995995, SRR6995996, SRR6995997, SRR6995998 SRR6995993 2: 6,559, 3: 517, 4: 653, 5: 1,165, 6: 2,089, 7: 4,913, 8: 9,606, 9: 15,742, 10: 21,789, 11: 28,382, 12: 36,121, 13: 45,900, 14: 52,881, 15: 57,202, 16: 64,103, 17: 74,718, 18: 92,536, 19: 118,351, 20: 154,449, 21: 198,580, 22: 254,766, 23: 334,360, 24: 458,277, 25: 684,293, 26: 1,032,583, 27: 1,369,940, 28: 564,775, 29: 517,303, 30: 647,195, 31: 809,351, 32: 1,018,861, 33: 1,306,444, 34: 1,728,546, 35: 2,387,884, 36: 3,529,002, 37: 4,838,585, 38: 3,030,347, 39: 253,792, 40: 74 SRR6995994 2: 4,694, 3: 193, 4: 318, 5: 608, 6: 1,012, 7: 1,920, 8: 3,804, 9: 6,404, 10: 10,211, 11: 14,529, 12: 22,325, 13: 33,763, 14: 44,085, 15: 52,261, 16: 57,404, 17: 64,836, 18: 85,267, 19: 119,458, 20: 167,738, 21: 228,741, 22: 301,822, 23: 402,377, 24: 559,348, 25: 855,725, 26: 1,306,062, 27: 1,681,202, 28: 443,089, 29: 189,323, 30: 188,855, 31: 199,149, 32: 213,345, 33: 242,878, 34: 301,568, 35: 381,760, 36: 460,598, 37: 413,799, 38: 123,638, 39: 4,829, 40: 2 SRR6995995 2: 8,750, 3: 601, 4: 880, 5: 1,504, 6: 3,058, 7: 7,302, 8: 14,227, 9: 23,268, 10: 33,782, 11: 46,094, 12: 62,837, 13: 82,746, 14: 94,089, 15: 100,457, 16: 113,958, 17: 134,816, 18: 170,235, 19: 221,242, 20: 291,118, 21: 374,745, 22: 482,808, 23: 632,616, 24: 866,469, 25: 1,288,659, 26: 1,885,329, 27: 2,550,707, 28: 1,024,553, 29: 804,266, 30: 977,089, 31: 1,205,401, 32: 1,499,534, 33: 1,903,309, 34: 2,510,824, 35: 3,463,330, 36: 5,109,343, 37: 6,987,140, 38: 4,411,860, 39: 391,201, 40: 74 SRR6995996 2: 34,102, 3: 1,472, 4: 2,221, 5: 3,591, 6: 6,113, 7: 12,448, 8: 20,828, 9: 30,156, 10: 39,837, 11: 51,501, 12: 64,629, 13: 79,723, 14: 87,129, 15: 95,070, 16: 104,707, 17: 116,785, 18: 138,644, 19: 172,206, 20: 216,552, 21: 270,244, 22: 338,108, 23: 435,783, 24: 588,826, 25: 861,718, 26: 1,271,057, 27: 1,546,977, 28: 657,864, 29: 690,552, 30: 852,250, 31: 1,063,365, 32: 1,331,285, 33: 1,703,348, 34: 2,251,173, 35: 3,073,967, 36: 4,435,845, 37: 6,026,938, 38: 4,221,337, 39: 510,733, 40: 330 SRR6995997 2: 4,466, 3: 344, 4: 496, 5: 939, 6: 1,855, 7: 4,462, 8: 8,048, 9: 12,546, 10: 18,070, 11: 24,285, 12: 31,568, 13: 40,833, 14: 47,238, 15: 52,625, 16: 60,278, 17: 70,220, 18: 88,314, 19: 117,852, 20: 157,727, 21: 209,189, 22: 273,824, 23: 361,668, 24: 500,549, 25: 746,263, 26: 1,151,145, 27: 1,588,591, 28: 500,276, 29: 400,178, 30: 474,656, 31: 572,971, 32: 697,822, 33: 865,637, 34: 1,118,420, 35: 1,509,783, 36: 2,129,198, 37: 2,492,547, 38: 953,837, 39: 38,477, 40: 13 SRR6995998 2: 18,189, 3: 665, 4: 1,157, 5: 1,938, 6: 3,308, 7: 6,775, 8: 11,814, 9: 17,722, 10: 24,151, 11: 32,264, 12: 42,575, 13: 54,265, 14: 60,291, 15: 64,130, 16: 71,017, 17: 81,320, 18: 98,256, 19: 123,922, 20: 157,285, 21: 200,192, 22: 252,569, 23: 330,858, 24: 459,617, 25: 696,231, 26: 973,341, 27: 1,176,137, 28: 455,648, 29: 489,632, 30: 607,469, 31: 757,415, 32: 949,216, 33: 1,211,276, 34: 1,601,482, 35: 2,203,416, 36: 3,183,031, 37: 4,434,353, 38: 3,466,810, 39: 472,668, 40: 279 ---------------------- Tool: FastQC Section: Per Base Sequence Content Section description: The proportion of each base position for which each of the four normal DNA bases has been called. Section help text: To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor. To see the data as a line plot, as in the original FastQC graph, click on a sample track. From the FastQC help: Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called. In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other. It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.
$ Click a sample row to see a line plot for that dataset.
Rollover for sample name
Position: -
%T: -
%C: -
%A: -
%G: -
---------------------- Tool: FastQC Section: Per Sequence GC Content Section description: The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content. Section help text: From the FastQC help: This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content. In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution. An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be. Title: FastQC: Per Sequence GC Content Plot type: x/y line X axis: % GC Y axis: Percentage ### Percentages Samples: SRR6995993, SRR6995994, SRR6995995, SRR6995996, SRR6995997, SRR6995998 Y values are in % X values are in % SRR6995993 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 1, 26: 1, 27: 2, 28: 2, 29: 3, 30: 3, 31: 4, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 4, 38: 4, 39: 4, 40: 4, 41: 4, 42: 4, 43: 4, 44: 3, 45: 3, 46: 3, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 0, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 1, 26: 1, 27: 2, 28: 2, 29: 3, 30: 3, 31: 4, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 4, 38: 4, 39: 4, 40: 4, 41: 4, 42: 4, 43: 4, 44: 3, 45: 3, 46: 3, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 0, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 1, 26: 1, 27: 2, 28: 2, 29: 3, 30: 3, 31: 4, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 4, 38: 4, 39: 4, 40: 4, 41: 4, 42: 4, 43: 4, 44: 3, 45: 3, 46: 3, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 0, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 1, 26: 1, 27: 2, 28: 2, 29: 3, 30: 3, 31: 4, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 4, 38: 4, 39: 4, 40: 4, 41: 4, 42: 4, 43: 4, 44: 3, 45: 3, 46: 3, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 0, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0 SRR6995994 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 0, 27: 0, 28: 0, 29: 0, 30: 0, 31: 0, 32: 0, 33: 0, 34: 0, 35: 0, 36: 0, 37: 1, 38: 1, 39: 2, 40: 4, 41: 5, 42: 6, 43: 7, 44: 8, 45: 8, 46: 8, 47: 7, 48: 6, 49: 5, 50: 4, 51: 3, 52: 2, 53: 2, 54: 1, 55: 1, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 0, 27: 0, 28: 0, 29: 0, 30: 0, 31: 0, 32: 0, 33: 0, 34: 0, 35: 0, 36: 0, 37: 1, 38: 1, 39: 2, 40: 4, 41: 5, 42: 6, 43: 7, 44: 8, 45: 8, 46: 8, 47: 7, 48: 6, 49: 5, 50: 4, 51: 3, 52: 2, 53: 2, 54: 1, 55: 1, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 0, 27: 0, 28: 0, 29: 0, 30: 0, 31: 0, 32: 0, 33: 0, 34: 0, 35: 0, 36: 0, 37: 1, 38: 1, 39: 2, 40: 4, 41: 5, 42: 6, 43: 7, 44: 8, 45: 8, 46: 8, 47: 7, 48: 6, 49: 5, 50: 4, 51: 3, 52: 2, 53: 2, 54: 1, 55: 1, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 0, 27: 0, 28: 0, 29: 0, 30: 0, 31: 0, 32: 0, 33: 0, 34: 0, 35: 0, 36: 0, 37: 1, 38: 1, 39: 2, 40: 4, 41: 5, 42: 6, 43: 7, 44: 8, 45: 8, 46: 8, 47: 7, 48: 6, 49: 5, 50: 4, 51: 3, 52: 2, 53: 2, 54: 1, 55: 1, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0 SRR6995995 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 1, 27: 1, 28: 2, 29: 2, 30: 3, 31: 3, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 4, 38: 4, 39: 4, 40: 4, 41: 4, 42: 4, 43: 4, 44: 4, 45: 4, 46: 3, 47: 3, 48: 2, 49: 2, 50: 2, 51: 1, 52: 1, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 1, 27: 1, 28: 2, 29: 2, 30: 3, 31: 3, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 4, 38: 4, 39: 4, 40: 4, 41: 4, 42: 4, 43: 4, 44: 4, 45: 4, 46: 3, 47: 3, 48: 2, 49: 2, 50: 2, 51: 1, 52: 1, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 1, 27: 1, 28: 2, 29: 2, 30: 3, 31: 3, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 4, 38: 4, 39: 4, 40: 4, 41: 4, 42: 4, 43: 4, 44: 4, 45: 4, 46: 3, 47: 3, 48: 2, 49: 2, 50: 2, 51: 1, 52: 1, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 1, 27: 1, 28: 2, 29: 2, 30: 3, 31: 3, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 4, 38: 4, 39: 4, 40: 4, 41: 4, 42: 4, 43: 4, 44: 4, 45: 4, 46: 3, 47: 3, 48: 2, 49: 2, 50: 2, 51: 1, 52: 1, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0 SRR6995996 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 1, 24: 1, 25: 2, 26: 2, 27: 2, 28: 3, 29: 3, 30: 3, 31: 4, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 3, 38: 3, 39: 3, 40: 3, 41: 3, 42: 3, 43: 3, 44: 3, 45: 3, 46: 2, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 0, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 1, 24: 1, 25: 2, 26: 2, 27: 2, 28: 3, 29: 3, 30: 3, 31: 4, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 3, 38: 3, 39: 3, 40: 3, 41: 3, 42: 3, 43: 3, 44: 3, 45: 3, 46: 2, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 0, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 1, 24: 1, 25: 2, 26: 2, 27: 2, 28: 3, 29: 3, 30: 3, 31: 4, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 3, 38: 3, 39: 3, 40: 3, 41: 3, 42: 3, 43: 3, 44: 3, 45: 3, 46: 2, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 0, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 1, 24: 1, 25: 2, 26: 2, 27: 2, 28: 3, 29: 3, 30: 3, 31: 4, 32: 4, 33: 4, 34: 4, 35: 4, 36: 4, 37: 3, 38: 3, 39: 3, 40: 3, 41: 3, 42: 3, 43: 3, 44: 3, 45: 3, 46: 2, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 0, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0 SRR6995997 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 0, 27: 0, 28: 0, 29: 0, 30: 0, 31: 0, 32: 0, 33: 1, 34: 1, 35: 2, 36: 2, 37: 3, 38: 4, 39: 5, 40: 5, 41: 6, 42: 6, 43: 7, 44: 7, 45: 6, 46: 6, 47: 5, 48: 4, 49: 3, 50: 3, 51: 3, 52: 2, 53: 1, 54: 1, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 0, 27: 0, 28: 0, 29: 0, 30: 0, 31: 0, 32: 0, 33: 1, 34: 1, 35: 2, 36: 2, 37: 3, 38: 4, 39: 5, 40: 5, 41: 6, 42: 6, 43: 7, 44: 7, 45: 6, 46: 6, 47: 5, 48: 4, 49: 3, 50: 3, 51: 3, 52: 2, 53: 1, 54: 1, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 0, 27: 0, 28: 0, 29: 0, 30: 0, 31: 0, 32: 0, 33: 1, 34: 1, 35: 2, 36: 2, 37: 3, 38: 4, 39: 5, 40: 5, 41: 6, 42: 6, 43: 7, 44: 7, 45: 6, 46: 6, 47: 5, 48: 4, 49: 3, 50: 3, 51: 3, 52: 2, 53: 1, 54: 1, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 0, 23: 0, 24: 0, 25: 0, 26: 0, 27: 0, 28: 0, 29: 0, 30: 0, 31: 0, 32: 0, 33: 1, 34: 1, 35: 2, 36: 2, 37: 3, 38: 4, 39: 5, 40: 5, 41: 6, 42: 6, 43: 7, 44: 7, 45: 6, 46: 6, 47: 5, 48: 4, 49: 3, 50: 3, 51: 3, 52: 2, 53: 1, 54: 1, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0 SRR6995998 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 1, 23: 1, 24: 1, 25: 2, 26: 2, 27: 3, 28: 3, 29: 4, 30: 4, 31: 4, 32: 4, 33: 4, 34: 4, 35: 3, 36: 3, 37: 3, 38: 3, 39: 3, 40: 3, 41: 3, 42: 3, 43: 3, 44: 3, 45: 2, 46: 2, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 1, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 1, 23: 1, 24: 1, 25: 2, 26: 2, 27: 3, 28: 3, 29: 4, 30: 4, 31: 4, 32: 4, 33: 4, 34: 4, 35: 3, 36: 3, 37: 3, 38: 3, 39: 3, 40: 3, 41: 3, 42: 3, 43: 3, 44: 3, 45: 2, 46: 2, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 1, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 1, 23: 1, 24: 1, 25: 2, 26: 2, 27: 3, 28: 3, 29: 4, 30: 4, 31: 4, 32: 4, 33: 4, 34: 4, 35: 3, 36: 3, 37: 3, 38: 3, 39: 3, 40: 3, 41: 3, 42: 3, 43: 3, 44: 3, 45: 2, 46: 2, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 1, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0, 0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 11: 0, 12: 0, 13: 0, 14: 0, 15: 0, 16: 0, 17: 0, 18: 0, 19: 0, 20: 0, 21: 0, 22: 1, 23: 1, 24: 1, 25: 2, 26: 2, 27: 3, 28: 3, 29: 4, 30: 4, 31: 4, 32: 4, 33: 4, 34: 4, 35: 3, 36: 3, 37: 3, 38: 3, 39: 3, 40: 3, 41: 3, 42: 3, 43: 3, 44: 3, 45: 2, 46: 2, 47: 2, 48: 2, 49: 1, 50: 1, 51: 1, 52: 1, 53: 0, 54: 0, 55: 0, 56: 0, 57: 0, 58: 0, 59: 0, 60: 0, 61: 0, 62: 0, 63: 0, 64: 0, 65: 0, 66: 0, 67: 0, 68: 0, 69: 0, 70: 0, 71: 0, 72: 0, 73: 0, 74: 0, 75: 0, 76: 0, 77: 0, 78: 0, 79: 0, 80: 0, 81: 0, 82: 0, 83: 0, 84: 0, 85: 0, 86: 0, 87: 0, 88: 0, 89: 0, 90: 0, 91: 0, 92: 0, 93: 0, 94: 0, 95: 0, 96: 0, 97: 0, 98: 0, 99: 0, 100: 0 ### Counts Samples: SRR6995993, SRR6995994, SRR6995995, SRR6995996, SRR6995997, SRR6995998 X values are in % SRR6995993 0: 1, 1: 1, 2: 3, 3: 3, 4: 7, 5: 18, 6: 30, 7: 32, 8: 60, 9: 104, 10: 178, 11: 307, 12: 560, 13: 1,074, 14: 2,048, 15: 3,590, 16: 5,817, 17: 9,073, 18: 13,874, 19: 21,081, 20: 32,128, 21: 49,634, 22: 77,292, 23: 121,188, 24: 187,103, 25: 277,592, 26: 395,473, 27: 539,101, 28: 698,682, 29: 855,906, 30: 995,193, 31: 1,110,403, 32: 1,195,373, 33: 1,247,075, 34: 1,262,085, 35: 1,250,199, 36: 1,222,160, 37: 1,185,903, 38: 1,154,268, 39: 1,130,719, 40: 1,115,624, 41: 1,101,944, 42: 1,081,839, 43: 1,047,354, 44: 993,930, 45: 919,707, 46: 824,982, 47: 719,308, 48: 606,907, 49: 498,488, 50: 408,437, 51: 328,902, 52: 248,564, 53: 180,182, 54: 133,199, 55: 99,732, 56: 75,394, 57: 57,804, 58: 45,122, 59: 35,982, 60: 29,434, 61: 24,486, 62: 20,560, 63: 17,577, 64: 14,890, 65: 12,516, 66: 10,711, 67: 9,186, 68: 7,835, 69: 6,585, 70: 5,509, 71: 4,679, 72: 3,961, 73: 3,196, 74: 2,513, 75: 2,014, 76: 1,589, 77: 1,237, 78: 982, 79: 769, 80: 602, 81: 486, 82: 398, 83: 320, 84: 281, 85: 238, 86: 199, 87: 194, 88: 176, 89: 154, 90: 126, 91: 104, 92: 93, 93: 80, 94: 64, 95: 46, 96: 35, 97: 21, 98: 13, 99: 8, 100: 2, 0: 1, 1: 1, 2: 3, 3: 3, 4: 7, 5: 18, 6: 30, 7: 32, 8: 60, 9: 104, 10: 178, 11: 307, 12: 560, 13: 1,074, 14: 2,048, 15: 3,590, 16: 5,817, 17: 9,073, 18: 13,874, 19: 21,081, 20: 32,128, 21: 49,634, 22: 77,292, 23: 121,188, 24: 187,103, 25: 277,592, 26: 395,473, 27: 539,101, 28: 698,682, 29: 855,906, 30: 995,193, 31: 1,110,403, 32: 1,195,373, 33: 1,247,075, 34: 1,262,085, 35: 1,250,199, 36: 1,222,160, 37: 1,185,903, 38: 1,154,268, 39: 1,130,719, 40: 1,115,624, 41: 1,101,944, 42: 1,081,839, 43: 1,047,354, 44: 993,930, 45: 919,707, 46: 824,982, 47: 719,308, 48: 606,907, 49: 498,488, 50: 408,437, 51: 328,902, 52: 248,564, 53: 180,182, 54: 133,199, 55: 99,732, 56: 75,394, 57: 57,804, 58: 45,122, 59: 35,982, 60: 29,434, 61: 24,486, 62: 20,560, 63: 17,577, 64: 14,890, 65: 12,516, 66: 10,711, 67: 9,186, 68: 7,835, 69: 6,585, 70: 5,509, 71: 4,679, 72: 3,961, 73: 3,196, 74: 2,513, 75: 2,014, 76: 1,589, 77: 1,237, 78: 982, 79: 769, 80: 602, 81: 486, 82: 398, 83: 320, 84: 281, 85: 238, 86: 199, 87: 194, 88: 176, 89: 154, 90: 126, 91: 104, 92: 93, 93: 80, 94: 64, 95: 46, 96: 35, 97: 21, 98: 13, 99: 8, 100: 2, 0: 1, 1: 1, 2: 3, 3: 3, 4: 7, 5: 18, 6: 30, 7: 32, 8: 60, 9: 104, 10: 178, 11: 307, 12: 560, 13: 1,074, 14: 2,048, 15: 3,590, 16: 5,817, 17: 9,073, 18: 13,874, 19: 21,081, 20: 32,128, 21: 49,634, 22: 77,292, 23: 121,188, 24: 187,103, 25: 277,592, 26: 395,473, 27: 539,101, 28: 698,682, 29: 855,906, 30: 995,193, 31: 1,110,403, 32: 1,195,373, 33: 1,247,075, 34: 1,262,085, 35: 1,250,199, 36: 1,222,160, 37: 1,185,903, 38: 1,154,268, 39: 1,130,719, 40: 1,115,624, 41: 1,101,944, 42: 1,081,839, 43: 1,047,354, 44: 993,930, 45: 919,707, 46: 824,982, 47: 719,308, 48: 606,907, 49: 498,488, 50: 408,437, 51: 328,902, 52: 248,564, 53: 180,182, 54: 133,199, 55: 99,732, 56: 75,394, 57: 57,804, 58: 45,122, 59: 35,982, 60: 29,434, 61: 24,486, 62: 20,560, 63: 17,577, 64: 14,890, 65: 12,516, 66: 10,711, 67: 9,186, 68: 7,835, 69: 6,585, 70: 5,509, 71: 4,679, 72: 3,961, 73: 3,196, 74: 2,513, 75: 2,014, 76: 1,589, 77: 1,237, 78: 982, 79: 769, 80: 602, 81: 486, 82: 398, 83: 320, 84: 281, 85: 238, 86: 199, 87: 194, 88: 176, 89: 154, 90: 126, 91: 104, 92: 93, 93: 80, 94: 64, 95: 46, 96: 35, 97: 21, 98: 13, 99: 8, 100: 2, 0: 1, 1: 1, 2: 3, 3: 3, 4: 7, 5: 18, 6: 30, 7: 32, 8: 60, 9: 104, 10: 178, 11: 307, 12: 560, 13: 1,074, 14: 2,048, 15: 3,590, 16: 5,817, 17: 9,073, 18: 13,874, 19: 21,081, 20: 32,128, 21: 49,634, 22: 77,292, 23: 121,188, 24: 187,103, 25: 277,592, 26: 395,473, 27: 539,101, 28: 698,682, 29: 855,906, 30: 995,193, 31: 1,110,403, 32: 1,195,373, 33: 1,247,075, 34: 1,262,085, 35: 1,250,199, 36: 1,222,160, 37: 1,185,903, 38: 1,154,268, 39: 1,130,719, 40: 1,115,624, 41: 1,101,944, 42: 1,081,839, 43: 1,047,354, 44: 993,930, 45: 919,707, 46: 824,982, 47: 719,308, 48: 606,907, 49: 498,488, 50: 408,437, 51: 328,902, 52: 248,564, 53: 180,182, 54: 133,199, 55: 99,732, 56: 75,394, 57: 57,804, 58: 45,122, 59: 35,982, 60: 29,434, 61: 24,486, 62: 20,560, 63: 17,577, 64: 14,890, 65: 12,516, 66: 10,711, 67: 9,186, 68: 7,835, 69: 6,585, 70: 5,509, 71: 4,679, 72: 3,961, 73: 3,196, 74: 2,513, 75: 2,014, 76: 1,589, 77: 1,237, 78: 982, 79: 769, 80: 602, 81: 486, 82: 398, 83: 320, 84: 281, 85: 238, 86: 199, 87: 194, 88: 176, 89: 154, 90: 126, 91: 104, 92: 93, 93: 80, 94: 64, 95: 46, 96: 35, 97: 21, 98: 13, 99: 8, 100: 2 SRR6995994 0: 0, 1: 0, 2: 0, 3: 0, 4: 1, 5: 1, 6: 0, 7: 1, 8: 2, 9: 2, 10: 4, 11: 5, 12: 11, 13: 16, 14: 28, 15: 44, 16: 66, 17: 90, 18: 121, 19: 171, 20: 225, 21: 312, 22: 427, 23: 571, 24: 782, 25: 1,012, 26: 1,332, 27: 1,813, 28: 2,365, 29: 3,078, 30: 4,106, 31: 5,712, 32: 8,127, 33: 12,709, 34: 21,142, 35: 35,523, 36: 61,209, 37: 105,010, 38: 173,938, 39: 268,359, 40: 383,633, 41: 508,513, 42: 623,806, 43: 714,603, 44: 768,938, 45: 781,292, 46: 752,601, 47: 691,256, 48: 606,414, 49: 507,687, 50: 412,622, 51: 328,683, 52: 254,660, 53: 193,725, 54: 147,044, 55: 112,071, 56: 87,359, 57: 70,724, 58: 59,156, 59: 51,022, 60: 45,264, 61: 41,029, 62: 37,596, 63: 34,381, 64: 32,183, 65: 30,546, 66: 28,862, 67: 26,435, 68: 23,690, 69: 21,798, 70: 19,703, 71: 17,087, 72: 14,326, 73: 11,851, 74: 9,702, 75: 7,730, 76: 5,866, 77: 4,375, 78: 3,276, 79: 2,336, 80: 1,661, 81: 1,186, 82: 847, 83: 585, 84: 442, 85: 356, 86: 305, 87: 255, 88: 205, 89: 182, 90: 165, 91: 136, 92: 119, 93: 98, 94: 66, 95: 53, 96: 42, 97: 27, 98: 14, 99: 6, 100: 1, 0: 0, 1: 0, 2: 0, 3: 0, 4: 1, 5: 1, 6: 0, 7: 1, 8: 2, 9: 2, 10: 4, 11: 5, 12: 11, 13: 16, 14: 28, 15: 44, 16: 66, 17: 90, 18: 121, 19: 171, 20: 225, 21: 312, 22: 427, 23: 571, 24: 782, 25: 1,012, 26: 1,332, 27: 1,813, 28: 2,365, 29: 3,078, 30: 4,106, 31: 5,712, 32: 8,127, 33: 12,709, 34: 21,142, 35: 35,523, 36: 61,209, 37: 105,010, 38: 173,938, 39: 268,359, 40: 383,633, 41: 508,513, 42: 623,806, 43: 714,603, 44: 768,938, 45: 781,292, 46: 752,601, 47: 691,256, 48: 606,414, 49: 507,687, 50: 412,622, 51: 328,683, 52: 254,660, 53: 193,725, 54: 147,044, 55: 112,071, 56: 87,359, 57: 70,724, 58: 59,156, 59: 51,022, 60: 45,264, 61: 41,029, 62: 37,596, 63: 34,381, 64: 32,183, 65: 30,546, 66: 28,862, 67: 26,435, 68: 23,690, 69: 21,798, 70: 19,703, 71: 17,087, 72: 14,326, 73: 11,851, 74: 9,702, 75: 7,730, 76: 5,866, 77: 4,375, 78: 3,276, 79: 2,336, 80: 1,661, 81: 1,186, 82: 847, 83: 585, 84: 442, 85: 356, 86: 305, 87: 255, 88: 205, 89: 182, 90: 165, 91: 136, 92: 119, 93: 98, 94: 66, 95: 53, 96: 42, 97: 27, 98: 14, 99: 6, 100: 1, 0: 0, 1: 0, 2: 0, 3: 0, 4: 1, 5: 1, 6: 0, 7: 1, 8: 2, 9: 2, 10: 4, 11: 5, 12: 11, 13: 16, 14: 28, 15: 44, 16: 66, 17: 90, 18: 121, 19: 171, 20: 225, 21: 312, 22: 427, 23: 571, 24: 782, 25: 1,012, 26: 1,332, 27: 1,813, 28: 2,365, 29: 3,078, 30: 4,106, 31: 5,712, 32: 8,127, 33: 12,709, 34: 21,142, 35: 35,523, 36: 61,209, 37: 105,010, 38: 173,938, 39: 268,359, 40: 383,633, 41: 508,513, 42: 623,806, 43: 714,603, 44: 768,938, 45: 781,292, 46: 752,601, 47: 691,256, 48: 606,414, 49: 507,687, 50: 412,622, 51: 328,683, 52: 254,660, 53: 193,725, 54: 147,044, 55: 112,071, 56: 87,359, 57: 70,724, 58: 59,156, 59: 51,022, 60: 45,264, 61: 41,029, 62: 37,596, 63: 34,381, 64: 32,183, 65: 30,546, 66: 28,862, 67: 26,435, 68: 23,690, 69: 21,798, 70: 19,703, 71: 17,087, 72: 14,326, 73: 11,851, 74: 9,702, 75: 7,730, 76: 5,866, 77: 4,375, 78: 3,276, 79: 2,336, 80: 1,661, 81: 1,186, 82: 847, 83: 585, 84: 442, 85: 356, 86: 305, 87: 255, 88: 205, 89: 182, 90: 165, 91: 136, 92: 119, 93: 98, 94: 66, 95: 53, 96: 42, 97: 27, 98: 14, 99: 6, 100: 1, 0: 0, 1: 0, 2: 0, 3: 0, 4: 1, 5: 1, 6: 0, 7: 1, 8: 2, 9: 2, 10: 4, 11: 5, 12: 11, 13: 16, 14: 28, 15: 44, 16: 66, 17: 90, 18: 121, 19: 171, 20: 225, 21: 312, 22: 427, 23: 571, 24: 782, 25: 1,012, 26: 1,332, 27: 1,813, 28: 2,365, 29: 3,078, 30: 4,106, 31: 5,712, 32: 8,127, 33: 12,709, 34: 21,142, 35: 35,523, 36: 61,209, 37: 105,010, 38: 173,938, 39: 268,359, 40: 383,633, 41: 508,513, 42: 623,806, 43: 714,603, 44: 768,938, 45: 781,292, 46: 752,601, 47: 691,256, 48: 606,414, 49: 507,687, 50: 412,622, 51: 328,683, 52: 254,660, 53: 193,725, 54: 147,044, 55: 112,071, 56: 87,359, 57: 70,724, 58: 59,156, 59: 51,022, 60: 45,264, 61: 41,029, 62: 37,596, 63: 34,381, 64: 32,183, 65: 30,546, 66: 28,862, 67: 26,435, 68: 23,690, 69: 21,798, 70: 19,703, 71: 17,087, 72: 14,326, 73: 11,851, 74: 9,702, 75: 7,730, 76: 5,866, 77: 4,375, 78: 3,276, 79: 2,336, 80: 1,661, 81: 1,186, 82: 847, 83: 585, 84: 442, 85: 356, 86: 305, 87: 255, 88: 205, 89: 182, 90: 165, 91: 136, 92: 119, 93: 98, 94: 66, 95: 53, 96: 42, 97: 27, 98: 14, 99: 6, 100: 1 SRR6995995 0: 1, 1: 3, 2: 2, 3: 4, 4: 9, 5: 11, 6: 18, 7: 32, 8: 47, 9: 86, 10: 137, 11: 202, 12: 323, 13: 601, 14: 1,094, 15: 1,911, 16: 3,336, 17: 5,657, 18: 9,129, 19: 14,474, 20: 23,209, 21: 38,539, 22: 66,184, 23: 114,480, 24: 194,305, 25: 315,674, 26: 482,578, 27: 688,056, 28: 914,865, 29: 1,142,162, 30: 1,344,760, 31: 1,508,085, 32: 1,640,834, 33: 1,735,524, 34: 1,777,152, 35: 1,778,942, 36: 1,758,301, 37: 1,732,753, 38: 1,721,150, 39: 1,725,285, 40: 1,750,636, 41: 1,788,147, 42: 1,810,928, 43: 1,798,995, 44: 1,738,386, 45: 1,632,113, 46: 1,486,002, 47: 1,307,818, 48: 1,112,648, 49: 934,021, 50: 798,582, 51: 670,016, 52: 509,887, 53: 364,953, 54: 269,645, 55: 202,867, 56: 155,034, 57: 121,010, 58: 95,662, 59: 77,029, 60: 62,944, 61: 52,457, 62: 44,785, 63: 38,474, 64: 32,975, 65: 28,355, 66: 24,510, 67: 21,253, 68: 18,733, 69: 16,314, 70: 13,996, 71: 11,994, 72: 10,132, 73: 8,366, 74: 6,761, 75: 5,378, 76: 4,216, 77: 3,253, 78: 2,468, 79: 1,873, 80: 1,361, 81: 999, 82: 784, 83: 611, 84: 483, 85: 392, 86: 337, 87: 307, 88: 267, 89: 221, 90: 184, 91: 169, 92: 143, 93: 115, 94: 96, 95: 71, 96: 53, 97: 36, 98: 22, 99: 11, 100: 2, 0: 1, 1: 3, 2: 2, 3: 4, 4: 9, 5: 11, 6: 18, 7: 32, 8: 47, 9: 86, 10: 137, 11: 202, 12: 323, 13: 601, 14: 1,094, 15: 1,911, 16: 3,336, 17: 5,657, 18: 9,129, 19: 14,474, 20: 23,209, 21: 38,539, 22: 66,184, 23: 114,480, 24: 194,305, 25: 315,674, 26: 482,578, 27: 688,056, 28: 914,865, 29: 1,142,162, 30: 1,344,760, 31: 1,508,085, 32: 1,640,834, 33: 1,735,524, 34: 1,777,152, 35: 1,778,942, 36: 1,758,301, 37: 1,732,753, 38: 1,721,150, 39: 1,725,285, 40: 1,750,636, 41: 1,788,147, 42: 1,810,928, 43: 1,798,995, 44: 1,738,386, 45: 1,632,113, 46: 1,486,002, 47: 1,307,818, 48: 1,112,648, 49: 934,021, 50: 798,582, 51: 670,016, 52: 509,887, 53: 364,953, 54: 269,645, 55: 202,867, 56: 155,034, 57: 121,010, 58: 95,662, 59: 77,029, 60: 62,944, 61: 52,457, 62: 44,785, 63: 38,474, 64: 32,975, 65: 28,355, 66: 24,510, 67: 21,253, 68: 18,733, 69: 16,314, 70: 13,996, 71: 11,994, 72: 10,132, 73: 8,366, 74: 6,761, 75: 5,378, 76: 4,216, 77: 3,253, 78: 2,468, 79: 1,873, 80: 1,361, 81: 999, 82: 784, 83: 611, 84: 483, 85: 392, 86: 337, 87: 307, 88: 267, 89: 221, 90: 184, 91: 169, 92: 143, 93: 115, 94: 96, 95: 71, 96: 53, 97: 36, 98: 22, 99: 11, 100: 2, 0: 1, 1: 3, 2: 2, 3: 4, 4: 9, 5: 11, 6: 18, 7: 32, 8: 47, 9: 86, 10: 137, 11: 202, 12: 323, 13: 601, 14: 1,094, 15: 1,911, 16: 3,336, 17: 5,657, 18: 9,129, 19: 14,474, 20: 23,209, 21: 38,539, 22: 66,184, 23: 114,480, 24: 194,305, 25: 315,674, 26: 482,578, 27: 688,056, 28: 914,865, 29: 1,142,162, 30: 1,344,760, 31: 1,508,085, 32: 1,640,834, 33: 1,735,524, 34: 1,777,152, 35: 1,778,942, 36: 1,758,301, 37: 1,732,753, 38: 1,721,150, 39: 1,725,285, 40: 1,750,636, 41: 1,788,147, 42: 1,810,928, 43: 1,798,995, 44: 1,738,386, 45: 1,632,113, 46: 1,486,002, 47: 1,307,818, 48: 1,112,648, 49: 934,021, 50: 798,582, 51: 670,016, 52: 509,887, 53: 364,953, 54: 269,645, 55: 202,867, 56: 155,034, 57: 121,010, 58: 95,662, 59: 77,029, 60: 62,944, 61: 52,457, 62: 44,785, 63: 38,474, 64: 32,975, 65: 28,355, 66: 24,510, 67: 21,253, 68: 18,733, 69: 16,314, 70: 13,996, 71: 11,994, 72: 10,132, 73: 8,366, 74: 6,761, 75: 5,378, 76: 4,216, 77: 3,253, 78: 2,468, 79: 1,873, 80: 1,361, 81: 999, 82: 784, 83: 611, 84: 483, 85: 392, 86: 337, 87: 307, 88: 267, 89: 221, 90: 184, 91: 169, 92: 143, 93: 115, 94: 96, 95: 71, 96: 53, 97: 36, 98: 22, 99: 11, 100: 2, 0: 1, 1: 3, 2: 2, 3: 4, 4: 9, 5: 11, 6: 18, 7: 32, 8: 47, 9: 86, 10: 137, 11: 202, 12: 323, 13: 601, 14: 1,094, 15: 1,911, 16: 3,336, 17: 5,657, 18: 9,129, 19: 14,474, 20: 23,209, 21: 38,539, 22: 66,184, 23: 114,480, 24: 194,305, 25: 315,674, 26: 482,578, 27: 688,056, 28: 914,865, 29: 1,142,162, 30: 1,344,760, 31: 1,508,085, 32: 1,640,834, 33: 1,735,524, 34: 1,777,152, 35: 1,778,942, 36: 1,758,301, 37: 1,732,753, 38: 1,721,150, 39: 1,725,285, 40: 1,750,636, 41: 1,788,147, 42: 1,810,928, 43: 1,798,995, 44: 1,738,386, 45: 1,632,113, 46: 1,486,002, 47: 1,307,818, 48: 1,112,648, 49: 934,021, 50: 798,582, 51: 670,016, 52: 509,887, 53: 364,953, 54: 269,645, 55: 202,867, 56: 155,034, 57: 121,010, 58: 95,662, 59: 77,029, 60: 62,944, 61: 52,457, 62: 44,785, 63: 38,474, 64: 32,975, 65: 28,355, 66: 24,510, 67: 21,253, 68: 18,733, 69: 16,314, 70: 13,996, 71: 11,994, 72: 10,132, 73: 8,366, 74: 6,761, 75: 5,378, 76: 4,216, 77: 3,253, 78: 2,468, 79: 1,873, 80: 1,361, 81: 999, 82: 784, 83: 611, 84: 483, 85: 392, 86: 337, 87: 307, 88: 267, 89: 221, 90: 184, 91: 169, 92: 143, 93: 115, 94: 96, 95: 71, 96: 53, 97: 36, 98: 22, 99: 11, 100: 2 SRR6995996 0: 24, 1: 25, 2: 37, 3: 56, 4: 102, 5: 161, 6: 240, 7: 391, 8: 641, 9: 1,166, 10: 2,285, 11: 4,518, 12: 8,542, 13: 14,956, 14: 24,746, 15: 37,682, 16: 54,214, 17: 75,353, 18: 102,374, 19: 138,442, 20: 185,712, 21: 248,177, 22: 330,463, 23: 433,664, 24: 555,963, 25: 692,160, 26: 836,932, 27: 982,560, 28: 1,118,488, 29: 1,235,419, 30: 1,326,202, 31: 1,389,961, 32: 1,428,558, 33: 1,440,659, 34: 1,424,086, 35: 1,390,541, 36: 1,345,807, 37: 1,296,827, 38: 1,259,560, 39: 1,233,136, 40: 1,218,840, 41: 1,214,156, 42: 1,201,131, 43: 1,166,789, 44: 1,111,184, 45: 1,035,893, 46: 937,504, 47: 822,648, 48: 701,814, 49: 583,286, 50: 476,784, 51: 384,468, 52: 305,467, 53: 243,273, 54: 197,352, 55: 161,816, 56: 134,882, 57: 114,352, 58: 99,058, 59: 87,952, 60: 78,590, 61: 70,586, 62: 63,921, 63: 57,366, 64: 50,910, 65: 45,067, 66: 39,068, 67: 33,026, 68: 27,630, 69: 23,088, 70: 19,031, 71: 15,496, 72: 12,552, 73: 9,954, 74: 7,871, 75: 6,312, 76: 4,987, 77: 3,938, 78: 3,277, 79: 2,722, 80: 2,184, 81: 1,850, 82: 1,621, 83: 1,385, 84: 1,210, 85: 1,075, 86: 963, 87: 781, 88: 667, 89: 614, 90: 517, 91: 423, 92: 359, 93: 273, 94: 205, 95: 165, 96: 106, 97: 65, 98: 41, 99: 20, 100: 6, 0: 24, 1: 25, 2: 37, 3: 56, 4: 102, 5: 161, 6: 240, 7: 391, 8: 641, 9: 1,166, 10: 2,285, 11: 4,518, 12: 8,542, 13: 14,956, 14: 24,746, 15: 37,682, 16: 54,214, 17: 75,353, 18: 102,374, 19: 138,442, 20: 185,712, 21: 248,177, 22: 330,463, 23: 433,664, 24: 555,963, 25: 692,160, 26: 836,932, 27: 982,560, 28: 1,118,488, 29: 1,235,419, 30: 1,326,202, 31: 1,389,961, 32: 1,428,558, 33: 1,440,659, 34: 1,424,086, 35: 1,390,541, 36: 1,345,807, 37: 1,296,827, 38: 1,259,560, 39: 1,233,136, 40: 1,218,840, 41: 1,214,156, 42: 1,201,131, 43: 1,166,789, 44: 1,111,184, 45: 1,035,893, 46: 937,504, 47: 822,648, 48: 701,814, 49: 583,286, 50: 476,784, 51: 384,468, 52: 305,467, 53: 243,273, 54: 197,352, 55: 161,816, 56: 134,882, 57: 114,352, 58: 99,058, 59: 87,952, 60: 78,590, 61: 70,586, 62: 63,921, 63: 57,366, 64: 50,910, 65: 45,067, 66: 39,068, 67: 33,026, 68: 27,630, 69: 23,088, 70: 19,031, 71: 15,496, 72: 12,552, 73: 9,954, 74: 7,871, 75: 6,312, 76: 4,987, 77: 3,938, 78: 3,277, 79: 2,722, 80: 2,184, 81: 1,850, 82: 1,621, 83: 1,385, 84: 1,210, 85: 1,075, 86: 963, 87: 781, 88: 667, 89: 614, 90: 517, 91: 423, 92: 359, 93: 273, 94: 205, 95: 165, 96: 106, 97: 65, 98: 41, 99: 20, 100: 6, 0: 24, 1: 25, 2: 37, 3: 56, 4: 102, 5: 161, 6: 240, 7: 391, 8: 641, 9: 1,166, 10: 2,285, 11: 4,518, 12: 8,542, 13: 14,956, 14: 24,746, 15: 37,682, 16: 54,214, 17: 75,353, 18: 102,374, 19: 138,442, 20: 185,712, 21: 248,177, 22: 330,463, 23: 433,664, 24: 555,963, 25: 692,160, 26: 836,932, 27: 982,560, 28: 1,118,488, 29: 1,235,419, 30: 1,326,202, 31: 1,389,961, 32: 1,428,558, 33: 1,440,659, 34: 1,424,086, 35: 1,390,541, 36: 1,345,807, 37: 1,296,827, 38: 1,259,560, 39: 1,233,136, 40: 1,218,840, 41: 1,214,156, 42: 1,201,131, 43: 1,166,789, 44: 1,111,184, 45: 1,035,893, 46: 937,504, 47: 822,648, 48: 701,814, 49: 583,286, 50: 476,784, 51: 384,468, 52: 305,467, 53: 243,273, 54: 197,352, 55: 161,816, 56: 134,882, 57: 114,352, 58: 99,058, 59: 87,952, 60: 78,590, 61: 70,586, 62: 63,921, 63: 57,366, 64: 50,910, 65: 45,067, 66: 39,068, 67: 33,026, 68: 27,630, 69: 23,088, 70: 19,031, 71: 15,496, 72: 12,552, 73: 9,954, 74: 7,871, 75: 6,312, 76: 4,987, 77: 3,938, 78: 3,277, 79: 2,722, 80: 2,184, 81: 1,850, 82: 1,621, 83: 1,385, 84: 1,210, 85: 1,075, 86: 963, 87: 781, 88: 667, 89: 614, 90: 517, 91: 423, 92: 359, 93: 273, 94: 205, 95: 165, 96: 106, 97: 65, 98: 41, 99: 20, 100: 6, 0: 24, 1: 25, 2: 37, 3: 56, 4: 102, 5: 161, 6: 240, 7: 391, 8: 641, 9: 1,166, 10: 2,285, 11: 4,518, 12: 8,542, 13: 14,956, 14: 24,746, 15: 37,682, 16: 54,214, 17: 75,353, 18: 102,374, 19: 138,442, 20: 185,712, 21: 248,177, 22: 330,463, 23: 433,664, 24: 555,963, 25: 692,160, 26: 836,932, 27: 982,560, 28: 1,118,488, 29: 1,235,419, 30: 1,326,202, 31: 1,389,961, 32: 1,428,558, 33: 1,440,659, 34: 1,424,086, 35: 1,390,541, 36: 1,345,807, 37: 1,296,827, 38: 1,259,560, 39: 1,233,136, 40: 1,218,840, 41: 1,214,156, 42: 1,201,131, 43: 1,166,789, 44: 1,111,184, 45: 1,035,893, 46: 937,504, 47: 822,648, 48: 701,814, 49: 583,286, 50: 476,784, 51: 384,468, 52: 305,467, 53: 243,273, 54: 197,352, 55: 161,816, 56: 134,882, 57: 114,352, 58: 99,058, 59: 87,952, 60: 78,590, 61: 70,586, 62: 63,921, 63: 57,366, 64: 50,910, 65: 45,067, 66: 39,068, 67: 33,026, 68: 27,630, 69: 23,088, 70: 19,031, 71: 15,496, 72: 12,552, 73: 9,954, 74: 7,871, 75: 6,312, 76: 4,987, 77: 3,938, 78: 3,277, 79: 2,722, 80: 2,184, 81: 1,850, 82: 1,621, 83: 1,385, 84: 1,210, 85: 1,075, 86: 963, 87: 781, 88: 667, 89: 614, 90: 517, 91: 423, 92: 359, 93: 273, 94: 205, 95: 165, 96: 106, 97: 65, 98: 41, 99: 20, 100: 6 SRR6995997 0: 0, 1: 0, 2: 0, 3: 0, 4: 1, 5: 2, 6: 3, 7: 3, 8: 5, 9: 12, 10: 15, 11: 21, 12: 35, 13: 53, 14: 83, 15: 135, 16: 249, 17: 405, 18: 643, 19: 956, 20: 1,328, 21: 1,778, 22: 2,353, 23: 3,148, 24: 4,272, 25: 5,808, 26: 8,084, 27: 11,839, 28: 18,097, 29: 28,475, 30: 45,947, 31: 73,845, 32: 118,011, 33: 184,158, 34: 271,761, 35: 379,626, 36: 505,323, 37: 641,095, 38: 779,886, 39: 914,759, 40: 1,036,578, 41: 1,135,268, 42: 1,204,992, 43: 1,236,907, 44: 1,220,116, 45: 1,157,508, 46: 1,057,741, 47: 934,730, 48: 802,359, 49: 689,784, 50: 612,919, 51: 529,331, 52: 399,961, 53: 275,188, 54: 196,770, 55: 144,872, 56: 110,229, 57: 86,519, 58: 69,898, 59: 57,998, 60: 49,463, 61: 43,149, 62: 38,260, 63: 34,052, 64: 30,264, 65: 26,728, 66: 23,715, 67: 21,060, 68: 18,392, 69: 15,746, 70: 13,247, 71: 10,996, 72: 9,016, 73: 7,272, 74: 5,706, 75: 4,370, 76: 3,314, 77: 2,474, 78: 1,816, 79: 1,400, 80: 1,057, 81: 771, 82: 585, 83: 456, 84: 359, 85: 283, 86: 254, 87: 213, 88: 161, 89: 150, 90: 133, 91: 108, 92: 86, 93: 72, 94: 64, 95: 48, 96: 32, 97: 19, 98: 9, 99: 4, 100: 1, 0: 0, 1: 0, 2: 0, 3: 0, 4: 1, 5: 2, 6: 3, 7: 3, 8: 5, 9: 12, 10: 15, 11: 21, 12: 35, 13: 53, 14: 83, 15: 135, 16: 249, 17: 405, 18: 643, 19: 956, 20: 1,328, 21: 1,778, 22: 2,353, 23: 3,148, 24: 4,272, 25: 5,808, 26: 8,084, 27: 11,839, 28: 18,097, 29: 28,475, 30: 45,947, 31: 73,845, 32: 118,011, 33: 184,158, 34: 271,761, 35: 379,626, 36: 505,323, 37: 641,095, 38: 779,886, 39: 914,759, 40: 1,036,578, 41: 1,135,268, 42: 1,204,992, 43: 1,236,907, 44: 1,220,116, 45: 1,157,508, 46: 1,057,741, 47: 934,730, 48: 802,359, 49: 689,784, 50: 612,919, 51: 529,331, 52: 399,961, 53: 275,188, 54: 196,770, 55: 144,872, 56: 110,229, 57: 86,519, 58: 69,898, 59: 57,998, 60: 49,463, 61: 43,149, 62: 38,260, 63: 34,052, 64: 30,264, 65: 26,728, 66: 23,715, 67: 21,060, 68: 18,392, 69: 15,746, 70: 13,247, 71: 10,996, 72: 9,016, 73: 7,272, 74: 5,706, 75: 4,370, 76: 3,314, 77: 2,474, 78: 1,816, 79: 1,400, 80: 1,057, 81: 771, 82: 585, 83: 456, 84: 359, 85: 283, 86: 254, 87: 213, 88: 161, 89: 150, 90: 133, 91: 108, 92: 86, 93: 72, 94: 64, 95: 48, 96: 32, 97: 19, 98: 9, 99: 4, 100: 1, 0: 0, 1: 0, 2: 0, 3: 0, 4: 1, 5: 2, 6: 3, 7: 3, 8: 5, 9: 12, 10: 15, 11: 21, 12: 35, 13: 53, 14: 83, 15: 135, 16: 249, 17: 405, 18: 643, 19: 956, 20: 1,328, 21: 1,778, 22: 2,353, 23: 3,148, 24: 4,272, 25: 5,808, 26: 8,084, 27: 11,839, 28: 18,097, 29: 28,475, 30: 45,947, 31: 73,845, 32: 118,011, 33: 184,158, 34: 271,761, 35: 379,626, 36: 505,323, 37: 641,095, 38: 779,886, 39: 914,759, 40: 1,036,578, 41: 1,135,268, 42: 1,204,992, 43: 1,236,907, 44: 1,220,116, 45: 1,157,508, 46: 1,057,741, 47: 934,730, 48: 802,359, 49: 689,784, 50: 612,919, 51: 529,331, 52: 399,961, 53: 275,188, 54: 196,770, 55: 144,872, 56: 110,229, 57: 86,519, 58: 69,898, 59: 57,998, 60: 49,463, 61: 43,149, 62: 38,260, 63: 34,052, 64: 30,264, 65: 26,728, 66: 23,715, 67: 21,060, 68: 18,392, 69: 15,746, 70: 13,247, 71: 10,996, 72: 9,016, 73: 7,272, 74: 5,706, 75: 4,370, 76: 3,314, 77: 2,474, 78: 1,816, 79: 1,400, 80: 1,057, 81: 771, 82: 585, 83: 456, 84: 359, 85: 283, 86: 254, 87: 213, 88: 161, 89: 150, 90: 133, 91: 108, 92: 86, 93: 72, 94: 64, 95: 48, 96: 32, 97: 19, 98: 9, 99: 4, 100: 1, 0: 0, 1: 0, 2: 0, 3: 0, 4: 1, 5: 2, 6: 3, 7: 3, 8: 5, 9: 12, 10: 15, 11: 21, 12: 35, 13: 53, 14: 83, 15: 135, 16: 249, 17: 405, 18: 643, 19: 956, 20: 1,328, 21: 1,778, 22: 2,353, 23: 3,148, 24: 4,272, 25: 5,808, 26: 8,084, 27: 11,839, 28: 18,097, 29: 28,475, 30: 45,947, 31: 73,845, 32: 118,011, 33: 184,158, 34: 271,761, 35: 379,626, 36: 505,323, 37: 641,095, 38: 779,886, 39: 914,759, 40: 1,036,578, 41: 1,135,268, 42: 1,204,992, 43: 1,236,907, 44: 1,220,116, 45: 1,157,508, 46: 1,057,741, 47: 934,730, 48: 802,359, 49: 689,784, 50: 612,919, 51: 529,331, 52: 399,961, 53: 275,188, 54: 196,770, 55: 144,872, 56: 110,229, 57: 86,519, 58: 69,898, 59: 57,998, 60: 49,463, 61: 43,149, 62: 38,260, 63: 34,052, 64: 30,264, 65: 26,728, 66: 23,715, 67: 21,060, 68: 18,392, 69: 15,746, 70: 13,247, 71: 10,996, 72: 9,016, 73: 7,272, 74: 5,706, 75: 4,370, 76: 3,314, 77: 2,474, 78: 1,816, 79: 1,400, 80: 1,057, 81: 771, 82: 585, 83: 456, 84: 359, 85: 283, 86: 254, 87: 213, 88: 161, 89: 150, 90: 133, 91: 108, 92: 86, 93: 72, 94: 64, 95: 48, 96: 32, 97: 19, 98: 9, 99: 4, 100: 1 SRR6995998 0: 19, 1: 23, 2: 25, 3: 40, 4: 75, 5: 122, 6: 171, 7: 244, 8: 382, 9: 719, 10: 1,406, 11: 2,808, 12: 5,407, 13: 9,704, 14: 16,148, 15: 24,976, 16: 36,938, 17: 52,679, 18: 74,339, 19: 104,683, 20: 145,934, 21: 201,480, 22: 274,836, 23: 367,905, 24: 479,629, 25: 603,667, 26: 728,883, 27: 845,961, 28: 945,200, 29: 1,020,266, 30: 1,066,814, 31: 1,082,748, 32: 1,080,420, 33: 1,060,909, 34: 1,011,646, 35: 948,970, 36: 891,421, 37: 847,020, 38: 815,620, 39: 793,155, 40: 780,587, 41: 777,152, 42: 783,173, 43: 783,562, 44: 764,605, 45: 727,405, 46: 674,356, 47: 607,423, 48: 531,091, 49: 452,650, 50: 382,545, 51: 320,579, 52: 262,625, 53: 215,316, 54: 180,029, 55: 151,848, 56: 129,097, 57: 109,971, 58: 94,099, 59: 80,894, 60: 69,722, 61: 60,039, 62: 51,360, 63: 43,750, 64: 36,970, 65: 31,148, 66: 26,220, 67: 21,953, 68: 18,220, 69: 15,102, 70: 12,471, 71: 10,228, 72: 8,360, 73: 6,800, 74: 5,525, 75: 4,408, 76: 3,510, 77: 2,756, 78: 2,137, 79: 1,664, 80: 1,326, 81: 1,103, 82: 893, 83: 738, 84: 629, 85: 530, 86: 458, 87: 418, 88: 374, 89: 320, 90: 268, 91: 226, 92: 185, 93: 138, 94: 106, 95: 86, 96: 52, 97: 34, 98: 24, 99: 9, 100: 5, 0: 19, 1: 23, 2: 25, 3: 40, 4: 75, 5: 122, 6: 171, 7: 244, 8: 382, 9: 719, 10: 1,406, 11: 2,808, 12: 5,407, 13: 9,704, 14: 16,148, 15: 24,976, 16: 36,938, 17: 52,679, 18: 74,339, 19: 104,683, 20: 145,934, 21: 201,480, 22: 274,836, 23: 367,905, 24: 479,629, 25: 603,667, 26: 728,883, 27: 845,961, 28: 945,200, 29: 1,020,266, 30: 1,066,814, 31: 1,082,748, 32: 1,080,420, 33: 1,060,909, 34: 1,011,646, 35: 948,970, 36: 891,421, 37: 847,020, 38: 815,620, 39: 793,155, 40: 780,587, 41: 777,152, 42: 783,173, 43: 783,562, 44: 764,605, 45: 727,405, 46: 674,356, 47: 607,423, 48: 531,091, 49: 452,650, 50: 382,545, 51: 320,579, 52: 262,625, 53: 215,316, 54: 180,029, 55: 151,848, 56: 129,097, 57: 109,971, 58: 94,099, 59: 80,894, 60: 69,722, 61: 60,039, 62: 51,360, 63: 43,750, 64: 36,970, 65: 31,148, 66: 26,220, 67: 21,953, 68: 18,220, 69: 15,102, 70: 12,471, 71: 10,228, 72: 8,360, 73: 6,800, 74: 5,525, 75: 4,408, 76: 3,510, 77: 2,756, 78: 2,137, 79: 1,664, 80: 1,326, 81: 1,103, 82: 893, 83: 738, 84: 629, 85: 530, 86: 458, 87: 418, 88: 374, 89: 320, 90: 268, 91: 226, 92: 185, 93: 138, 94: 106, 95: 86, 96: 52, 97: 34, 98: 24, 99: 9, 100: 5, 0: 19, 1: 23, 2: 25, 3: 40, 4: 75, 5: 122, 6: 171, 7: 244, 8: 382, 9: 719, 10: 1,406, 11: 2,808, 12: 5,407, 13: 9,704, 14: 16,148, 15: 24,976, 16: 36,938, 17: 52,679, 18: 74,339, 19: 104,683, 20: 145,934, 21: 201,480, 22: 274,836, 23: 367,905, 24: 479,629, 25: 603,667, 26: 728,883, 27: 845,961, 28: 945,200, 29: 1,020,266, 30: 1,066,814, 31: 1,082,748, 32: 1,080,420, 33: 1,060,909, 34: 1,011,646, 35: 948,970, 36: 891,421, 37: 847,020, 38: 815,620, 39: 793,155, 40: 780,587, 41: 777,152, 42: 783,173, 43: 783,562, 44: 764,605, 45: 727,405, 46: 674,356, 47: 607,423, 48: 531,091, 49: 452,650, 50: 382,545, 51: 320,579, 52: 262,625, 53: 215,316, 54: 180,029, 55: 151,848, 56: 129,097, 57: 109,971, 58: 94,099, 59: 80,894, 60: 69,722, 61: 60,039, 62: 51,360, 63: 43,750, 64: 36,970, 65: 31,148, 66: 26,220, 67: 21,953, 68: 18,220, 69: 15,102, 70: 12,471, 71: 10,228, 72: 8,360, 73: 6,800, 74: 5,525, 75: 4,408, 76: 3,510, 77: 2,756, 78: 2,137, 79: 1,664, 80: 1,326, 81: 1,103, 82: 893, 83: 738, 84: 629, 85: 530, 86: 458, 87: 418, 88: 374, 89: 320, 90: 268, 91: 226, 92: 185, 93: 138, 94: 106, 95: 86, 96: 52, 97: 34, 98: 24, 99: 9, 100: 5, 0: 19, 1: 23, 2: 25, 3: 40, 4: 75, 5: 122, 6: 171, 7: 244, 8: 382, 9: 719, 10: 1,406, 11: 2,808, 12: 5,407, 13: 9,704, 14: 16,148, 15: 24,976, 16: 36,938, 17: 52,679, 18: 74,339, 19: 104,683, 20: 145,934, 21: 201,480, 22: 274,836, 23: 367,905, 24: 479,629, 25: 603,667, 26: 728,883, 27: 845,961, 28: 945,200, 29: 1,020,266, 30: 1,066,814, 31: 1,082,748, 32: 1,080,420, 33: 1,060,909, 34: 1,011,646, 35: 948,970, 36: 891,421, 37: 847,020, 38: 815,620, 39: 793,155, 40: 780,587, 41: 777,152, 42: 783,173, 43: 783,562, 44: 764,605, 45: 727,405, 46: 674,356, 47: 607,423, 48: 531,091, 49: 452,650, 50: 382,545, 51: 320,579, 52: 262,625, 53: 215,316, 54: 180,029, 55: 151,848, 56: 129,097, 57: 109,971, 58: 94,099, 59: 80,894, 60: 69,722, 61: 60,039, 62: 51,360, 63: 43,750, 64: 36,970, 65: 31,148, 66: 26,220, 67: 21,953, 68: 18,220, 69: 15,102, 70: 12,471, 71: 10,228, 72: 8,360, 73: 6,800, 74: 5,525, 75: 4,408, 76: 3,510, 77: 2,756, 78: 2,137, 79: 1,664, 80: 1,326, 81: 1,103, 82: 893, 83: 738, 84: 629, 85: 530, 86: 458, 87: 418, 88: 374, 89: 320, 90: 268, 91: 226, 92: 185, 93: 138, 94: 106, 95: 86, 96: 52, 97: 34, 98: 24, 99: 9, 100: 5 ---------------------- Tool: FastQC Section: Per Base N Content Section description: The percentage of base calls at each position for which an N was called. Section help text: From the FastQC help: If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called. It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls. Title: FastQC: Per Base N Content Plot type: x/y line X axis: Position in Read (bp) Y axis: Percentage N-Count Samples: SRR6995993, SRR6995994, SRR6995995, SRR6995996, SRR6995997, SRR6995998 Y values are in % X values are in bp SRR6995993 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 0, 72: 0, 74: 0, 76: 0, 78: 0, 80: 0, 82: 0, 84: 0, 86: 0, 88: 0, 90: 0, 92: 0, 94: 0, 96: 0, 98: 0, 100: 0 SRR6995994 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 0, 72: 0, 74: 0, 76: 0, 78: 0, 80: 0, 82: 0, 84: 0, 86: 0, 88: 0, 90: 0, 92: 0, 94: 0, 96: 0, 98: 0, 100: 0 SRR6995995 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 0, 72: 0, 74: 0, 76: 0, 78: 0, 80: 0, 82: 0, 84: 0, 86: 0, 88: 0, 90: 0, 92: 0, 94: 0, 96: 0, 98: 0, 100: 0 SRR6995996 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 0, 72: 0, 74: 0, 76: 0, 78: 0, 80: 0, 82: 0, 84: 0, 86: 0, 88: 0, 90: 0, 92: 0, 94: 0, 96: 0, 98: 0, 100: 0 SRR6995997 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 0, 72: 0, 74: 0, 76: 0, 78: 0, 80: 0, 82: 0, 84: 0, 86: 0, 88: 0, 90: 0, 92: 0, 94: 0, 96: 0, 98: 0, 100: 0 SRR6995998 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 0, 72: 0, 74: 0, 76: 0, 78: 0, 80: 0, 82: 0, 84: 0, 86: 0, 88: 0, 90: 0, 92: 0, 94: 0, 96: 0, 98: 0, 100: 0 ---------------------- Tool: FastQC Section: Sequence Length Distribution ---------------------- Tool: FastQC Section: Sequence Duplication Levels Section description: The relative level of duplication found for every sequence. Section help text: From the FastQC Help: In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (e.g. PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication. Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level. The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis. In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot. Title: FastQC: Sequence Duplication Levels Plot type: x/y line X axis: Sequence Duplication Level Y axis: % of Library Samples: SRR6995993, SRR6995994, SRR6995995, SRR6995996, SRR6995997, SRR6995998 Y values are in % SRR6995993 1: 53, 2: 11, 3: 4, 4: 2, 5: 1, 6: 1, 7: 0, 8: 0, 9: 0, >10: 5, >50: 0, >100: 1, >500: 0, >1k: 0, >5k: 0, >10k+: 13 SRR6995994 1: 11, 2: 3, 3: 2, 4: 1, 5: 1, 6: 1, 7: 1, 8: 0, 9: 0, >10: 6, >50: 0, >100: 1, >500: 0, >1k: 2, >5k: 1, >10k+: 60 SRR6995995 1: 54, 2: 8, 3: 3, 4: 1, 5: 1, 6: 0, 7: 0, 8: 0, 9: 0, >10: 5, >50: 1, >100: 1, >500: 0, >1k: 1, >5k: 0, >10k+: 18 SRR6995996 1: 54, 2: 13, 3: 4, 4: 2, 5: 1, 6: 1, 7: 0, 8: 0, 9: 0, >10: 5, >50: 0, >100: 0, >500: 0, >1k: 0, >5k: 0, >10k+: 12 SRR6995997 1: 28, 2: 12, 3: 6, 4: 3, 5: 2, 6: 1, 7: 1, 8: 0, 9: 0, >10: 8, >50: 1, >100: 2, >500: 0, >1k: 1, >5k: 0, >10k+: 26 SRR6995998 1: 69, 2: 5, 3: 1, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, >10: 2, >50: 0, >100: 1, >500: 0, >1k: 1, >5k: 0, >10k+: 13 ---------------------- Tool: FastQC Section: Overrepresented sequences by sample Section description: The total amount of overrepresented sequences found in each library. Section help text: FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented. Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences. From the FastQC Help: A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected. FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module. Title: FastQC: Overrepresented sequences sample summary Plot type: bar plot Values: Percentage of Total Sequences |Sample|Top overrepresented sequence|Sum of remaining overrepresented sequences| |---|---|---| |SRR6995998|10 %|2 %| |SRR6995997|20 %|5 %| |SRR6995996|9 %|2 %| |SRR6995995|14 %|3 %| |SRR6995994|47 %|12 %| |SRR6995993|10 %|2 %| ---------------------- Tool: FastQC Section: Top overrepresented sequences Section description: Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in. Title: FastQC: Top overrepresented sequences Plot type: violin plot Number of samples: 20 Metrics: Reports - Number of FastQC reports where this sequence is founds as overrepresented Occurrences - Total number of occurrences of the sequence (among the samples where the sequence is overrepresented) % of all reads - Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented) |Overrepresented sequence|Reports|Occurrences|% of all reads| |---|---|---|---| |ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC|2|109,570|0.0729| |CATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC|1|63,438|0.0422| |CATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC|1|40,329|0.0268| |CGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGT|1|234,751|0.1562| |CGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGT|1|160,649|0.1069| |CGTAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGT|1|27,094|0.0180| |GAACGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC|1|97,384|0.0648| |GAACGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC|1|65,495|0.0436| |GAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCT|1|33,606|0.0224| |GACCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC|1|244,813|0.1629| |GACCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC|1|166,296|0.1107| |GAGCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC|1|56,231|0.0374| |GATCCGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC|1|44,932|0.0299| |GATCCGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC|1|33,722|0.0224| |GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGAACAATCTCGTATGC|1|54,785|0.0365| |GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC|1|4,405,888|2.9323| |GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGAGCAATCTCGTATGC|1|31,347|0.0209| |GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC|1|2,802,757|1.8654| |GATTGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC|1|137,114|0.0913| |GATTGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC|1|91,772|0.0611| ---------------------- Tool: FastQC Section: Adapter Content Section description: The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Section help text: Note that only samples with ≥ 0.1% adapter contamination are shown. There may be several lines per sample, as one is shown for each adapter detected in the file. From the FastQC Help: The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on. Title: FastQC: Adapter Content Plot type: x/y line X axis: Position (bp) Y axis: % of Sequences Samples: SRR6995993 - illumina_universal_adapter, SRR6995993 - polya, SRR6995994 - illumina_universal_adapter, SRR6995994 - polya, SRR6995995 - illumina_universal_adapter, SRR6995995 - polya, SRR6995996 - illumina_universal_adapter, SRR6995996 - polya, SRR6995997 - illumina_universal_adapter, SRR6995997 - polya, SRR6995998 - illumina_universal_adapter, SRR6995998 - polya Y values are in % X values are in bp SRR6995993 - illumina_universal_adapter 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 1, 72: 1, 74: 1, 76: 2, 78: 2, 80: 3, 82: 4, 84: 5, 86: 6, 88: 7, 90: 8 SRR6995993 - polya 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 6, 66: 6, 68: 6, 70: 6, 72: 6, 74: 6, 76: 6, 78: 6, 80: 6, 82: 6, 84: 6, 86: 6, 88: 6, 90: 6 SRR6995994 - illumina_universal_adapter 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 1, 60: 1, 62: 1, 64: 1, 66: 2, 68: 2, 70: 2, 72: 3, 74: 3, 76: 4, 78: 5, 80: 5, 82: 6, 84: 7, 86: 7, 88: 8, 90: 9 SRR6995994 - polya 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 1, 62: 2, 64: 28, 66: 28, 68: 28, 70: 28, 72: 28, 74: 28, 76: 28, 78: 28, 80: 28, 82: 28, 84: 28, 86: 28, 88: 28, 90: 28 SRR6995995 - illumina_universal_adapter 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 0, 72: 1, 74: 1, 76: 1, 78: 2, 80: 2, 82: 3, 84: 3, 86: 4, 88: 5, 90: 6 SRR6995995 - polya 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 8, 66: 8, 68: 8, 70: 8, 72: 8, 74: 8, 76: 8, 78: 8, 80: 8, 82: 8, 84: 8, 86: 8, 88: 8, 90: 8 SRR6995996 - illumina_universal_adapter 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 0, 72: 0, 74: 0, 76: 1, 78: 1, 80: 1, 82: 1, 84: 2, 86: 2, 88: 3, 90: 3 SRR6995996 - polya 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 1, 64: 6, 66: 6, 68: 6, 70: 6, 72: 6, 74: 6, 76: 6, 78: 6, 80: 6, 82: 6, 84: 6, 86: 6, 88: 6, 90: 6 SRR6995997 - illumina_universal_adapter 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 0, 72: 0, 74: 1, 76: 1, 78: 1, 80: 1, 82: 2, 84: 2, 86: 3, 88: 4, 90: 4 SRR6995997 - polya 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 1, 64: 11, 66: 11, 68: 11, 70: 11, 72: 11, 74: 11, 76: 11, 78: 11, 80: 11, 82: 11, 84: 11, 86: 11, 88: 11, 90: 11 SRR6995998 - illumina_universal_adapter 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 0, 64: 0, 66: 0, 68: 0, 70: 0, 72: 0, 74: 0, 76: 1, 78: 1, 80: 1, 82: 1, 84: 2, 86: 2, 88: 3, 90: 3 SRR6995998 - polya 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0, 9: 0, 10: 0, 12: 0, 14: 0, 16: 0, 18: 0, 20: 0, 22: 0, 24: 0, 26: 0, 28: 0, 30: 0, 32: 0, 34: 0, 36: 0, 38: 0, 40: 0, 42: 0, 44: 0, 46: 0, 48: 0, 50: 0, 52: 0, 54: 0, 56: 0, 58: 0, 60: 0, 62: 1, 64: 6, 66: 6, 68: 6, 70: 6, 72: 6, 74: 6, 76: 6, 78: 6, 80: 6, 82: 6, 84: 6, 86: 6, 88: 6, 90: 6 ---------------------- Tool: FastQC Section: Status Checks Section description: Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red). Section help text: FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red). It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse. Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help. In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap. Title: FastQC: Status Checks Plot type: heatmap X axis: Section Name Y axis: Sample Z axis: z |Sample|Basic Statistics|Per Base Sequence Quality|Per Tile Sequence Quality|Per Sequence Quality Scores|Per Base Sequence Content|Per Sequence GC Content|Per Base N Content|Sequence Length Distribution|Sequence Duplication Levels|Overrepresented Sequences|Adapter Content| |---|---|---|---|---|---|---|---|---|---|---|---| |SRR6995993|1|1|0.5|1|0.25|0.5|1|1|0.5|0.25|0.5| |SRR6995994|1|0.25|0.5|0.5|0.25|0.25|1|1|0.25|0.25|0.25| |SRR6995995|1|0.25|0.5|1|0.25|1|1|1|0.5|0.25|0.5| |SRR6995996|1|1|0.5|1|0.25|0.5|1|1|0.5|0.25|0.5| |SRR6995997|1|0.25|0.5|1|0.25|0.5|1|1|0.25|0.25|0.25| |SRR6995998|1|1|0.5|1|0.25|0.25|1|1|1|0.25|0.5|