Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ (absolute path is '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/)' Processing sequences up to read no. 10000 from the input file Input files to be analysed (in current folder '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset'): /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_10_s1_R1_val_1.fq.gz /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_10_s1_R2_val_2.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Setting parallelization to single-threaded (default) Current working directory is: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset Now reading in and storing sequence information of the genome specified in: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_10_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_10_s1_R2_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_10_s1_R1_val_1.fq.gz Writing a C -> T converted version of the input file zr2096_10_s1_R1_val_1.fq.gz to zr2096_10_s1_R1_val_1.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_10_s1_R1_val_1.fq.gz to zr2096_10_s1_R1_val_1.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_10_s1_R1_val_1.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_10_s1_R2_val_2.fq.gz Writing a C -> T converted version of the input file zr2096_10_s1_R2_val_2.fq.gz to zr2096_10_s1_R2_val_2.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_10_s1_R2_val_2.fq.gz to zr2096_10_s1_R2_val_2.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_10_s1_R2_val_2.fq.gz (10001 sequences in total) Input files are zr2096_10_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_10_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_10_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_10_s1_R2_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_10_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_10_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:2:1101:1232:2155_1:N:0:GATCAG/1 77 * 0 0 * * 0 0 ATTGTATTAATTATAAAAAATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTATTATTAAAAATATTAAATA FFFFFFFFFBFFFFFFFFFFFFF#################################<>> Writing bisulfite mapping results to zr2096_10_s1_R1_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_10_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_10_s1_R2_val_2.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 8990 (89.90%) aligned concordantly 0 times 566 (5.66%) aligned concordantly exactly 1 time 444 (4.44%) aligned concordantly >1 times 10.10% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8906 (89.06%) aligned concordantly 0 times 594 (5.94%) aligned concordantly exactly 1 time 500 (5.00%) aligned concordantly >1 times 10.94% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8908 (89.08%) aligned concordantly 0 times 621 (6.21%) aligned concordantly exactly 1 time 471 (4.71%) aligned concordantly >1 times 10.92% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8897 (88.97%) aligned concordantly 0 times 591 (5.91%) aligned concordantly exactly 1 time 512 (5.12%) aligned concordantly >1 times 11.03% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files zr2096_10_s1_R1_val_1.fq.gz_C_to_T.fastq, zr2096_10_s1_R1_val_1.fq.gz_G_to_A.fastq, zr2096_10_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_10_s1_R2_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 58898 Total methylated C's in CpG context: 6616 Total methylated C's in CHG context: 217 Total methylated C's in CHH context: 640 Total methylated C's in Unknown context: 3 Total unmethylated C's in CpG context: 1946 Total unmethylated C's in CHG context: 13741 Total unmethylated C's in CHH context: 35738 Total unmethylated C's in Unknown context: 16 C methylated in CpG context: 77.3% C methylated in CHG context: 1.6% C methylated in CHH context: 1.8% C methylated in unknown context (CN or CHN): 15.8% Bismark completed in 0d 0h 1m 35s ==================== Bismark run complete ==================== Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ (absolute path is '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/)' Processing sequences up to read no. 10000 from the input file Input files to be analysed (in current folder '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset'): /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_1_s1_R1_val_1.fq.gz /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_1_s1_R2_val_2.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Setting parallelization to single-threaded (default) Current working directory is: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset Now reading in and storing sequence information of the genome specified in: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_1_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_1_s1_R2_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_1_s1_R1_val_1.fq.gz Writing a C -> T converted version of the input file zr2096_1_s1_R1_val_1.fq.gz to zr2096_1_s1_R1_val_1.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_1_s1_R1_val_1.fq.gz to zr2096_1_s1_R1_val_1.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_1_s1_R1_val_1.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_1_s1_R2_val_2.fq.gz Writing a C -> T converted version of the input file zr2096_1_s1_R2_val_2.fq.gz to zr2096_1_s1_R2_val_2.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_1_s1_R2_val_2.fq.gz to zr2096_1_s1_R2_val_2.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_1_s1_R2_val_2.fq.gz (10001 sequences in total) Input files are zr2096_1_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_1_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_1_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_1_s1_R2_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_1_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_1_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1249:2156_1:N:0:CGATGT/1 77 * 0 0 * * 0 0 GATTATTTGTTGTTTGTTGTTTGTTTGNNNNTNNNTNNGTTTGTTTGTTTGTTTGTTTGTTTGTAAATTTTTTATATTT FFFFFFFFFFFFFFFFFFFFFFFFFFF####<###<##<<>> Writing bisulfite mapping results to zr2096_1_s1_R1_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_1_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_1_s1_R2_val_2.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 9574 (95.74%) aligned concordantly 0 times 214 (2.14%) aligned concordantly exactly 1 time 212 (2.12%) aligned concordantly >1 times 4.26% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 9553 (95.53%) aligned concordantly 0 times 230 (2.30%) aligned concordantly exactly 1 time 217 (2.17%) aligned concordantly >1 times 4.47% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 9568 (95.68%) aligned concordantly 0 times 211 (2.11%) aligned concordantly exactly 1 time 221 (2.21%) aligned concordantly >1 times 4.32% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 9534 (95.34%) aligned concordantly 0 times 263 (2.63%) aligned concordantly exactly 1 time 203 (2.03%) aligned concordantly >1 times 4.66% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files zr2096_1_s1_R1_val_1.fq.gz_C_to_T.fastq, zr2096_1_s1_R1_val_1.fq.gz_G_to_A.fastq, zr2096_1_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_1_s1_R2_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 22392 Total methylated C's in CpG context: 2436 Total methylated C's in CHG context: 58 Total methylated C's in CHH context: 197 Total methylated C's in Unknown context: 8 Total unmethylated C's in CpG context: 638 Total unmethylated C's in CHG context: 5096 Total unmethylated C's in CHH context: 13967 Total unmethylated C's in Unknown context: 31 C methylated in CpG context: 79.2% C methylated in CHG context: 1.1% C methylated in CHH context: 1.4% C methylated in unknown context (CN or CHN): 20.5% Bismark completed in 0d 0h 0m 41s ==================== Bismark run complete ==================== Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ (absolute path is '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/)' Processing sequences up to read no. 10000 from the input file Input files to be analysed (in current folder '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset'): /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_2_s1_R1_val_1.fq.gz /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_2_s1_R2_val_2.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Setting parallelization to single-threaded (default) Current working directory is: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset Now reading in and storing sequence information of the genome specified in: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_2_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_2_s1_R2_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_2_s1_R1_val_1.fq.gz Writing a C -> T converted version of the input file zr2096_2_s1_R1_val_1.fq.gz to zr2096_2_s1_R1_val_1.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_2_s1_R1_val_1.fq.gz to zr2096_2_s1_R1_val_1.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_2_s1_R1_val_1.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_2_s1_R2_val_2.fq.gz Writing a C -> T converted version of the input file zr2096_2_s1_R2_val_2.fq.gz to zr2096_2_s1_R2_val_2.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_2_s1_R2_val_2.fq.gz to zr2096_2_s1_R2_val_2.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_2_s1_R2_val_2.fq.gz (10001 sequences in total) Input files are zr2096_2_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_2_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_2_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_2_s1_R2_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_2_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_2_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1148:2157_1:N:0:TGACCA/1 77 * 0 0 * * 0 0 AAATTTATTATTTTAAAAATAAAAATTNNNNTNNNTTTTATTATTTTTTTTAATATTTTTTAATATAATTAAATAATAA FFFFFFFFFFFFFFFFFFFFFFFFFFF####<###<<>> Writing bisulfite mapping results to zr2096_2_s1_R1_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_2_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_2_s1_R2_val_2.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 8884 (88.84%) aligned concordantly 0 times 575 (5.75%) aligned concordantly exactly 1 time 541 (5.41%) aligned concordantly >1 times 11.16% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8928 (89.28%) aligned concordantly 0 times 532 (5.32%) aligned concordantly exactly 1 time 540 (5.40%) aligned concordantly >1 times 10.72% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8896 (88.96%) aligned concordantly 0 times 579 (10000 reads; of these:5.79%) aligned concordantly exactly 1 time 525 (5.25%) aligned concordantly >1 times 11.04% overall alignment rate 10000 (100.00%) were paired; of these: 8938 (89.38%) aligned concordantly 0 times 539 (5.39%) aligned concordantly exactly 1 time 523 (5.23%) aligned concordantly >1 times 10.62% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files zr2096_2_s1_R1_val_1.fq.gz_C_to_T.fastq, zr2096_2_s1_R1_val_1.fq.gz_G_to_A.fastq, zr2096_2_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_2_s1_R2_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 49228 Total methylated C's in CpG context: 5554 Total methylated C's in CHG context: 186 Total methylated C's in CHH context: 584 Total methylated C's in Unknown context: 6 Total unmethylated C's in CpG context: 1564 Total unmethylated C's in CHG context: 11561 Total unmethylated C's in CHH context: 29779 Total unmethylated C's in Unknown context: 34 C methylated in CpG context: 78.0% C methylated in CHG context: 1.6% C methylated in CHH context: 1.9% C methylated in unknown context (CN or CHN): 15.0% Bismark completed in 0d 0h 0m 28s ==================== Bismark run complete ==================== Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ (absolute path is '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/)' Processing sequences up to read no. 10000 from the input file Input files to be analysed (in current folder '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset'): /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_3_s1_R1_val_1.fq.gz /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_3_s1_R2_val_2.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Setting parallelization to single-threaded (default) Current working directory is: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset Now reading in and storing sequence information of the genome specified in: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_3_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_3_s1_R2_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_3_s1_R1_val_1.fq.gz Writing a C -> T converted version of the input file zr2096_3_s1_R1_val_1.fq.gz to zr2096_3_s1_R1_val_1.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_3_s1_R1_val_1.fq.gz to zr2096_3_s1_R1_val_1.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_3_s1_R1_val_1.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_3_s1_R2_val_2.fq.gz Writing a C -> T converted version of the input file zr2096_3_s1_R2_val_2.fq.gz to zr2096_3_s1_R2_val_2.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_3_s1_R2_val_2.fq.gz to zr2096_3_s1_R2_val_2.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_3_s1_R2_val_2.fq.gz (10001 sequences in total) Input files are zr2096_3_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_3_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_3_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_3_s1_R2_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_3_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_3_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1059:2153_1:N:0:ACAGTG/1 77 * 0 0 * * 0 0 TAATTTAAATAATTTTATATAAATNNNNNNNNNNNNNNNTATTTAAATTAAAAATTTAAATAAATTTTTTTAATTATTTA FFFFFFFFFFFFFFFFFFFFFFFF###############<<>> Writing bisulfite mapping results to zr2096_3_s1_R1_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_3_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_3_s1_R2_val_2.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 8763 (87.63%) aligned concordantly 0 times 658 (6.58%) aligned concordantly exactly 1 time 579 (5.79%) aligned concordantly >1 times 12.37% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8795 (87.95%) aligned concordantly 0 times 623 (6.23%) aligned concordantly exactly 1 time 582 (10000 reads; of these: 10000 (100.00%) were paired; of these: 8887 (88.87%) aligned concordantly 0 times 592 (5.92%) aligned concordantly exactly 1 time 5.82%) aligned concordantly >1 times 5211000012.05% reads; of these: overall alignment rate (5.21%) aligned concordantly >1 times 11.13% overall alignment rate 10000 (100.00%) were paired; of these: 8882 (88.82%) aligned concordantly 0 times 600 (6.00%) aligned concordantly exactly 1 time 518 (5.18%) aligned concordantly >1 times 11.18% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files zr2096_3_s1_R1_val_1.fq.gz_C_to_T.fastq, zr2096_3_s1_R1_val_1.fq.gz_G_to_A.fastq, zr2096_3_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_3_s1_R2_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 59368 Total methylated C's in CpG context: 7578 Total methylated C's in CHG context: 179 Total methylated C's in CHH context: 571 Total methylated C's in Unknown context: 7 Total unmethylated C's in CpG context: 1424 Total unmethylated C's in CHG context: 13694 Total unmethylated C's in CHH context: 35922 Total unmethylated C's in Unknown context: 43 C methylated in CpG context: 84.2% C methylated in CHG context: 1.3% C methylated in CHH context: 1.6% C methylated in unknown context (CN or CHN): 14.0% Bismark completed in 0d 0h 0m 23s ==================== Bismark run complete ==================== Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ (absolute path is '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/)' Processing sequences up to read no. 10000 from the input file Input files to be analysed (in current folder '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset'): /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_4_s1_R1_val_1.fq.gz /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_4_s1_R2_val_2.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Setting parallelization to single-threaded (default) Current working directory is: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset Now reading in and storing sequence information of the genome specified in: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_4_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_4_s1_R2_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_4_s1_R1_val_1.fq.gz Writing a C -> T converted version of the input file zr2096_4_s1_R1_val_1.fq.gz to zr2096_4_s1_R1_val_1.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_4_s1_R1_val_1.fq.gz to zr2096_4_s1_R1_val_1.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_4_s1_R1_val_1.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_4_s1_R2_val_2.fq.gz Writing a C -> T converted version of the input file zr2096_4_s1_R2_val_2.fq.gz to zr2096_4_s1_R2_val_2.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_4_s1_R2_val_2.fq.gz to zr2096_4_s1_R2_val_2.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_4_s1_R2_val_2.fq.gz (10001 sequences in total) Input files are zr2096_4_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_4_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_4_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_4_s1_R2_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_4_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_4_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1343:2133_1:N:0:GCCAAT/1 77 * 0 0 * * 0 0 ATAGTGGTTGTTATGGAAATTAGNNNNNNNNNNNNNNNNNNNNNNNNNTGNANTNTTTTTATTAGAATTGTTAAGGTTT FFFFFFFFFFFFFFFFFFFFFFF#########################<<#<#/#<>> Writing bisulfite mapping results to zr2096_4_s1_R1_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_4_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_4_s1_R2_val_2.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 8767 (87.67%) aligned concordantly 0 times 637 (6.37%) aligned concordantly exactly 1 time 596 (5.96%) aligned concordantly >1 times 12.33% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8860 (88.60%) aligned concordantly 0 times 593 (5.93%) aligned concordantly exactly 1 time 547 (5.47%) aligned concordantly >1 times 11.40% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8775 (87.75%) aligned concordantly 0 times 636 (6.36%) aligned concordantly exactly 1 time 589 (5.89%) aligned concordantly >1 times 12.25% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8865 (88.65%) aligned concordantly 0 times 581 (5.81%) aligned concordantly exactly 1 time 554 (5.54%) aligned concordantly >1 times 11.35% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files zr2096_4_s1_R1_val_1.fq.gz_C_to_T.fastq, zr2096_4_s1_R1_val_1.fq.gz_G_to_A.fastq, zr2096_4_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_4_s1_R2_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 54440 Total methylated C's in CpG context: 5595 Total methylated C's in CHG context: 151 Total methylated C's in CHH context: 583 Total methylated C's in Unknown context: 7 Total unmethylated C's in CpG context: 1860 Total unmethylated C's in CHG context: 12403 Total unmethylated C's in CHH context: 33848 Total unmethylated C's in Unknown context: 27 C methylated in CpG context: 75.1% C methylated in CHG context: 1.2% C methylated in CHH context: 1.7% C methylated in unknown context (CN or CHN): 20.6% Bismark completed in 0d 0h 0m 22s ==================== Bismark run complete ==================== Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ (absolute path is '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/)' Processing sequences up to read no. 10000 from the input file Input files to be analysed (in current folder '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset'): /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_5_s1_R1_val_1.fq.gz /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_5_s1_R2_val_2.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Setting parallelization to single-threaded (default) Current working directory is: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset Now reading in and storing sequence information of the genome specified in: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_5_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_5_s1_R2_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_5_s1_R1_val_1.fq.gz Writing a C -> T converted version of the input file zr2096_5_s1_R1_val_1.fq.gz to zr2096_5_s1_R1_val_1.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_5_s1_R1_val_1.fq.gz to zr2096_5_s1_R1_val_1.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_5_s1_R1_val_1.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_5_s1_R2_val_2.fq.gz Writing a C -> T converted version of the input file zr2096_5_s1_R2_val_2.fq.gz to zr2096_5_s1_R2_val_2.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_5_s1_R2_val_2.fq.gz to zr2096_5_s1_R2_val_2.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_5_s1_R2_val_2.fq.gz (10001 sequences in total) Input files are zr2096_5_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_5_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_5_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_5_s1_R2_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_5_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_5_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1218:2142_1:N:0:CAGATC/1 77 * 0 0 * * 0 0 TTATTTAAATTTTATTATTTATANNNNNNNNNNNNNNNNNNATTNTTTTTATTATATATATAAAATTATTTTAAAATTAT FFFFFFFFFFFFFFFFFFFFFFF##################<<<#<>> Writing bisulfite mapping results to zr2096_5_s1_R1_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_5_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_5_s1_R2_val_2.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 8978 (89.78%) aligned concordantly 0 times 565 (5.65%) aligned concordantly exactly 1 time 457 (4.57%) aligned concordantly >1 times 10.22% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8958 (89.58%) aligned concordantly 0 times 596 (5.96%) aligned concordantly exactly 1 time 446 (4.46%) aligned concordantly >1 times 10.42% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 9001 (90.01%) aligned concordantly 0 times 532 (5.32%) aligned concordantly exactly 1 time 467 (4.67%) aligned concordantly >1 times 9.99% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8992 (89.92%) aligned concordantly 0 times 569 (5.69%) aligned concordantly exactly 1 time 439 (4.39%) aligned concordantly >1 times 10.08% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files zr2096_5_s1_R1_val_1.fq.gz_C_to_T.fastq, zr2096_5_s1_R1_val_1.fq.gz_G_to_A.fastq, zr2096_5_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_5_s1_R2_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 53972 Total methylated C's in CpG context: 5519 Total methylated C's in CHG context: 212 Total methylated C's in CHH context: 544 Total methylated C's in Unknown context: 7 Total unmethylated C's in CpG context: 1726 Total unmethylated C's in CHG context: 11983 Total unmethylated C's in CHH context: 33988 Total unmethylated C's in Unknown context: 38 C methylated in CpG context: 76.2% C methylated in CHG context: 1.7% C methylated in CHH context: 1.6% C methylated in unknown context (CN or CHN): 15.6% Bismark completed in 0d 0h 0m 22s ==================== Bismark run complete ==================== Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ (absolute path is '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/)' Processing sequences up to read no. 10000 from the input file Input files to be analysed (in current folder '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset'): /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_6_s1_R1_val_1.fq.gz /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_6_s1_R2_val_2.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Setting parallelization to single-threaded (default) Current working directory is: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset Now reading in and storing sequence information of the genome specified in: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_6_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_6_s1_R2_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_6_s1_R1_val_1.fq.gz Writing a C -> T converted version of the input file zr2096_6_s1_R1_val_1.fq.gz to zr2096_6_s1_R1_val_1.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_6_s1_R1_val_1.fq.gz to zr2096_6_s1_R1_val_1.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_6_s1_R1_val_1.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_6_s1_R2_val_2.fq.gz Writing a C -> T converted version of the input file zr2096_6_s1_R2_val_2.fq.gz to zr2096_6_s1_R2_val_2.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_6_s1_R2_val_2.fq.gz to zr2096_6_s1_R2_val_2.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_6_s1_R2_val_2.fq.gz (10001 sequences in total) Input files are zr2096_6_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_6_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_6_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_6_s1_R2_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_6_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_6_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1093:2134_1:N:0:CTTGTA/1 77 * 0 0 * * 0 0 TTAATTTTATTATTAAATAAAAANNNNNNNNNNNNNNNNNNNNNNANNTANANAAATATTAATTAAATATTTTTAAAATA FFFFFFFFFFFFFFFFFFFFFFF######################<##<<#<#<>> Writing bisulfite mapping results to zr2096_6_s1_R1_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_6_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_6_s1_R2_val_2.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 8923 (89.23%) aligned concordantly 0 times 570 (5.70%) aligned concordantly exactly 1 time 507 (5.07%) aligned concordantly >1 times 10.77% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8725 (87.25%) aligned concordantly 0 times 687 (6.87%) aligned concordantly exactly 1 time 588 (5.88%) aligned concordantly >1 times 12.75% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8707 (87.07%) aligned concordantly 0 times 696 (6.96%) aligned concordantly exactly 1 time 597 (5.97%) aligned concordantly >1 times 12.93% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8905 (89.05%) aligned concordantly 0 times 575 (5.75%) aligned concordantly exactly 1 time 520 (5.20%) aligned concordantly >1 times 10.95% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files zr2096_6_s1_R1_val_1.fq.gz_C_to_T.fastq, zr2096_6_s1_R1_val_1.fq.gz_G_to_A.fastq, zr2096_6_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_6_s1_R2_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 56488 Total methylated C's in CpG context: 6634 Total methylated C's in CHG context: 140 Total methylated C's in CHH context: 556 Total methylated C's in Unknown context: 0 Total unmethylated C's in CpG context: 1406 Total unmethylated C's in CHG context: 13018 Total unmethylated C's in CHH context: 34734 Total unmethylated C's in Unknown context: 26 C methylated in CpG context: 82.5% C methylated in CHG context: 1.1% C methylated in CHH context: 1.6% C methylated in unknown context (CN or CHN): 0.0% Bismark completed in 0d 0h 0m 25s ==================== Bismark run complete ==================== Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ (absolute path is '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/)' Processing sequences up to read no. 10000 from the input file Input files to be analysed (in current folder '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset'): /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_7_s1_R1_val_1.fq.gz /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_7_s1_R2_val_2.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Setting parallelization to single-threaded (default) Current working directory is: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset Now reading in and storing sequence information of the genome specified in: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_7_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_7_s1_R2_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_7_s1_R1_val_1.fq.gz Writing a C -> T converted version of the input file zr2096_7_s1_R1_val_1.fq.gz to zr2096_7_s1_R1_val_1.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_7_s1_R1_val_1.fq.gz to zr2096_7_s1_R1_val_1.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_7_s1_R1_val_1.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_7_s1_R2_val_2.fq.gz Writing a C -> T converted version of the input file zr2096_7_s1_R2_val_2.fq.gz to zr2096_7_s1_R2_val_2.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_7_s1_R2_val_2.fq.gz to zr2096_7_s1_R2_val_2.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_7_s1_R2_val_2.fq.gz (10001 sequences in total) Input files are zr2096_7_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_7_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_7_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_7_s1_R2_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_7_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_7_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1132:2189_1:N:0:ATCACG/1 77 * 0 0 * * 0 0 TTATTATGATGAATTTAAATATTAATAATAAAATTTAAAAAAAATATAAATGTTAAATATTAAATTTTTTAAAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF YT:Z:UP HWI-C00124:321:CC781ANXX:1:1101:1132:2189_2:N:0:ATCACG/2 141 * 0 0 * * 0 0 TTTTTAAAAAATTTAATATTTAACATTTATATTTTTTTTAAATTTTATTATTAATATTTAAATTCATCATAATAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF/FFBBFFFFFFBBFFFFFFFFFFFFF YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2GAgenome (reading in sequences from zr2096_7_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_7_s1_R2_val_2.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1132:2189_1:N:0:ATCACG/1 99 NC_035781.1_GA_converted 24539756 32 75M = 24539756 -75 CTACTACAACAAATTCAAATATTAATAACAAAATTTAAAAAAAACATAAACATTAAATATCAAATTCTTCAAAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:75 YS:i:0 YT:Z:CP HWI-C00124:321:CC781ANXX:1:1101:1132:2189_2:N:0:ATCACG/2 147 NC_035781.1_GA_converted 24539756 32 75M = 24539756 -75 CTACTACAACAAATTCAAATATTAATAACAAAATTTAAAAAAAACATAAACATTAAATATCAAATTCTTCAAAAA FFFFFFFFFFFFFBBFFFFFFBBFF/FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:75 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2CTgenome (reading in sequences from zr2096_7_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_7_s1_R2_val_2.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1132:2189_1:N:0:ATCACG/1 83 NC_035780.1_CT_converted 42548691 32 75M = 42548691 -75 TTTTTGAAGAATTTGATATTTAATGTTTATGTTTTTTTTAAATTTTGTTATTAATATTTGAATTTGTTGTAGTAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:75 YS:i:0 YT:Z:CP HWI-C00124:321:CC781ANXX:1:1101:1132:2189_2:N:0:ATCACG/2 163 NC_035780.1_CT_converted 42548691 32 75M = 42548691 -75 TTTTTGAAGAATTTGATATTTAATGTTTATGTTTTTTTTAAATTTTGTTATTAATATTTGAATTTGTTGTAGTAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF/FFBBFFFFFFBBFFFFFFFFFFFFF AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:75 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from zr2096_7_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_7_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1132:2189_1:N:0:ATCACG/1 77 * 0 0 * * 0 0 TTATTATGATGAATTTAAATATTAATAATAAAATTTAAAAAAAATATAAATGTTAAATATTAAATTTTTTAAAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF YT:Z:UP HWI-C00124:321:CC781ANXX:1:1101:1132:2189_2:N:0:ATCACG/2 141 * 0 0 * * 0 0 TTTTTAAAAAATTTAATATTTAACATTTATATTTTTTTTAAATTTTATTATTAATATTTAAATTCATCATAATAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF/FFBBFFFFFFBBFFFFFFFFFFFFF YT:Z:UP >>> Writing bisulfite mapping results to zr2096_7_s1_R1_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_7_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_7_s1_R2_val_2.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 8980 (89.80%) aligned concordantly 0 times 564 (5.64%) aligned concordantly exactly 1 time 456 (4.56%) aligned concordantly >1 times 10.20% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8971 (89.71%10000 reads; of these: 10000 (10000 reads; of these:) aligned concordantly 0 times 100.00 %) were paired; of these: 10000 (9038 (100.0090.38 %561%) aligned concordantly 0 times ( 5.61%) aligned concordantly exactly 1 time541 ( ) were paired; of these: 4689037 ( (90.375.41%%4.68) aligned concordantly exactly 1 time% ) aligned concordantly >1 times 10.29) aligned concordantly 0 times % overall alignment rate543 ( 5.43%) aligned concordantly exactly 1 time 420 (4.20%) aligned concordantly >1 times 9.63% overall alignment rate 421 (4.21%) aligned concordantly >1 times 9.62% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files zr2096_7_s1_R1_val_1.fq.gz_C_to_T.fastq, zr2096_7_s1_R1_val_1.fq.gz_G_to_A.fastq, zr2096_7_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_7_s1_R2_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 51903 Total methylated C's in CpG context: 5479 Total methylated C's in CHG context: 190 Total methylated C's in CHH context: 543 Total methylated C's in Unknown context: 3 Total unmethylated C's in CpG context: 1329 Total unmethylated C's in CHG context: 11633 Total unmethylated C's in CHH context: 32729 Total unmethylated C's in Unknown context: 48 C methylated in CpG context: 80.5% C methylated in CHG context: 1.6% C methylated in CHH context: 1.6% C methylated in unknown context (CN or CHN): 5.9% Bismark completed in 0d 0h 0m 23s ==================== Bismark run complete ==================== Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ (absolute path is '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/)' Processing sequences up to read no. 10000 from the input file Input files to be analysed (in current folder '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset'): /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_8_s1_R1_val_1.fq.gz /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_8_s1_R2_val_2.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Setting parallelization to single-threaded (default) Current working directory is: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset Now reading in and storing sequence information of the genome specified in: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_8_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_8_s1_R2_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_8_s1_R1_val_1.fq.gz Writing a C -> T converted version of the input file zr2096_8_s1_R1_val_1.fq.gz to zr2096_8_s1_R1_val_1.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_8_s1_R1_val_1.fq.gz to zr2096_8_s1_R1_val_1.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_8_s1_R1_val_1.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_8_s1_R2_val_2.fq.gz Writing a C -> T converted version of the input file zr2096_8_s1_R2_val_2.fq.gz to zr2096_8_s1_R2_val_2.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_8_s1_R2_val_2.fq.gz to zr2096_8_s1_R2_val_2.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_8_s1_R2_val_2.fq.gz (10001 sequences in total) Input files are zr2096_8_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_8_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_8_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_8_s1_R2_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_8_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_8_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:1:1101:1281:2170_1:N:0:TTAGGC/1 77 * 0 0 * * 0 0 TTAAAAAATTTATTAAATTTATTATTATTTNTTATTTTTTATAAAAGAAAATAGAGAGAGAGAGAGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF#<>> Writing bisulfite mapping results to zr2096_8_s1_R1_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_8_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_8_s1_R2_val_2.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 9026 (90.26%) aligned concordantly 0 times 514 (5.14%) aligned concordantly exactly 1 time 460 (4.60%) aligned concordantly >1 times 9.74% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 9033 (90.33%) aligned concordantly 0 times 536 (5.36%) aligned concordantly exactly 1 time 431 (4.31%10000 reads; of these:) aligned concordantly >1 times 9.6710000 (%100.00%) were paired; of these: overall alignment rate 9073 (90.73%) aligned concordantly 0 times 498 (4.98%) aligned concordantly exactly 1 time 429 (4.29%) aligned concordantly >1 times 9.27% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 9083 (90.83%) aligned concordantly 0 times 493 (4.93%) aligned concordantly exactly 1 time 424 (4.24%) aligned concordantly >1 times 9.17% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files zr2096_8_s1_R1_val_1.fq.gz_C_to_T.fastq, zr2096_8_s1_R1_val_1.fq.gz_G_to_A.fastq, zr2096_8_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_8_s1_R2_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 47295 Total methylated C's in CpG context: 4577 Total methylated C's in CHG context: 155 Total methylated C's in CHH context: 650 Total methylated C's in Unknown context: 0 Total unmethylated C's in CpG context: 1539 Total unmethylated C's in CHG context: 10803 Total unmethylated C's in CHH context: 29571 Total unmethylated C's in Unknown context: 33 C methylated in CpG context: 74.8% C methylated in CHG context: 1.4% C methylated in CHH context: 2.2% C methylated in unknown context (CN or CHN): 0.0% Bismark completed in 0d 0h 0m 27s ==================== Bismark run complete ==================== Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ (absolute path is '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/)' Processing sequences up to read no. 10000 from the input file Input files to be analysed (in current folder '/Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset'): /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_9_s1_R1_val_1.fq.gz /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_9_s1_R2_val_2.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Setting parallelization to single-threaded (default) Current working directory is: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-05-22-Bismark-Subset Now reading in and storing sequence information of the genome specified in: /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_9_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_9_s1_R2_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_9_s1_R1_val_1.fq.gz Writing a C -> T converted version of the input file zr2096_9_s1_R1_val_1.fq.gz to zr2096_9_s1_R1_val_1.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_9_s1_R1_val_1.fq.gz to zr2096_9_s1_R1_val_1.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_9_s1_R1_val_1.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_9_s1_R2_val_2.fq.gz Writing a C -> T converted version of the input file zr2096_9_s1_R2_val_2.fq.gz to zr2096_9_s1_R2_val_2.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file zr2096_9_s1_R2_val_2.fq.gz to zr2096_9_s1_R2_val_2.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file zr2096_9_s1_R2_val_2.fq.gz (10001 sequences in total) Input files are zr2096_9_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_9_s1_R1_val_1.fq.gz_G_to_A.fastq and zr2096_9_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_9_s1_R2_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /Users/yaamini/Documents/project-virginica-oa/analyses/2018-04-27-Bismark/2018-04-27-Bismark-Inputs/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from zr2096_9_s1_R1_val_1.fq.gz_C_to_T.fastq and zr2096_9_s1_R2_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: HWI-C00124:321:CC781ANXX:2:1101:1135:2128_1:N:0:ACTTGA/1 77 * 0 0 * * 0 0 AAAATAATAAATAATAAATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN >> Writing bisulfite mapping results to zr2096_9_s1_R1_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_9_s1_R1_val_1.fq.gz and /Volumes/web/Athaliana/20180411_trimgalore_10bp_Cvirginica_MBD/zr2096_9_s1_R2_val_2.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 9029 (90.29%) aligned concordantly 0 times 518 (5.18%) aligned concordantly exactly 1 time 453 (4.53%) aligned concordantly >1 times 9.71% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8872 (88.72%) aligned concordantly 0 times 646 (6.46%) aligned concordantly exactly 1 time 482 (4.82%) aligned concordantly >1 times 11.28% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8939 (89.39%) aligned concordantly 0 times 578 (5.78%) aligned concordantly exactly 1 time 483 (4.83%) aligned concordantly >1 times 10.61% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 9078 (90.78%) aligned concordantly 0 times 477 (4.77%) aligned concordantly exactly 1 time 445 (4.45%) aligned concordantly >1 times 9.22% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files zr2096_9_s1_R1_val_1.fq.gz_C_to_T.fastq, zr2096_9_s1_R1_val_1.fq.gz_G_to_A.fastq, zr2096_9_s1_R2_val_2.fq.gz_C_to_T.fastq and zr2096_9_s1_R2_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 53419 Total methylated C's in CpG context: 6780 Total methylated C's in CHG context: 256 Total methylated C's in CHH context: 552 Total methylated C's in Unknown context: 0 Total unmethylated C's in CpG context: 1291 Total unmethylated C's in CHG context: 12269 Total unmethylated C's in CHH context: 32271 Total unmethylated C's in Unknown context: 20 C methylated in CpG context: 84.0% C methylated in CHG context: 2.0% C methylated in CHH context: 1.7% C methylated in unknown context (CN or CHN): 0.0% Bismark completed in 0d 0h 0m 21s ==================== Bismark run complete ====================