WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GCGACGCCGTTCAACCAGATATTGAAGCAGAACGCAAAAAGAGAGATGAGATTGAGGCTG

Read1 before filtering:
total reads: 2634620
total bases: 379385280
Q20 bases: 368081838(97.0206%)
Q30 bases: 353051365(93.0588%)

Read1 after filtering:
total reads: 2614736
total bases: 376511872
Q20 bases: 365980492(97.2029%)
Q30 bases: 351171695(93.2698%)

Filtering result:
reads passed filter: 2614736
reads failed due to low quality: 6919
reads failed due to too many N: 3593
reads failed due to too short: 9372
reads with adapter trimmed: 10543
bases trimmed due to adapters: 1357546

Duplication rate (may be overestimated since this is SE data): 70.9102%

JSON report: SekiuWA_FG035.json
HTML report: SekiuWA_FG035.html

fastp -i SekiuWA_FG035.F.fq.gz -o SekiuWA_FG035.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG035.json -h SekiuWA_FG035.html 
fastp v0.20.0, time used: 25 seconds