WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
CAGTCGGGAGAGGAGTGGCATTAACACCATCCTTCATGAACTTAATCCACTGTTCACCAT

Read1 before filtering:
total reads: 2679543
total bases: 385854192
Q20 bases: 375050177(97.2%)
Q30 bases: 359906717(93.2753%)

Read1 after filtering:
total reads: 2656118
total bases: 380673826
Q20 bases: 370684080(97.3758%)
Q30 bases: 355871507(93.4846%)

Filtering result:
reads passed filter: 2656118
reads failed due to low quality: 6513
reads failed due to too many N: 3497
reads failed due to too short: 13415
reads with adapter trimmed: 55273
bases trimmed due to adapters: 3736467

Duplication rate (may be overestimated since this is SE data): 63.2019%

JSON report: SekiuWA_FG032.json
HTML report: SekiuWA_FG032.html

fastp -i SekiuWA_FG032.F.fq.gz -o SekiuWA_FG032.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG032.json -h SekiuWA_FG032.html 
fastp v0.20.0, time used: 25 seconds