WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
CTGGACAATCAGAAAGAGATTGCCGAGATGCAAAATGAGACTCAAAAAGAGATTGCTGGC

Read1 before filtering:
total reads: 3132083
total bases: 451019952
Q20 bases: 437764081(97.0609%)
Q30 bases: 419810252(93.0802%)

Read1 after filtering:
total reads: 3103061
total bases: 446811158
Q20 bases: 434530073(97.2514%)
Q30 bases: 416888779(93.3031%)

Filtering result:
reads passed filter: 3103061
reads failed due to low quality: 8684
reads failed due to too many N: 4263
reads failed due to too short: 16075
reads with adapter trimmed: 20284
bases trimmed due to adapters: 2341841

Duplication rate (may be overestimated since this is SE data): 64.8095%

JSON report: SekiuWA_FG031.json
HTML report: SekiuWA_FG031.html

fastp -i SekiuWA_FG031.F.fq.gz -o SekiuWA_FG031.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG031.json -h SekiuWA_FG031.html 
fastp v0.20.0, time used: 29 seconds