WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
ATAAGGCCACGTATTTTGCAAGCTATTTAACTGGCGGCGATTGCGTACCCGACGACCAAA

Read1 before filtering:
total reads: 3791320
total bases: 545950080
Q20 bases: 529521027(96.9907%)
Q30 bases: 507451802(92.9484%)

Read1 after filtering:
total reads: 3760096
total bases: 541406861
Q20 bases: 526175705(97.1867%)
Q30 bases: 504462041(93.1761%)

Filtering result:
reads passed filter: 3760096
reads failed due to low quality: 10924
reads failed due to too many N: 5080
reads failed due to too short: 15220
reads with adapter trimmed: 22512
bases trimmed due to adapters: 2235998

Duplication rate (may be overestimated since this is SE data): 62.2837%

JSON report: SekiuWA_FG027.json
HTML report: SekiuWA_FG027.html

fastp -i SekiuWA_FG027.F.fq.gz -o SekiuWA_FG027.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG027.json -h SekiuWA_FG027.html 
fastp v0.20.0, time used: 35 seconds