WARNING: cut_by_quality5 is deprecated, please use cut_front instead. Detecting adapter sequence for read1... ATAAAGGAAAGGATACTCGTGATTATCTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGG Read1 before filtering: total reads: 1454631 total bases: 209466864 Q20 bases: 203495637(97.1493%) Q30 bases: 195332509(93.2522%) Read1 after filtering: total reads: 1438861 total bases: 207169131 Q20 bases: 201643059(97.3326%) Q30 bases: 193630733(93.4651%) Filtering result: reads passed filter: 1438861 reads failed due to low quality: 3871 reads failed due to too many N: 1922 reads failed due to too short: 9977 reads with adapter trimmed: 14034 bases trimmed due to adapters: 1461974 Duplication rate (may be overestimated since this is SE data): 76.7399% JSON report: SekiuWA_FG026.json HTML report: SekiuWA_FG026.html fastp -i SekiuWA_FG026.F.fq.gz -o SekiuWA_FG026.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG026.json -h SekiuWA_FG026.html fastp v0.20.0, time used: 17 seconds