WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
TTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGTCCCTAGTTTTG

Read1 before filtering:
total reads: 2560176
total bases: 368665344
Q20 bases: 358559144(97.2587%)
Q30 bases: 344488349(93.442%)

Read1 after filtering:
total reads: 2538275
total bases: 364980596
Q20 bases: 355628541(97.4377%)
Q30 bases: 341822610(93.655%)

Filtering result:
reads passed filter: 2538275
reads failed due to low quality: 6386
reads failed due to too many N: 3368
reads failed due to too short: 12147
reads with adapter trimmed: 42648
bases trimmed due to adapters: 2277670

Duplication rate (may be overestimated since this is SE data): 71.88%

JSON report: SekiuWA_FG021.json
HTML report: SekiuWA_FG021.html

fastp -i SekiuWA_FG021.F.fq.gz -o SekiuWA_FG021.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG021.json -h SekiuWA_FG021.html 
fastp v0.20.0, time used: 27 seconds