WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
ACCAAAATTAGGGTCAACGCTACCTGTAGGAAGTGTCCGCATAAAGTGCACCGCATGGAA

Read1 before filtering:
total reads: 1424295
total bases: 205098480
Q20 bases: 198688095(96.8745%)
Q30 bases: 190483357(92.8741%)

Read1 after filtering:
total reads: 1402795
total bases: 201953017
Q20 bases: 196020609(97.0625%)
Q30 bases: 188001742(93.0918%)

Filtering result:
reads passed filter: 1402795
reads failed due to low quality: 4097
reads failed due to too many N: 1826
reads failed due to too short: 15577
reads with adapter trimmed: 22017
bases trimmed due to adapters: 2290892

Duplication rate (may be overestimated since this is SE data): 76.4303%

JSON report: SekiuWA_FG018.json
HTML report: SekiuWA_FG018.html

fastp -i SekiuWA_FG018.F.fq.gz -o SekiuWA_FG018.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG018.json -h SekiuWA_FG018.html 
fastp v0.20.0, time used: 17 seconds