WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GGCCTCCACTATGAAATCGCGTAGAGGCTTTGCTATTCAGCGTTTGATGAATGCAATGCG

Read1 before filtering:
total reads: 3111838
total bases: 448104672
Q20 bases: 435432438(97.172%)
Q30 bases: 418113726(93.3072%)

Read1 after filtering:
total reads: 3092260
total bases: 445274492
Q20 bases: 433526335(97.3616%)
Q30 bases: 416458950(93.5286%)

Filtering result:
reads passed filter: 3092260
reads failed due to low quality: 8459
reads failed due to too many N: 4192
reads failed due to too short: 6927
reads with adapter trimmed: 8374
bases trimmed due to adapters: 1005733

Duplication rate (may be overestimated since this is SE data): 66.2713%

JSON report: SekiuWA_FG017.json
HTML report: SekiuWA_FG017.html

fastp -i SekiuWA_FG017.F.fq.gz -o SekiuWA_FG017.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG017.json -h SekiuWA_FG017.html 
fastp v0.20.0, time used: 31 seconds