WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
TATAGGTCTGTTGAACACGACCAGAAAACTGGCCTAACGACGTTTGGTCAGTTCCATCAA

Read1 before filtering:
total reads: 3804122
total bases: 547793568
Q20 bases: 531953698(97.1084%)
Q30 bases: 510297503(93.1551%)

Read1 after filtering:
total reads: 3770535
total bases: 542077984
Q20 bases: 527444350(97.3005%)
Q30 bases: 506200704(93.3815%)

Filtering result:
reads passed filter: 3770535
reads failed due to low quality: 10675
reads failed due to too many N: 5001
reads failed due to too short: 17911
reads with adapter trimmed: 44195
bases trimmed due to adapters: 3454861

Duplication rate (may be overestimated since this is SE data): 68.4312%

JSON report: SekiuWA_FG015.json
HTML report: SekiuWA_FG015.html

fastp -i SekiuWA_FG015.F.fq.gz -o SekiuWA_FG015.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG015.json -h SekiuWA_FG015.html 
fastp v0.20.0, time used: 38 seconds