WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
ATAGTTGTTATAGATATTCAAATAACCCTGAAACAAATGCTTAGGGATTTTATTGGTATC

Read1 before filtering:
total reads: 2992442
total bases: 430911648
Q20 bases: 418602754(97.1435%)
Q30 bases: 401374159(93.1453%)

Read1 after filtering:
total reads: 2955466
total bases: 425537977
Q20 bases: 414116819(97.3161%)
Q30 bases: 397224049(93.3463%)

Filtering result:
reads passed filter: 2955466
reads failed due to low quality: 7435
reads failed due to too many N: 3756
reads failed due to too short: 25785
reads with adapter trimmed: 32369
bases trimmed due to adapters: 3758742

Duplication rate (may be overestimated since this is SE data): 64.5328%

JSON report: SekiuWA_FG014.json
HTML report: SekiuWA_FG014.html

fastp -i SekiuWA_FG014.F.fq.gz -o SekiuWA_FG014.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG014.json -h SekiuWA_FG014.html 
fastp v0.20.0, time used: 28 seconds