WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
ACCTCACTTAAGTGGCTGGAGACAAATAATCTCTTTAATAACCTGATTCAGCGAAACCAA

Read1 before filtering:
total reads: 4388671
total bases: 631968624
Q20 bases: 613658957(97.1028%)
Q30 bases: 588727666(93.1577%)

Read1 after filtering:
total reads: 4357580
total bases: 627448121
Q20 bases: 610471150(97.2943%)
Q30 bases: 585914953(93.3806%)

Filtering result:
reads passed filter: 4357580
reads failed due to low quality: 11904
reads failed due to too many N: 6006
reads failed due to too short: 13181
reads with adapter trimmed: 18491
bases trimmed due to adapters: 1938507

Duplication rate (may be overestimated since this is SE data): 60.9001%

JSON report: SekiuWA_FG013.json
HTML report: SekiuWA_FG013.html

fastp -i SekiuWA_FG013.F.fq.gz -o SekiuWA_FG013.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG013.json -h SekiuWA_FG013.html 
fastp v0.20.0, time used: 44 seconds