WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
TTCAGCAGCCAGCTTGCGGCAAAACTGCGTAACCGTCTTCTCGTTCTCTAAAAACCATTT

Read1 before filtering:
total reads: 1774998
total bases: 255599712
Q20 bases: 248267073(97.1312%)
Q30 bases: 238325207(93.2416%)

Read1 after filtering:
total reads: 1758955
total bases: 253258809
Q20 bases: 246453866(97.313%)
Q30 bases: 236676220(93.4523%)

Filtering result:
reads passed filter: 1758955
reads failed due to low quality: 4574
reads failed due to too many N: 2404
reads failed due to too short: 9065
reads with adapter trimmed: 13941
bases trimmed due to adapters: 1334453

Duplication rate (may be overestimated since this is SE data): 71.8172%

JSON report: SekiuWA_FG011.json
HTML report: SekiuWA_FG011.html

fastp -i SekiuWA_FG011.F.fq.gz -o SekiuWA_FG011.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG011.json -h SekiuWA_FG011.html 
fastp v0.20.0, time used: 18 seconds