WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GATTGCCGAGATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTC

Read1 before filtering:
total reads: 3776667
total bases: 543840048
Q20 bases: 528354369(97.1525%)
Q30 bases: 507308587(93.2827%)

Read1 after filtering:
total reads: 3736334
total bases: 537951324
Q20 bases: 523663825(97.3441%)
Q30 bases: 503011770(93.5051%)

Filtering result:
reads passed filter: 3736334
reads failed due to low quality: 10358
reads failed due to too many N: 5364
reads failed due to too short: 24611
reads with adapter trimmed: 35765
bases trimmed due to adapters: 2518295

Duplication rate (may be overestimated since this is SE data): 61.4728%

JSON report: SekiuWA_FG010.json
HTML report: SekiuWA_FG010.html

fastp -i SekiuWA_FG010.F.fq.gz -o SekiuWA_FG010.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG010.json -h SekiuWA_FG010.html 
fastp v0.20.0, time used: 36 seconds