WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
CTTGCCACCAAGTCCAACCAAATCAAGCAACTTATCAGAAACGGCAGAAGTGCCAGCCTG

Read1 before filtering:
total reads: 2659233
total bases: 382929552
Q20 bases: 372168875(97.1899%)
Q30 bases: 357284310(93.3029%)

Read1 after filtering:
total reads: 2626232
total bases: 377660951
Q20 bases: 367702331(97.3631%)
Q30 bases: 353129433(93.5044%)

Filtering result:
reads passed filter: 2626232
reads failed due to low quality: 6476
reads failed due to too many N: 3637
reads failed due to too short: 22888
reads with adapter trimmed: 45916
bases trimmed due to adapters: 3809422

Duplication rate (may be overestimated since this is SE data): 64.867%

JSON report: SekiuWA_FG009.json
HTML report: SekiuWA_FG009.html

fastp -i SekiuWA_FG009.F.fq.gz -o SekiuWA_FG009.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG009.json -h SekiuWA_FG009.html 
fastp v0.20.0, time used: 27 seconds