WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
CAAAAGCAATATCAGCACCAACAGAAACAACCTGATTAGCGGCGTTGACAGATGTATCCA

Read1 before filtering:
total reads: 2851503
total bases: 410616432
Q20 bases: 398727714(97.1047%)
Q30 bases: 382672722(93.1947%)

Read1 after filtering:
total reads: 2826495
total bases: 406944993
Q20 bases: 395927768(97.2927%)
Q30 bases: 380138291(93.4127%)

Filtering result:
reads passed filter: 2826495
reads failed due to low quality: 7705
reads failed due to too many N: 3922
reads failed due to too short: 13381
reads with adapter trimmed: 22865
bases trimmed due to adapters: 1994878

Duplication rate (may be overestimated since this is SE data): 64.7932%

JSON report: SekiuWA_FG006.json
HTML report: SekiuWA_FG006.html

fastp -i SekiuWA_FG006.F.fq.gz -o SekiuWA_FG006.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG006.json -h SekiuWA_FG006.html 
fastp v0.20.0, time used: 32 seconds