WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GGAAGTAGCGACAGCTTGGTTTTTAGTGAGTTGTTCCATTCTTTAGCTCCTAGACCTTTA

Read1 before filtering:
total reads: 3464735
total bases: 498921840
Q20 bases: 484532538(97.1159%)
Q30 bases: 465057029(93.2124%)

Read1 after filtering:
total reads: 3440565
total bases: 495399168
Q20 bases: 482047087(97.3048%)
Q30 bases: 462862216(93.4322%)

Filtering result:
reads passed filter: 3440565
reads failed due to low quality: 9372
reads failed due to too many N: 4625
reads failed due to too short: 10173
reads with adapter trimmed: 16871
bases trimmed due to adapters: 1504324

Duplication rate (may be overestimated since this is SE data): 64.0625%

JSON report: SekiuWA_FG004.json
HTML report: SekiuWA_FG004.html

fastp -i SekiuWA_FG004.F.fq.gz -o SekiuWA_FG004.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG004.json -h SekiuWA_FG004.html 
fastp v0.20.0, time used: 39 seconds