WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GAACACTCATCCTTAATACCTTTCTTTTTGGGGTAATTATACTCATCGCGAATATCCTTA

Read1 before filtering:
total reads: 4543979
total bases: 654332976
Q20 bases: 634955320(97.0386%)
Q30 bases: 608868992(93.0519%)

Read1 after filtering:
total reads: 4513533
total bases: 649899868
Q20 bases: 631935045(97.2358%)
Q30 bases: 606240851(93.2822%)

Filtering result:
reads passed filter: 4513533
reads failed due to low quality: 12903
reads failed due to too many N: 6154
reads failed due to too short: 11389
reads with adapter trimmed: 18925
bases trimmed due to adapters: 1685822

Duplication rate (may be overestimated since this is SE data): 63.4094%

JSON report: SekiuWA_FG003.json
HTML report: SekiuWA_FG003.html

fastp -i SekiuWA_FG003.F.fq.gz -o SekiuWA_FG003.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG003.json -h SekiuWA_FG003.html 
fastp v0.20.0, time used: 45 seconds