WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
AAGTTAGACCAAACCATGAAACCAACATAAACATTATTGCCCGGCGTACGGGGAAGGACG

Read1 before filtering:
total reads: 6025454
total bases: 867665376
Q20 bases: 842717377(97.1247%)
Q30 bases: 809152266(93.2563%)

Read1 after filtering:
total reads: 5990497
total bases: 862485267
Q20 bases: 839496573(97.3346%)
Q30 bases: 806461796(93.5044%)

Filtering result:
reads passed filter: 5990497
reads failed due to low quality: 18312
reads failed due to too many N: 8464
reads failed due to too short: 8181
reads with adapter trimmed: 31308
bases trimmed due to adapters: 1320763

Duplication rate (may be overestimated since this is SE data): 59.6056%

JSON report: SekiuWA_FG002.json
HTML report: SekiuWA_FG002.html

fastp -i SekiuWA_FG002.F.fq.gz -o SekiuWA_FG002.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG002.json -h SekiuWA_FG002.html 
fastp v0.20.0, time used: 58 seconds