WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
ACAAGCGCAAGAGTAAACATAGTGCCATGCTCAGGAACAAAGAAACGCGGCACAGAATGT

Read1 before filtering:
total reads: 5857080
total bases: 843419520
Q20 bases: 818652885(97.0635%)
Q30 bases: 785138757(93.0899%)

Read1 after filtering:
total reads: 5818265
total bases: 836740708
Q20 bases: 813753955(97.2528%)
Q30 bases: 780775529(93.3115%)

Filtering result:
reads passed filter: 5818265
reads failed due to low quality: 15918
reads failed due to too many N: 7905
reads failed due to too short: 14992
reads with adapter trimmed: 52599
bases trimmed due to adapters: 3243861

Duplication rate (may be overestimated since this is SE data): 60.5949%

JSON report: SekiuWA_FG001.json
HTML report: SekiuWA_FG001.html

fastp -i SekiuWA_FG001.F.fq.gz -o SekiuWA_FG001.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j SekiuWA_FG001.json -h SekiuWA_FG001.html 
fastp v0.20.0, time used: 55 seconds