WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
>TruSeq2_PE_r
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG

Read1 before filtering:
total reads: 3991082
total bases: 574715808
Q20 bases: 555706977(96.6925%)
Q30 bases: 523991895(91.1741%)

Read1 after filtering:
total reads: 3967129
total bases: 568988947
Q20 bases: 551636363(96.9503%)
Q30 bases: 520661148(91.5064%)

Filtering result:
reads passed filter: 3967129
reads failed due to low quality: 9584
reads failed due to too many N: 5670
reads failed due to too short: 8699
reads with adapter trimmed: 97553
bases trimmed due to adapters: 3489775

Duplication rate (may be overestimated since this is SE data): 76.2531%

JSON report: PortGambleWA_FG197.json
HTML report: PortGambleWA_FG197.html

fastp -i PortGambleWA_FG197.F.fq.gz -o PortGambleWA_FG197.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j PortGambleWA_FG197.json -h PortGambleWA_FG197.html 
fastp v0.20.0, time used: 38 seconds